Novel Protozoans in Austria Revealed through the Use of Dogs as Sentinels for Ticks and Tick-Borne Pathogens
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ticks
2.2. DNA Extraction
2.3. Reverse Line Blot-PCR
2.4. Molecular Confirmation of Morphological Identification of Ixodes Ricinus
2.5. Sequencing
3. Results
3.1. Identification of Ixodes Ticks by Sequencing
3.2. Molecular Detection of Tick-Borne Microorganisms
3.3. Rickettsia raoultii Sequencing
4. Discussion and Conclusions
4.1. Tick Collecting
4.2. Molecular Identification of Ixodes Ticks
4.3. Tick-Borne Microorganisms Screening
4.4. Rickettsia raoultii Strain Jongejan
4.5. Theileria capreoli
4.6. Babesia spp.
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Wijnveld, M.; Schötta, A.-M.; Pintér, A.; Stockinger, H.; Stanek, G. Novel Rickettsia raoultii strain isolated and propagated from Austrian Dermacentor reticulatus ticks. Parasites Vectors 2016, 9, 567. [Google Scholar] [CrossRef] [Green Version]
- Portillo, A.; Santibáñez, S.; García-Álvarez, L.; Palomar, A.M.; Oteo, J.A. Rickettsioses in Europe. Microbes Infect. 2015, 17, 834–838. [Google Scholar] [CrossRef]
- Mediannikov, O.; Matsumoto, K.; Samoylenko, I.; Drancourt, M.; Roux, V.; Rydkina, E.; Davoust, B.; Tarasevich, I.; Brouqui, P.; Fournier, P.E. Rickettsia raoultii sp. nov., a spotted fever group rickettsia associated with Dermacentor ticks in Europe and Russia. Int. J. Syst. Evol. Microbiol. 2008, 58, 1635–1639. [Google Scholar] [CrossRef] [Green Version]
- Schötta, A.-M.; Wijnveld, M.; Stockinger, H.; Stanek, G. Approaches for Reverse Line Blot-Based Detection of Microbial Pathogens in Ixodes ricinus Ticks Collected in Austria and Impact of the Chosen Method. Appl. Environ. Microbiol. 2017, 83, e00489-17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chmielewski, T.; Podsiadly, E.; Karbowiak, G.; Tylewska-Wierzbanowska, S. Rickettsia spp. In ticks, Poland. Emerg. Infect. Dis. 2009, 15, 486–488. [Google Scholar] [CrossRef]
- Piotrowski, M.; Rymaszewska, A. Expansion of tick-borne rickettsioses in the world. Microorganisms 2020, 8, 1906. [Google Scholar] [CrossRef] [PubMed]
- Buczek, W.; Koman-Iżko, A.; Buczek, A.; Buczek, A.; Bartosik, K.; Kulina, D.; Ciura, D. Spotted fever group rickettsiae transmitted by Dermacentor ticks and determinants of their spread in Europe. Ann. Agric. Environ. Med. 2020, 27, 505–511. [Google Scholar] [CrossRef] [PubMed]
- Tomassone, L.; Portillo, A.; Nováková, M.; de Sousa, R.; Oteo, J.A. Neglected aspects of tick-borne rickettsioses. Parasites Vectors 2018, 11, 263. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Duscher, G.G.; Feiler, A.; Leschnik, M.; Joachim, A. Seasonal and spatial distribution of ixodid tick species feeding on naturally infested dogs from Eastern Austria and the influence of acaricides/repellents on these parameters. Parasites Vectors 2013, 6, 76. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schouls, L.M.; Van De Pol, I.; Rijpkema, S.G.T.; Schot, C.S. Detection and Identification of Ehrlichia, Borrelia burgdorferi Sensu Lato, and Bartonella Species in Dutch Ixodes ricinus Ticks. J. Clin. Microbiol. 1999, 37, 2215–2222. [Google Scholar] [CrossRef] [Green Version]
- Bekker, C.P.; de Vos, S.; Taoufik, A.; Sparagano, O.A..; Jongejan, F. Simultaneous detection of Anaplasma and Ehrlichia species in ruminants and detection of Ehrlichia ruminantium in Amblyomma variegatum ticks by reverse line blot hybridization. Vet. Microbiol. 2002, 89, 223–238. [Google Scholar] [CrossRef]
- Georges, K.; Loria, G.; Riili, S.; Greco, A.; Caracappa, S.; Jongejan, F.; Sparagano, O. Detection of haemoparasites in cattle by reverse line blot hybridisation with a note on the distribution of ticks in Sicily. Vet. Parasitol. 2001, 99, 273–286. [Google Scholar] [CrossRef]
- Rijpkema, S.G.; Molkenboer, M.J.; Schouls, L.M.; Jongejan, F.; Schellekens, J.F. Simultaneous detection and genotyping of three genomic groups of Borrelia burgdorferi sensu lato in Dutch Ixodes ricinus ticks by characterization of the amplified intergenic spacer region between 5S and 23S rRNA genes. J. Clin. Microbiol. 1995, 33, 3091–3095. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nijhof, A.M.; Bodaan, C.; Postigo, M.; Nieuwenhuijs, H.; Opsteegh, M.; Franssen, L.; Jebbink, F.; Jongejan, F. Ticks and associated pathogens collected from domestic animals in the Netherlands. Vector Borne Zoonotic Dis. 2007, 7, 585–595. [Google Scholar] [CrossRef]
- Christova, I.; Van De Pol, J.; Yazar, S.; Velo, E.; Schouls, L. Identification of Borrelia burgdorferi sensu lato, Anaplasma and Ehrlichia species, and spotted fever group Rickettsiae in ticks from Southeastern Europe. Eur. J. Clin. Microbiol. Infect. Dis. 2003, 22, 535–542. [Google Scholar] [CrossRef] [PubMed]
- Jado, I.; Escudero, R. Molecular method for identification of Rickettsia species in clinical and environmental samples. J. Clin. Microbiol. 2006, 44, 4572–4576. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sekeyova, Z.; Roux, V.; Raoult, D. Phylogeny of Rickettsia spp. inferred by comparing sequences of “gene D”, which encodes an intracytoplasmic protein. Int. J. Syst. Evol. Microbiol. 2001, 51, 1353–1360. [Google Scholar] [CrossRef] [Green Version]
- Fournier, P.; Roux, V.; Raoult, D. Phylogenetic analysis of spotted fever group rickettsiae by study of the outer surface protein rOmpA. Int. J. Syst. Bacteriol. 1998, 48, 839–849. [Google Scholar] [CrossRef] [Green Version]
- Roux, V.; Raoult, D. Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer-membrane protein rOmpB (ompB). Int. J. Syst. Evol. Microbiol. 2000, 50, 1449–1455. [Google Scholar] [CrossRef] [Green Version]
- Labruna, M.B.; Whitworth, T.; Horta, M.C.; Bouyer, D.H.; McBride, J.W.; Pinter, A.; Popov, V.; Gennari, S.M.; Walker, D.H. Rickettsia Species Infecting Amblyomma cooperi Ticks from an Area in the State of Sao Paulo, Brazil, Where Brazilian Spotted Fever Is Endemic. J. Clin. Microbiol. 2004, 42, 90–98. [Google Scholar] [CrossRef] [Green Version]
- Black, W.C.; Piesman, J. Phylogeny of hard- and soft-tick taxa (Acari: Ixodida) based on mitochondrial 16S rDNA sequences. Proc. Natl. Acad. Sci. USA 1994, 91, 10034–10038. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Anderson, J.M.J.J.M.; Ammerman, N.C.; Norris, D.E. Molecular Differentiation of Metastriate Tick Immatures. Vector-Borne Zoonotic Dis. 2004, 4, 334–343. [Google Scholar] [CrossRef] [Green Version]
- Estrada-Peña, A.; Nava, S.; Petney, T. Description of all the stages of Ixodes inopinatus n. sp. (Acari: Ixodidae). Ticks Tick Borne Dis. 2014, 5, 734–743. [Google Scholar] [CrossRef]
- Estrada-Peña, A.; Gray, J.S.; Kahl, O.; Lane, R.S.; Nijhof, A.M. Research on the ecology of ticks and tick-borne pathogens—methodological principles and caveats. Front. Cell. Infect. Microbiol. 2013, 3, 29. [Google Scholar] [CrossRef] [Green Version]
- Gray, J.S. A carbon dioxide trap for prolonged sampling of Ixodes ricinus L. populations. Exp. Appl. Acarol. 1985, 1, 35–44. [Google Scholar] [CrossRef]
- Moraes-Filho, J.; Costa, F.B.; Gerardi, M.; Soares, H.S.; Labruna, M.B. Rickettsia rickettsii Co-feeding Transmission among Amblyomma aureolatum Ticks. Emerg. Infect. Dis. 2018, 24, 2041–2048. [Google Scholar] [CrossRef] [Green Version]
- Špitalská, E.; Boldišová, E.; Štefanidesová, K.; Kocianová, E.; Majerčíková, Z.; Tarageľová, V.R.; Selyemová, D.; Chvostáč, M.; Derdáková, M.; Škultéty, Ľ. Pathogenic microorganisms in ticks removed from Slovakian residents over the years 2008–2018. Ticks Tick Borne Dis. 2021, 12. [Google Scholar] [CrossRef] [PubMed]
- Szekeres, S.; Claudia Coipan, E.; Rigó, K.; Majoros, G.; Jahfari, S.; Sprong, H.; Földvári, G. Candidatus Neoehrlichia mikurensis and Anaplasma phagocytophilum in natural rodent and tick communities in Southern Hungary. Ticks Tick Borne Dis. 2015, 6, 111–116. [Google Scholar] [CrossRef]
- Takumi, K.; Hofmeester, T.R.; Sprong, H. Red and fallow deer determine the density of Ixodes ricinus nymphs containing Anaplasma phagocytophilum. Parasites Vectors 2021, 14, 59. [Google Scholar] [CrossRef] [PubMed]
- Remesar, S.; Díaz, P.; Prieto, A.; García-Dios, D.; Panadero, R.; Fernández, G.; Brianti, E.; Díez-Baños, P.; Morrondo, P.; López, C.M. Molecular detection and identification of piroplasms ( Babesia spp. and Theileria spp.) and Anaplasma phagocytophilum in questing ticks from northwest Spain. Med. Vet. Entomol. 2020, 35, 51–58. [Google Scholar] [CrossRef]
- Christova, I.; Schouls, L.; van de Pol, I.; Park, J.; Panayotov, S.; Lefterova, V.; Kantardjiev, T.; Dumler, J.S. High Prevalence of Granulocytic Ehrlichiae and Borrelia burgdorferi Sensu Lato in Ixodes ricinus Ticks from Bulgaria. J. Clin. Microbiol. 2001, 39, 4172–4174. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hoepler, W.; Markowicz, M.; Schoetta, A.-M.; Zoufaly, A.; Stanek, G.; Wenisch, C. Molecular diagnosis of autochthonous human anaplasmosis in Austria–An infectious diseases case report. BMC Infect. Dis. 2020, 20, 288. [Google Scholar] [CrossRef]
- Kovryha, N.; Tsyhankova, A.; Zelenuchina, O.; Mashchak, O.; Terekhov, R.; Rogovskyy, A.S. Prevalence of Borrelia burgdorferi and Anaplasma phagocytophilum in Ixodid Ticks from Southeastern Ukraine. Vector-Borne Zoonotic Dis. 2021, 21, 242–246. [Google Scholar] [CrossRef] [PubMed]
- Zintl, A.; Zaid, T.; McKiernan, F.; Naranjo-Lucena, A.; Gray, J.; Brosnan, S.; Browne, J.; O’Connor, J.; Mee, J.F.; Good, B.; et al. Update on the presence of Ixodes ricinus at the western limit of its range and the prevalence of Borrelia burgdorferi sensu lato. Ticks Tick Borne Dis. 2020, 11, 101518. [Google Scholar] [CrossRef]
- Estrada-Peña, A.; Mihalca, A.D.; Petney, T.N. Ticks of Europe and North Africa; Estrada-Peña, A., Mihalca, A.D., Petney, T.N., Eds.; Springer International Publishing: Cham, Switzerland, 2017; ISBN 978-3-319-63759-4. [Google Scholar]
- Dunaj, J.; Trzeszczkowski, A.; Moniuszko-Malinowska, A.; Rutkowski, K.; Pancewicz, S. Assessment of tick-borne pathogens presence in Dermacentor reticulatus ticks in north-eastern Poland. Adv. Med. Sci. 2021, 66, 113–118. [Google Scholar] [CrossRef] [PubMed]
- Milhano, N.; de Carvalho, I.L.; Alves, A.S.; Arroube, S.; Soares, J.; Rodriguez, P.; Carolino, M.; Núncio, M.S.; Piesman, J.; de Sousa, R. Coinfections of Rickettsia slovaca and Rickettsia helvetica with Borrelia lusitaniae in ticks collected in a Safari Park, Portugal. Ticks Tick Borne Dis. 2010, 1, 172–177. [Google Scholar] [CrossRef]
- Mendoza-Roldan, J.A.; Colella, V.; Lia, R.P.; Nguyen, V.L.; Barros-Battesti, D.M.; Iatta, R.; Dantas-Torres, F.; Otranto, D. Borrelia burgdorferi (sensu lato) in ectoparasites and reptiles in southern Italy. Parasites Vectors 2019, 12, 35. [Google Scholar] [CrossRef]
- Norte, A.C.; Lopes de Carvalho, I.; Núncio, M.S.; Ramos, J.A.; Gern, L. Blackbirds Turdus merula as competent reservoirs for Borrelia turdi and Borrelia valaisiana in Portugal: Evidence from a xenodiagnostic experiment. Environ. Microbiol. Rep. 2013, 5, 604–607. [Google Scholar] [CrossRef]
- Wass, L.; Grankvist, A.; Bell-Sakyi, L.; Bergström, M.; Ulfhammer, E.; Lingblom, C.; Wennerås, C. Cultivation of the causative agent of human neoehrlichiosis from clinical isolates identifies vascular endothelium as a target of infection. Emerg. Microbes Infect. 2019, 8, 413–425. [Google Scholar] [CrossRef] [Green Version]
- Garcia-Vozmediano, A.; Krawczyk, A.I.; Sprong, H.; Rossi, L.; Ramassa, E.; Tomassone, L. Ticks climb the mountains: Ixodid tick infestation and infection by tick-borne pathogens in the Western Alps. Ticks Tick Borne Dis. 2020, 11, 101489. [Google Scholar] [CrossRef]
- Pedersen, B.N.; Jenkins, A.; Paulsen, K.M.; Okbaldet, Y.B.; Edgar, K.S.; Lamsal, A.; Soleng, A.; Andreassen, Å.K. Distribution of Neoehrlichia mikurensis in Ixodes ricinus ticks along the coast of Norway: The western seaboard is a low-prevalence region. Zoonoses Public Health 2020, 67, 130–137. [Google Scholar] [CrossRef]
- Hildebrandt, A.; Gray, J.S.; Hunfeld, K.P. Human Babesiosis in Europe: What clinicians need to know. Infection 2013, 41, 1057–1072. [Google Scholar] [CrossRef] [PubMed]
- Bloch, E.M.; Kumar, S.; Krause, P.J. Persistence of Babesia microti Infection in Humans. Pathogens 2019, 8, 102. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Uilenberg, G. Babesia-A historical overview. Vet. Parasitol. 2006, 138, 3–10. [Google Scholar] [CrossRef] [PubMed]
- Nováková, M.; Šmajs, D. Rickettsial Endosymbionts of Ticks. In Ticks and Tick-Borne Pathogens; IntechOpen: London, UK, 2019. [Google Scholar]
- Kniazeva, V.; Pogotskaya, Y.; Higgs, S.; Krasko, A. The Prevalence of Different Human Pathogenic Microorganisms Transmitted by Ixodes Tick Vectors in Belarus. Vector-Borne Zoonotic Dis. 2021, 21, 6–10. [Google Scholar] [CrossRef]
- Szekeres, S.; Docters van Leeuwen, A.; Rigó, K.; Jablonszky, M.; Majoros, G.; Sprong, H.; Földvári, G. Prevalence and diversity of human pathogenic rickettsiae in urban versus rural habitats, Hungary. Exp. Appl. Acarol. 2016, 68, 223–226. [Google Scholar] [CrossRef]
- Hornok, S.; Takács, N.; Szekeres, S.; Szőke, K.; Kontschán, J.; Horváth, G.; Sugár, L. DNA of Theileria orientalis, T. equi and T. capreoli in stable flies (Stomoxys calcitrans). Parasites Vectors 2020, 13, 186. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hornok, S.; Sugár, L.; Horváth, G.; Kovács, T.; Micsutka, A.; Gönczi, E.; Flaisz, B.; Takács, N.; Farkas, R.; Meli, M.L.; et al. Evidence for host specificity of Theileria capreoli genotypes in cervids. Parasites Vectors 2017, 10, 473. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- García-Sanmartín, J.; Aurtenetxe, O.; Barral, M.; Marco, I.; Lavin, S.; García-Pérez, A.L.; Hurtado, A. Molecular detection and characterization of piroplasms infecting cervids and chamois in Northern Spain. Parasitology 2007, 134, 391–398. [Google Scholar] [CrossRef]
- Wang, H.; Yang, J.; Mukhtar, M.U.; Liu, Z.; Zhang, M.; Wang, X. Molecular detection and identification of tick-borne bacteria and protozoans in goats and wild Siberian roe deer (Capreolus pygargus) from Heilongjiang Province, northeastern China. Parasites Vectors 2019, 12, 296. [Google Scholar] [CrossRef] [Green Version]
- Beck, A.; Huber, D.; Polkinghorne, A.; Kurilj, A.G.; Benko, V.; Mrljak, V.; Reljić, S.; Kusak, J.; Reil, I.; Beck, R. The prevalence and impact of Babesia canis and Theileria sp. in free-ranging grey wolf (Canis lupus) populations in Croatia. Parasites Vectors 2017, 10, 168. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Beck, A.; Huber, D.; Antolić, M.; Anzulović, Ž.; Reil, I.; Polkinghorne, A.; Baneth, G.; Beck, R. Retrospective study of canine infectious haemolytic anaemia cases reveals the importance of molecular investigation in accurate postmortal diagnostic protocols. Comp. Immunol. Microbiol. Infect. Dis. 2019, 65, 81–87. [Google Scholar] [CrossRef]
- Fankhauser, B.; Irwin, J.P.; Stone, M.L.; Chester, S.T.; Soll, M.D. Repellent and insecticidal efficacy of a new combination of fipronil and permethrin against stable flies (Stomoxys calcitrans). Parasites Vectors 2015, 8, 4–9. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, Y.; Christie, J.; Köster, L.; Du, A.; Yao, C. Emerging human babesiosis with “ground zero” in North America. Microorganisms 2021, 9, 440. [Google Scholar] [CrossRef] [PubMed]
- Rar, V.A.; Epikhina, T.I.; Suntsova, O.V.; Kozlova, I.V.; Lisak, O.V.; Pukhovskaya, N.M.; Vysochina, N.P.; Ivanov, L.I.; Tikunova, N.V. Genetic variability of Babesia parasites in Haemaphysalis spp. and Ixodes persulcatus ticks in the Baikal region and Far East of Russia. Infect. Genet. Evol. 2014, 28, 270–275. [Google Scholar] [CrossRef]
- Fuehrer, H.-P.P.; Biro, N.; Harl, J.; Worliczek, H.L.; Beiglböck, C.; Farkas, R.; Joachim, A.; Duscher, G.G. Molecular detection of Theileria sp. ZS TO4 in red deer (Cervus elaphus) and questing Haemaphysalis concinna ticks in Eastern Austria. Vet. Parasitol. 2013, 197, 653–657. [Google Scholar] [CrossRef]
- Hornok, S.; Kováts, D.; Csörg¿, T.; Meli, M.L.; Gönczi, E.; Hadnagy, Z.; Takács, N.; Farkas, R.; Hofmann-Lehmann, R. Birds as potential reservoirs of tick-borne pathogens: First evidence of bacteraemia with Rickettsia helvetica. Parasites Vectors 2014, 7, 128. [Google Scholar] [CrossRef] [Green Version]
- Nosek, J. The ecology, bionomics and behaviour of Haemaphysalis (Haemaphysalis) concinna tick. Z. Parasitenkd. 1971, 36, 233–241. [Google Scholar] [CrossRef]
- Meng, H.; Xu, S.; Yu, Z.; Li, N.; Wang, R.; Gao, X.; Yang, X.; Liu, J. Abundance and seasonal activity of Haemaphysalis concinna (Acari: Ixodidae) at the border between China and Russia in Northern Inner Mongolia, China. Parasites Vectors 2016, 9, 1. [Google Scholar] [CrossRef] [Green Version]
- Dwużnik, D.; Mierzejewska, E.J.; Alsarraf, M.; Bajer, A. A new focus of the tick Haemaphysalis concinna in Western Poland. Exp. Appl. Acarol. 2019, 78, 93–112. [Google Scholar] [CrossRef] [Green Version]
- Kazimírová, M.; Hamšíková, Z.; Špitalská, E.; Minichová, L.; Mahríková, L.; Caban, R.; Sprong, H.; Fonville, M.; Schnittger, L.; Kocianová, E. Diverse tick-borne microorganisms identified in free-living ungulates in Slovakia. Parasites Vectors 2018, 11, 495. [Google Scholar] [CrossRef] [PubMed]
- Földvári, G.; Farkas, R. Ixodid tick species attaching to dogs in Hungary. Vet. Parasitol. 2005, 129, 125–131. [Google Scholar] [CrossRef] [PubMed]
Target Organisms | Sequence (5′–3′) | Target Region | Reference |
---|---|---|---|
RLB primers * | |||
Anaplasma/Ehrlichia spp. | GGAATTCAGAGTTGGATCMTGGYTCAG | 16S ribosomal RNA gene | [10] |
(Biotin-)CGGGATCCCGAGTTTGCCGGGACTTYTTCT | [11] | ||
Babesia/Theileria spp. | GACACAGGGAGGTAGTGACAAG | 18S ribosomal RNA gene | [12] |
(Biotin-)CTAAGAATTTCACCTCTGACAGT | [12] | ||
Borrelia burgdorferi sensu lato | ACCATAGACTCTTATTACTTTGACCA | 5S–23S ribosomal RNA intergenic spacer | [13] |
(Biotin-)GAGAGTAGGTTATTGCCAGGG | [13] | ||
Rickettsia spp. | GAACGCTATCGGTATGCTTAACACA | 16S ribosomal RNA gene | [14,15] |
(Biotin-)CATCACTCACTCGGTATTGCTGGA | [14,15] | ||
GATAGGTCRGRTGTGGAAGCAC | 23S–5S ribosomal RNA intergenic spacer | [16] | |
(Biotin-)TCGGGAYGGGATCGTGTGTTTC | [16] | ||
Additional sequencing primers | |||
Rickettsia spp. | ATGAGTAAAGACGGTAACCT | sca4 | [17] |
AAGCTATTGCGTCATCTCCG | [17] | ||
ATGGCGAATATTTCTCCAAAA | ompA | [18] | |
GTTCCGTTAATGGCAGCATCT | [18] | ||
AAACAATAATCAAGGTACTGT | ompB | [19] | |
TACTTCCGGTTACAGCAAAGT | [19] | ||
GCAAGTATCGGTGAGGATGTAAT | gltA | [20] | |
GCTTCCTTAAAATTCAATAAATCAGGAT | [20] | ||
Molecular identification of ticks | CTGCTCAATGATTTTTTAAATTGCTGTGG | 16S ribosomal RNA gene | [21] |
CCGGTCTGAACTAGATCAAGT | [22] |
Dermacentor reticulatus | Haemaphysalis concinna | Ixodes ricinus | ||||||||
---|---|---|---|---|---|---|---|---|---|---|
Tot. (n = 75) | Female (n = 47) | Male (n = 28) | Tot. (n = 44) | Female (n = 21) | Male (n = 7) | Nymphs (n = 16) | Tot. (n = 75) | Female (n = 47) | Male (n = 28) | |
Anaplasma phagocytophilum | 5 | 1 | 4 | 1 | 1 | |||||
Babesia spp. | 4 | 2 | 2 | |||||||
Borrelia afzelii | 1 | 1 | 1 | 1 | ||||||
Borrelia burgdorferi sensu stricto | 1 | 1 | ||||||||
Borrelia garinii/Borrelia bavariensis | 1 | 1 | ||||||||
Borrelia lusitaniae | 2 | 2 | 1 | 1 | ||||||
Borrelia spielmanii | 1 | 1 | 1 | 1 | ||||||
Borrelia valaisiana | 3 | 2 | 1 | 1 | 1 | |||||
Ca. Neoehrlichia mikurensis | 1 | 1 | ||||||||
Rickettsia helvetica | 2 | 1 | 1 | 3 | 2 | 1 | ||||
Rickettsia monacensis | 1 | 1 | ||||||||
Rickettsia raoultii | 10 | 1 | 9 | |||||||
Theileria capreoli | 1 | 1 | ||||||||
Theileria (Babesia) microti | 1 | 1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wijnveld, M.; Schötta, A.-M.; Stelzer, T.; Duscher, G.; Leschnik, M.; Stockinger, H.; Lindgren, P.-E.; Stanek, G. Novel Protozoans in Austria Revealed through the Use of Dogs as Sentinels for Ticks and Tick-Borne Pathogens. Microorganisms 2021, 9, 1392. https://doi.org/10.3390/microorganisms9071392
Wijnveld M, Schötta A-M, Stelzer T, Duscher G, Leschnik M, Stockinger H, Lindgren P-E, Stanek G. Novel Protozoans in Austria Revealed through the Use of Dogs as Sentinels for Ticks and Tick-Borne Pathogens. Microorganisms. 2021; 9(7):1392. https://doi.org/10.3390/microorganisms9071392
Chicago/Turabian StyleWijnveld, Michiel, Anna-Margarita Schötta, Theresa Stelzer, Georg Duscher, Michael Leschnik, Hannes Stockinger, Per-Eric Lindgren, and Gerold Stanek. 2021. "Novel Protozoans in Austria Revealed through the Use of Dogs as Sentinels for Ticks and Tick-Borne Pathogens" Microorganisms 9, no. 7: 1392. https://doi.org/10.3390/microorganisms9071392
APA StyleWijnveld, M., Schötta, A.-M., Stelzer, T., Duscher, G., Leschnik, M., Stockinger, H., Lindgren, P.-E., & Stanek, G. (2021). Novel Protozoans in Austria Revealed through the Use of Dogs as Sentinels for Ticks and Tick-Borne Pathogens. Microorganisms, 9(7), 1392. https://doi.org/10.3390/microorganisms9071392