Effect of Feeding Wet Feed or Wet Feed Fermented by Bacillus licheniformis on Growth Performance, Histopathology and Growth and Lipid Metabolism Marker Genes in Broiler Chickens
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Birds and Experimental Diets
2.2. Growth Performance
2.3. Nutrients Digestibility
2.4. Blood Biochemistry
2.5. Morphometry of Intestine
2.6. Real-Time Polymerase Chain Reaction (RT-PCR)
2.7. Statistical Analysis
3. Results
3.1. Growth Performance
3.2. Blood Biochemistry
3.3. Morphometry of Intestine
3.4. Expression of Growth- and Lipid Metabolism-Related Genes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Abo Ghanima, M.M.; Bin-Jumah, M.; Abdel-Moneim, A.M.E.; Khafaga, A.F.; Abd El-Hack, M.E.; Allam, A.A. Impacts of Strain Variation on Response to Heat Stress and Boldo Extract Supplementation to Broiler Chickens. Animals 2020, 10, 24. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hirakawa, R.; Nurjanah, S.; Furukawa, K.; Murai, A.; Kikusato, M.; Nochi, T.; Toyomizu, M. Heat stress causes immune abnormalities via massive damage to effect proliferation and differentiation of lymphocytes in broiler chickens. Front. Vet. Sci. 2020, 7, 46. [Google Scholar] [CrossRef] [PubMed]
- Melesse, A.; Maak, S.; Schmidt, R.; Von Lengerken, G. Effect of long-term heat stress on key enzyme activities and T3 levels in commercial layer hens. Inter. J. Livest. Product. 2011, 2, 107–116. [Google Scholar]
- Saleh, A.A.; Hayashi, K.; Ijiri, D.; Ohtsuka, A. Beneficial effects of Aspergillus awamori in broiler nutrition. World’s Poult. Sci. J. 2014, 70, 857–864. [Google Scholar] [CrossRef]
- Afsharmanesh, M.; Scott, T.; Silversides, F. A comparison of grinding processes and wet feeding of wheat-based diets on AME, production, and gastrointestinal tract development of broiler chicks. Can. J. Anim. Sci. 2006, 86, 255–261. [Google Scholar] [CrossRef]
- Akinola, O.; Onakomaiya, A.; Agunbiade, J.; Oso, A. Growth performance, apparent nutrient digestibility, intestinal morphology and carcass traits of broiler chickens fed dry, wet and fermented-wet feed. Livest. Sci. 2015, 177, 103–109. [Google Scholar] [CrossRef]
- Farghly, M.; Abd El-Hack, M.; Alagawany, M.; Saadeldin, I.; Swelum, A. Wet feed and cold water as heat stress modulators in growing Muscovy ducklings. Poult. Sci. 2018, 97, 1588–1594. [Google Scholar] [CrossRef]
- Abd El-Moneim, E.A.; El-Wardany, I.; Abu-Taleb, A.M.; Wakwak, M.M.; Ebeid, T.A.; Saleh, A.A. Assessment of in ovo administration of Bifidobacterium bifidum and Bifidobacterium longum on performance, ileal histomorphometry, blood hematological, and biochemical parameters of broilers. Probiotics Antimicrob. Proteins 2020, 12, 439–450. [Google Scholar] [CrossRef]
- Dei, H.; Bumbie, G. Effect of wet feeding on growth performance of broiler chickens in a hot climate. Br. Poult. Sci. 2011, 52, 82–85. [Google Scholar] [CrossRef]
- Afsharmanesh, M.; Lotfi, M.; Mehdipour, Z. Effects of wet feeding and early feed restriction on blood parameters and growth performance of broiler chickens. Anim. Nut. 2016, 2, 168–172. [Google Scholar] [CrossRef]
- Tabeidian, S.; Toghyani, M.; Toghyani, A.; Barekatain, M.; Toghyani, M. Effect of pre-starter diet ingredients and moisture content on performance, yolk sac utilization and small intestine morphology in broiler chickens. J. Appl. Anim. Res. 2015, 43, 157–165. [Google Scholar] [CrossRef] [Green Version]
- Atapattu, N.; Sudusinghe, H. Wet feeding mitigates the adverse effects of high dietary rice bran levels on growth performance and nitrogen retention of broiler chickens. Iran. J. Appl. Anim. Sci. 2013, 3, 153–160. [Google Scholar]
- Emadinia, A.; Toghyani, M.; Gheisari, A.; Tabeidian, S.A.; Ale Saheb Fosoul, S.S.; Mohammadrezaei, M. Effect of wet feeding and enzyme supplementation on performance and immune responses of broiler chicks. J. Appl. Anim. Res. 2014, 42, 32–37. [Google Scholar] [CrossRef] [Green Version]
- Liu, Z.; Huang, X.; Luo, Y.; Xue, J.; Wang, Q.; Wang, Y.; Wang, C. Effect of Dry and Wet Feed on Growth Performance, Carcass Traits, and Apparent Nutrient Digestibility in Geese. J. Appl. Poult. Res. 2019, 28, 1115–1120. [Google Scholar] [CrossRef]
- Saleh, A.A.; Ohtsuka, A.; Yamamoto, M.; Hayashi, K. Aspergillus awamori feeding modifies lipid metabolism in rats. BioMed Res. Internat. 2013, 2013, 594393. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Larsen, N.; Thorsen, L.; Kpikpi, E.N.; Stuer-Lauridsen, B.; Cantor, M.D.; Nielsen, B. Characterization of Bacillus spp. strains for use as probiotic additives in pig feed. Appl. Microbiol. Biotechnol. 2014, 98, 1105–1118. [Google Scholar] [CrossRef]
- Saleh, A.A.; Paray, B.A.; Dawood, M.A.O. Olive Cake Meal and Bacillus licheniformis Impacted the Growth Performance, Muscle Fatty Acid Content, and Health Status of Broiler Chickens. Animals 2020, 10, 695. [Google Scholar] [CrossRef]
- Pedersen, C.; Lindberg, J.E. Effect of fermentation in a liquid diet on nitrogen metabolism in growing pigs. Publ. Eur. Assoc. Anim. Product. 2003, 109, 641–644. [Google Scholar]
- Scholten, R.H.; Van der Peet-Schwering, C.M.; Verstegen, M.W.; Den Hartog, L.; Schrama, J.; Vesseur, P. Fermented co-products and fermented compound diets for pigs: A review. Anim. Feed Sci. Technol. 1999, 82, 1–19. [Google Scholar] [CrossRef]
- Afsharmanesh, M.; Barani, M.; Silversides, F. Evaluation of wet-feeding wheat-based diets containing Saccharomyces cerevisiae to broiler chickens. Br. Poult. Sci. 2010, 51, 776–783. [Google Scholar] [CrossRef]
- NRC. Nutrition Requirements of Poultry, 9th ed.; National Academy Press: Washington, DC, USA, 1994. [Google Scholar]
- Heres, L.; Engel, B.; Van Knapen, F.; de Jong, M.; Wagenaar, J.; Urlings, H. Fermented liquid feed reduces susceptibility of broilers for Salmonella enteritidis. Poult. Sci. 2003, 82, 603–611. [Google Scholar] [CrossRef] [PubMed]
- Abdel-Moneim, A.E.; Elbaz, A.M.; Khidr, R.E.; Badri, F.B. Effect of in ovo inoculation of Bifidobacterium spp. on growth performance, thyroid activity, ileum histomorphometry and microbial enumeration of broilers. Probiotics Antimicrob. Proteins 2020, 12, 873–882. [Google Scholar] [CrossRef] [PubMed]
- Abdel-Moneim, E.A.; Selim, D.A.; Basuony, H.A.; Sabic, E.M.; Saleh, A.A.; Ebeid, T.A. Effect of dietary supplementation of Bacillus subtilis spores on growth performance, oxidative status, and digestive enzyme activities in Japanese quail birds. Trop. Anim. Health Pro. 2020, 52, 671–680. [Google Scholar] [CrossRef] [PubMed]
- AOAC. Official Methods of Analysis of AOAC, 17th ed.; AOAC: Gaithersburg, MD, USA, 2003. [Google Scholar]
- Jacobsen, D.; Gertovey, S.; Nielson, H. Digestibility trials with poultry. 322 Bertning fra forsg slabooratoriel udgbet of statens. In Husdyrbugsudvaly–Kobengaven; Københavns Universitet: Copenhagen, Denmark, 1960. [Google Scholar]
- Bancroft, J.D.; Layton, C. The hematoxylins and eosin. In Bancroft’s Theory and Practice of Histological Techniques, 8th ed.; Suvarna, S.K., Layton, C., Bancroft, J.D., Eds.; Elsevier: Churchill Livingstone, UK, 2019; pp. 126–138. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Scott, T.; Silversides, F. Defining the effects of wheat type, water inclusion level, and wet-diet restriction on variability in performance of broilers fed wheat-based diets with added water. Can. J. Anim. Sci. 2003, 83, 265–272. [Google Scholar] [CrossRef]
- Saleh, A.A.; Hayashi, K.; Ijiri, D.; Ohtsuka, A. The influence of dietary supplementation with Aspergillus awamori and feeding canola seed on the growth performance and meat quality in male broilers chickens. J. Anim. Sci. 2015, 86, 305–311. [Google Scholar] [CrossRef]
- Yasar, S.; Forbes, J. Enzyme supplementation of dry and wet wheat-based feeds for broiler chickens: Performance and gut responses. Br. J. Nut. 2000, 84, 297–307. [Google Scholar] [CrossRef] [Green Version]
- Saleh, A.A.; Gálik, B.; Arpášová, H.; Capcarová, M.; Kalafová, A.; Šimko, M.; Juráček, M.; Rolinec, M.; Bíro, D.; Abudabos, A.M. Synergistic effect of feeding Aspergillus Awamori and Lactic acid bacteria on performance, egg traits, egg yolk cholesterol and fatty acid profile in laying hens. Ital. J. Anim. Sci. 2017, 16, 132–139. [Google Scholar] [CrossRef] [Green Version]
- Yasar, S. Performance and gastro-intestinal response of broiler chickens fed on cereal grain-based foods soaked in water. Br. Poult. Sci. 1999, 40, 65–76. [Google Scholar] [CrossRef]
- Yasar, S.; Forbes, J. Nutritional value of wet and dry grain based diets for broiler chickens. Br. Poult. Sci. 1996, 37, S82. [Google Scholar]
- Liu, X.; Yan, H.; Le Lv, Q.X.; Yin, C.; Zhang, K.; Wang, P.; Hu, J. Growth performance and meat quality of broiler chickens supplemented with Bacillus licheniformis in drinking water. Asian Australas. J. Anim. Sci. 2012, 25, 682–688. [Google Scholar] [CrossRef] [PubMed]
- Gong, L.; Wang, B.; Mei, X.; Xu, H.; Qin, Y.; Li, W.; Zhou, Y. Effects of three probiotic Bacillus on growth performance, digestive enzyme activities, antioxidative capacity, serum immunity, and biochemical parameters in broilers. Anim. Sci. J. 2018, 89, 1561–1571. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.C.; Yu, Y.H. Bacillus licheniformis–fermented products improve growth performance and the fecal microbiota community in broilers. Poult. Sci. 2020, 99, 1432–1443. [Google Scholar] [CrossRef] [PubMed]
- Canibe, N.; Højberg, O.; Badsberg, J.H.; Jensen, B.B. Effect of feeding fermented liquid feed and fermented grain on gastrointestinal ecology and growth performance in piglets. J. Anim. Sci. 2007, 85, 2959–2971. [Google Scholar] [CrossRef] [Green Version]
- Abou-Kassem, D.; Elsadek, M.; Abdel-Moneim, A.; Mahgoub, S.; Elaraby, G.; Taha, A.; Ashour, E. Growth, carcass characteristics, meat quality and microbial aspects of growing quail fed diets enriched with two different types of probiotics (Bacillus toyonensis and Bifidobacterium bifidum). Poult. Sci. 2020, in press. [Google Scholar] [CrossRef]
- Lin, E.R.; Cheng, Y.H.; Hsiao, F.S.H.; Proskura, W.S.; Dybus, A.; Yu, Y.H. Optimization of solid-state fermentation conditions of Bacillus licheniformis and its effects on Clostridium perfringens-induced necrotic enteritis in broilers. Rev. Bras. Zootec. 2019, 48. [Google Scholar] [CrossRef] [Green Version]
- Uchewa, E.; Onu, P. The effect of feed wetting and fermentation on the performance of broiler chick. Biotechnol. Anim. Husb. 2012, 28, 433–439. [Google Scholar] [CrossRef]
- Mikkelsen, L.; Jensen, B. Feeding liquid diets to pigs. In Recent Developments in Pig Nutrition; Wiseman, J., Gansworthy, P., Eds.; Nottingham University Press: Thrumpton, UK, 2001; pp. 379–398. [Google Scholar]
- Yang, J.; Jung, H.; Xuan, Z.; Kim, J.; Kim, D.; Chae, B.; Han, I.K. Effects of feeding and processing methods of diets on performance, morphological changes in the small intestine and nutrient digestibility in growing-finishing pigs. Asian Australas. J. Anim. Sci. 2001, 14, 1450–1459. [Google Scholar] [CrossRef]
- Sabatini, D.M. mTOR signaling in growth control and disease. Cell 2012, 149, 274–293. [Google Scholar]
- Sengupta, S.; Peterson, T.R.; Sabatini, D.M. Regulation of the mTOR complex 1 pathway by nutrients, growth factors, and stress. Mol. Cell 2010, 40, 310–322. [Google Scholar] [CrossRef] [Green Version]
- Deng, B.; Zhang, F.; Wen, J.; Ye, S.; Wang, L.; Yang, Y.; Jiang, S. The function of myostatin in the regulation of fat mass in mammals. Nutr. Metab. 2017, 14, 1–6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xu, C.; Li, X.F.; Tian, H.Y.; Jiang, G.Z.; Liu, W.B. Feeding rates affect growth, intestinal digestive and absorptive capabilities and endocrine functions of juvenile blunt snout bream Megalobrama amblycephala. Fish Physiol. Biochem. 2016, 42, 689–700. [Google Scholar] [CrossRef] [PubMed]
- Butler, A.A.; Roith, D.L. Control of growth by the somatropic axis: Growth hormone and the insulin-like growth factors have related and independent roles. Annu. Rev. Physiol. 2001, 63, 141–164. [Google Scholar] [CrossRef] [PubMed]
- Theil, P.K.; Lauridsen, C. Interactions between dietary fatty acids and hepatic gene expression in livers of pigs during the weaning period. Livest. Sci. 2007, 3, 26–29. [Google Scholar] [CrossRef]
- Wang, X.; Tian, W. Green tea epigallocatechin gallate: A natural inhibitor of fatty-acid synthase. Biochem. Biophys. Res. Commun. 2001, 288, 1200–1206. [Google Scholar] [CrossRef]
- Wang, Y.; Mu, Y.; Li, H.; Ding, N.; Wang, Q.; Wang, S.; Wang, N. Peroxisome proliferator-activated receptor-γ gene: A key regulator of adipocyte differentiation in chickens. Poult. Sci. 2008, 87, 226–232. [Google Scholar] [CrossRef]
- Xiong, M.; Li, S.; Peng, X.; Feng, Y.; Yu, G.; Xin, Q.; Gong, Y. Adipogenesis in ducks interfered by small interfering ribonucleic acids of peroxisome proliferator-activated receptor γ gene. Poult. Sci. 2010, 89, 88–95. [Google Scholar] [CrossRef]
- Abdel-Moneim, A.M.E.; Sabic, E.; Abu-Taleb, A.; Ibrahim, N. Growth performance, hemato-biochemical indices, thyroid activity, antioxidant status, and immune response of growing Japanese quail fed diet with full-fat canola seeds. Trop. Anim. Health Pro. 2020, 2, 1–10. [Google Scholar] [CrossRef]
- Hermier, D. Lipoprotein metabolism and fattening in poultry. J. Nutrit. 1997, 127, 805S–808S. [Google Scholar] [CrossRef]
- Royan, M.; Meng, G.Y.; Othman, F.; Sazili, A.Q.; Navidshad, B. Effects of conjugated linoleic acid, fish oil and soybean oil on PPARs (α & γ) mRNA expression in broiler chickens and their relation to body fat deposits. Internat. J. Mol. Sci. 2011, 12, 8581–8595. [Google Scholar]
- Dawood, M.A.O.; Magouz, F.I.; Mansour, M.; Saleh, A.A.; Asely, A.M.E.; Fadl, S.E.; Ahmed, H.A.; Al-Ghanim, K.A.; Mahboob, S.; Al-Misned, F. Evaluation of Yeast Fermented Poultry By-Product Meal in Nile Tilapia (Oreochromis niloticus) Feed: Effects on Growth Performance, Digestive Enzymes Activity, Innate Immunity, and Antioxidant Capacity. Front. Vet. Sci. 2020, 6, 516. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Saleh, A.; El-Magd, M. Beneficial effects of dietary silver nanoparticles and silver nitrate on broiler nutrition. Environ. Sci. Pollut. Res. 2018, 25, 27031–27038. [Google Scholar] [CrossRef] [PubMed]
- Abudabos, A.; Ali, M.H.; Nassan, M.A.; Saleh, A.A. Ameliorative Effect of Bacillus subtilis on Growth Performance and Intestinal Architecture in Broiler Infected with Salmonella. Animals 2019, 9, 190. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Saleh, A.A.; Elnagar, A.M.; Eid, Y.Z.; Ebeid, T.A.; Amber, K.A. Effect of feeding wheat middlings and calcium lignosulfonate as pellet binders on pellet quality, growth performance, and lipid peroxidation in broiler chickens. Vet. Med. Sci. 2020, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Saleh, A.A.; Ijiri, D.; Ohtsuka, A. Effects of summer shield supplementation on the growth performance, nutrient utilization, and plasma lipid profiles in broiler chickens. Vet. Med. 2014, 59, 536–542. [Google Scholar] [CrossRef] [Green Version]
- Zhou, M.; Zeng, D.; Ni, X.; Tu, T.; Yin, Z.; Pan, K.; Jing, B. Effects of Bacillus licheniformis on the growth performance and expression of lipid metabolism-related genes in broiler chickens challenged with Clostridium perfringens-induced necrotic enteritis. Lipids Health Dis. 2016, 15, 1–10. [Google Scholar] [CrossRef] [Green Version]
Ingredients | Starter (1–21 Day) | Grower (22–35 Day) |
---|---|---|
Yellow corn, % | 54.03 | 58.98 |
Soybean meal (44%), % | 34.50 | 29.50 |
Corn germ (62%), % | 5.50 | 5.50 |
Soya oil, % | 1.80 | 2.30 |
Limestone, % | 1.08 | 0.95 |
Di-Calcium Phosphate, % | 2.00 | 1.75 |
Premix 1, % | 0.30 | 0.30 |
NaCl, % | 0.30 | 0.30 |
L-lysine, % | 0.29 | 0.24 |
DL-Methionine, % | 0.20 | 0.18 |
Calculated composition 2 (%) | ||
Metabolizable energy (ME, kcal kg−1) | 3001 | 3180 |
Crude protein | 23.12 | 20.99 |
Calcium | 0.99 | 0.89 |
Potassium | 0.54 | 0.52 |
Available Phosphorus | 0.51 | 0.46 |
Digestible methio + Cys | 0.93 | 0.89 |
Digestible methionine | 0.59 | 0.52 |
Digestible lysine | 1.43 | 1.24 |
Digestible arginine | 1.25 | 1.07 |
Digestible tryptophan | 0.19 | 0.17 |
Gene 1 | Forward | Reverse | Accession Number |
---|---|---|---|
IGF-1 | CATTTCTTCTACCTTGGC | TCATCCACTATTCCCTTG | M32791 |
mTOR | CCAGGATTCTTCGGACTA | CCATCACAAACCCTTATT | XM_417614 |
Myostatin | GGGACGTTATTAAGCAGC | ACTCCGTAGGCATTGTGA | NM 001001461 |
GH | CACCACAGCTAGAGACCCACATC | CCCACCGGCTCAAACTGC | HE608816 |
Myogenin | GCGGAGGCTGAAGAAGGT | AGGCGCTCGATGTACTGG | NM_204184.1 |
LPL | TTGGTGACCTGCTTATGCTA | TGCTGCCTCTTCTCCTTTAC | NM_205282 |
PPARγ | TCGCATCCATAAGAAAAGCA | CTTCTCCTTCTCCGCTTCGT | NM_001001460.1 |
FAS | CCAACGATTACCCGTCTCAA | CAGGCTCTGTATGCTGTCCAA | J03860 |
GAPDH | GGTGAAAGTCGGAGTCAACGG | CGATGAAGGGATCATTGATGGC | NM_204305 |
Item | Dry Feed | Wet Feed | Fermented Wet Feed | SEM 1 | p-Value |
---|---|---|---|---|---|
Initial body weight ‘g’ | 49.32 | 49.35 | 49.31 | 0.128 | 0.991 |
Final body weight ‘g’ | 1842.6 a | 1765.0 b | 1814.5 a | 9.715 | <0.001 |
Weight gain ‘g·bird·day−1’ | 51.23 a | 49.03 b | 50.43 a | 0.276 | <0.001 |
Feed intake ‘g·bird·day−1’ | 77.93 | 81.60 | 79.38 | 0.646 | 0.055 |
Feed conversion ratio ‘g feed·g gain−1’ | 1.52 b | 1.66 a | 1.57 b | 0.075 | <0.001 |
Crude protein ‘%’ | 64.83 b | 63.83 b | 68.33 a | 0.642 | 0.003 |
Ether extract ‘%’ | 83.83 | 83.67 | 84.33 | 0.431 | 0.825 |
Crude fiber ‘%’ | 22.67 | 23.83 | 23.17 | 0.319 | 0.345 |
Item | Dry Feed | Wet Feed | Fermented Wet Feed | SEM 1 | p-Value |
---|---|---|---|---|---|
Dressing | 70.92 | 70.45 | 70.69 | 0.447 | 0.923 |
Carcass yield | 74.88 | 74.51 | 74.50 | 0.412 | 0.933 |
Liver | 2.74 | 2.89 | 2.67 | 0.079 | 0.538 |
Gizzard | 1.21 | 1.17 | 1.14 | 0.028 | 0.600 |
Heart | 0.505 | 0.552 | 0.608 | 0.025 | 0.247 |
Spleen | 0.117 | 0.147 | 0.173 | 0.015 | 0.307 |
Abdominal fat | 1.41 | 1.18 | 1.20 | 0.083 | 0.479 |
Breast | 23.84 | 22.17 | 23.90 | 0.537 | 0.352 |
Thigh | 15.78 | 15.79 | 15.49 | 0.288 | 0.898 |
Item | Dry Feed | Wet Feed | Fermented Wet Feed | SEM 1 | p-Value |
---|---|---|---|---|---|
Total protein ‘g·dL−1’ | 5.52 | 5.53 | 5.42 | 0.174 | 0.964 |
Albumin ‘g·dL−1’ | 1.55 | 1.52 | 1.62 | 0.043 | 0.653 |
Globulin ‘g·dL−1’ | 3.97 | 4.01 | 3.80 | 0.175 | 0.888 |
Albumin/globulin ratio | 0.407 | 0.395 | 0.437 | 0.021 | 0.741 |
AST ‘U·L−1’ | 257.8 | 252.0 | 246.2 | 9.048 | 0.884 |
ALT ‘U·L−1’ | 5.50 | 6.00 | 4.32 | 0.560 | 0.479 |
Glucose ‘mg·dL−1’ | 162.3 | 161.2 | 154.7 | 7.904 | 0.922 |
Triglycerides ‘mg·dL−1’ | 60.17 | 55.83 | 55.33 | 4.407 | 0.898 |
Total cholesterol ‘mg·dL−1’ | 124.7 | 119.0 | 118.5 | 4.697 | 0.854 |
VLDL-cholesterol ‘mg·dL−1’ | 12.03 | 11.17 | 11.06 | 0.882 | 0.899 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Saleh, A.A.; Shukry, M.; Farrag, F.; Soliman, M.M.; Abdel-Moneim, A.-M.E. Effect of Feeding Wet Feed or Wet Feed Fermented by Bacillus licheniformis on Growth Performance, Histopathology and Growth and Lipid Metabolism Marker Genes in Broiler Chickens. Animals 2021, 11, 83. https://doi.org/10.3390/ani11010083
Saleh AA, Shukry M, Farrag F, Soliman MM, Abdel-Moneim A-ME. Effect of Feeding Wet Feed or Wet Feed Fermented by Bacillus licheniformis on Growth Performance, Histopathology and Growth and Lipid Metabolism Marker Genes in Broiler Chickens. Animals. 2021; 11(1):83. https://doi.org/10.3390/ani11010083
Chicago/Turabian StyleSaleh, Ahmed A., Mustafa Shukry, Foad Farrag, Mohamed M. Soliman, and Abdel-Moneim Eid Abdel-Moneim. 2021. "Effect of Feeding Wet Feed or Wet Feed Fermented by Bacillus licheniformis on Growth Performance, Histopathology and Growth and Lipid Metabolism Marker Genes in Broiler Chickens" Animals 11, no. 1: 83. https://doi.org/10.3390/ani11010083