Construction and Immunogenicity Evaluation of a Recombinant Fowlpox Virus Expressing VP2 Gene of African Horse Sickness Virus Serotype 1
Abstract
1. Introduction
2. Materials and Methods
2.1. Cells, Viruses, Plasmids, and Animals
2.2. Generation of rFPV-VP2
2.3. PCR
2.4. WB and Indirect Immunofluorescence (IFA)
2.5. Virus Titration
2.6. Animal Experiment
2.7. Preparation of Recombinant AHSV-1 VP2 Protein
2.8. Development of an Indirect ELISA (iELISA) Based on Recombinant AHSV-1 VP2 for Antibody Detection
2.9. Virus Neutralization (VN) Test
3. Results
3.1. Construction of rFPV-VP2
3.2. Replication Characteristics of rFPV-VP2
3.3. Immunogenicity of rFPV-VP2 in Mice and Horses
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| AHSV | African horse sickness virus |
| AHS | African horse sickness |
| iELISA | Indirect enzyme-linked immunosorbent assay |
| CEF | chicken embryo fibroblast |
| IFA | Immunofluorescence assays |
| VN | Virus neutralization |
| rFPV | Recombinant fowlpox virus |
References
- Woah Terrestrial Manual-Section 3.6 Equidae-Chapter 3.6.1-African Horse Sickness (Infection with African Horse Sickness Virus). Available online: https://www.woah.org/fileadmin/Home/eng/Health_standards/tahm/3.06.01_AHS.pdf (accessed on 26 October 2025).
- Hamblin, C.; Salt, J.S.; Mellor, P.S.; Graham, S.D.; Smith, P.R.; Wohlsein, P. Donkeys as reservoirs of African horse sickness virus. In African Horse Sickness; Springer: Vienna, Austria, 1998; pp. 37–47. [Google Scholar]
- Fassi-Fihri, O.; el Harrak, M.; Fassi-Fehri, M.M. Clinical, virological and immune responses of normal and immunosuppressed donkeys (Equus asinus africanus) after inoculation with African horse sickness virus. Arch. Virol. Suppl. 1998, 14, 49–56. [Google Scholar]
- el Hasnaoui, H.; el Harrak, M.; Zientara, S.; Laviada, M.; Hamblin, C. Serological and virological responses in mules and donkeys following inoculation with African horse sickness virus serotype 4. Arch. Virol. Suppl. 1998, 14, 29–36. [Google Scholar]
- Barnard, B.J. Epidemiology of African horse sickness and the role of the zebra in South Africa. Arch. Virol. Suppl. 1998, 14, 13–19. [Google Scholar]
- Carpenter, S.; Mellor, P.S.; Fall, A.G.; Garros, C.; Venter, G.J. African Horse Sickness Virus: History, Transmission, and Current Status. Annu. Rev. Entomol. 2017, 62, 343–358. [Google Scholar] [CrossRef]
- House, J.A. African horse sickness. Vet. Clin. N. Am. Equine Pract. 1993, 9, 355–364. [Google Scholar] [CrossRef]
- Mellor, P.S.; Hamblin, C. African horse sickness. Vet. Res. 2004, 35, 445–466. [Google Scholar] [CrossRef] [PubMed]
- Bunpapong, N.; Charoenkul, K.; Nasamran, C.; Chamsai, E.; Udom, K.; Boonyapisitsopa, S.; Tantilertcharoen, R.; Kesdangsakonwut, S.; Techakriengkrai, N.; Suradhat, S.; et al. African Horse Sickness Virus Serotype 1 on Horse Farm, Thailand, 2020. Emerg. Infect. Dis. 2021, 27, 2208–2211. [Google Scholar] [CrossRef] [PubMed]
- MALAYSIA, Department of Veterinary Services Malaysia. African Horse Sickness in Malaysia. In 2020. Available online: https://rr-asia.woah.org/app/uploads/2020/11/malaysia_ahs-situation_10nov2020.pdf (accessed on 26 October 2025).
- Gao, S.; Zeng, Z.; Wang, H.; Chen, F.; Huang, L.; Wang, X. Predicting the possibility of African horse sickness (AHS) introduction into China using spatial risk analysis and habitat connectivity of Culicoides. Sci. Rep. 2022, 12, 3910. [Google Scholar] [CrossRef]
- Dennis, S.J.; Meyers, A.E.; Hitzeroth, I.I.; Rybicki, E.P. African Horse Sickness: A Review of Current Understanding and Vaccine Development. Viruses 2019, 11, 844. [Google Scholar] [CrossRef] [PubMed]
- Roy, P.; Mertens, P.P.; Casal, I. African horse sickness virus structure. Comp. Immunol. Microbiol. Infect. Dis. 1994, 17, 243–273. [Google Scholar] [CrossRef]
- Chiam, R.; Sharp, E.; Maan, S.; Rao, S.; Mertens, P.; Blacklaws, B.; Davis-Poynter, N.; Wood, J.; Castillo-Olivares, J. Induction of antibody responses to African horse sickness virus (AHSV) in ponies after vaccination with recombinant modified vaccinia Ankara (MVA). PLoS ONE 2009, 4, e5997. [Google Scholar] [CrossRef] [PubMed]
- Howell, P.G. The isolation and identification of further antigenic types of African Horsesickness virus. Onderstepoort J. Vet. Res. 1962, 29, 139–149. [Google Scholar]
- Alonso, C.; Utrilla-Trigo, S.; Calvo-Pinilla, E.; Jiménez-Cabello, L.; Ortego, J.; Nogales, A. Inhibition of Orbivirus Replication by Aurintricarboxylic Acid. Int. J. Mol. Sci. 2020, 21, 7294. [Google Scholar] [CrossRef]
- Calvo-Pinilla, E.; Marin-Lopez, A.; Utrilla-Trigo, S.; Jimenez-Cabello, L.; Ortego, J. Reverse genetics approaches: A novel strategy for African horse sickness virus vaccine design. Curr. Opin. Virol. 2020, 44, 49–56. [Google Scholar] [CrossRef]
- Weyer, C.T.; Grewar, J.D.; Burger, P.; Rossouw, E.; Lourens, C.; Joone, C.; le Grange, M.; Coetzee, P.; Venter, E.; Martin, D.P.; et al. African Horse Sickness Caused by Genome Reassortment and Reversion to Virulence of Live, Attenuated Vaccine Viruses, South Africa, 2004-2014. Emerg. Infect. Dis. 2016, 22, 2087–2096. [Google Scholar] [CrossRef]
- Raja, P. Fowlpox Virus. In Recent Advances in Animal Virology; Malik, Y.S., Singh, R.K., Yadav, M.P., Eds.; Springer: Singapore, 2019; pp. 143–160. [Google Scholar]
- Edlund Toulemonde, C.; Daly, J.; Sindle, T.; Guigal, P.M.; Audonnet, J.C.; Minke, J.M. Efficacy of a recombinant equine influenza vaccine against challenge with an American lineage H3N8 influenza virus responsible for the 2003 outbreak in the United Kingdom. Vet Rec. 2005, 156, 367–371. [Google Scholar] [CrossRef]
- Jas, D.; Coupier, C.; Toulemonde, C.E.; Guigal, P.M.; Poulet, H. Three-year duration of immunity in cats vaccinated with a canarypox-vectored recombinant rabies virus vaccine. Vaccine 2012, 30, 6991–6996. [Google Scholar] [CrossRef]
- Weli, S.C.; Tryland, M. Avipoxviruses: Infection biology and their use as vaccine vectors. Virol. J. 2011, 8, 49. [Google Scholar] [CrossRef]
- Qiao, C.L.; Yu, K.Z.; Jiang, Y.P.; Jia, Y.Q.; Tian, G.B.; Liu, M.; Deng, G.H.; Wang, X.R.; Meng, Q.W.; Tang, X.Y. Protection of chickens against highly lethal H5N1 and H7N1 avian influenza viruses with a recombinant fowlpox virus co-expressing H5 haemagglutinin and N1 neuraminidase genes. Avian Pathol. 2003, 32, 25–32. [Google Scholar] [CrossRef] [PubMed]
- Ting, Q. Molecular Epidemiologic Surveillance of Equine Influenza Virus in China and Primary Study of Fowlpox Virus-Vectored Vaccine Against EIV. Ph.D. Thesis, Chinese Academy of Agricultural Sciences, Beijing, China, 2011. [Google Scholar]
- Aksular, M.; Calvo-Pinilla, E.; Marin-Lopez, A.; Ortego, J.; Chambers, A.C.; King, L.A.; Castillo-Olivares, J. A single dose of African horse sickness virus (AHSV) VP2 based vaccines provides complete clinical protection in a mouse model. Vaccine 2018, 36, 7003–7010. [Google Scholar] [CrossRef] [PubMed]
- Calvo-Pinilla, E.; Gubbins, S.; Mertens, P.; Ortego, J.; Castillo-Olivares, J. The immunogenicity of recombinant vaccines based on modified Vaccinia Ankara (MVA) viruses expressing African horse sickness virus VP2 antigens depends on the levels of expressed VP2 protein delivered to the host. Antivir. Res. 2018, 154, 132–139. [Google Scholar] [CrossRef] [PubMed]
- Kanai, Y.; van Rijn, P.A.; Maris-Veldhuis, M.; Kaname, Y.; Athmaram, T.N.; Roy, P. Immunogenicity of recombinant VP2 proteins of all nine serotypes of African horse sickness virus. Vaccine 2014, 32, 4932–4937. [Google Scholar] [CrossRef]
- Alberca, B.; Bachanek-Bankowska, K.; Cabana, M.; Calvo-Pinilla, E.; Viaplana, E.; Frost, L.; Gubbins, S.; Urniza, A.; Mertens, P.; Castillo-Olivares, J. Vaccination of horses with a recombinant modified vaccinia Ankara virus (MVA) expressing African horse sickness (AHS) virus major capsid protein VP2 provides complete clinical protection against challenge. Vaccine 2014, 32, 3670–3674. [Google Scholar] [CrossRef]
- Hernandez, R.; Brown, D.T. Growth and maintenance of chick embryo fibroblasts (CEF). Curr. Protoc. Microbiol. 2010, 17, A.4I.1–A.4I.8. [Google Scholar] [CrossRef]
- Ma, X.; Zhang, Y.; Na, L.; Qi, T.; Ma, W.; Guo, X.; Wang, X.F.; Wang, X. Identification and Characterization of Linear Epitopes of Monoclonal Antibodies Against African Horse Sickness Virus Serotype 1 VP2 Protein. Viruses 2024, 16, 1780. [Google Scholar] [CrossRef]
- Zhang, M.; Wang, X.-F.; Guo, S.-F.; Wang, L.; Fu, B.-F.; Wang, J.-W.; Song, Y.-F.; Yang, X.-Y.; Hao, S.-Y.; Zhang, Q.-Y.; et al. Identification and Genetic Characterization of a Strain of African Horse Sickness Virus Serotype 1 and Its Safety Evaluation in a Mouse Model. Microorganisms 2025, 13, 2314. [Google Scholar] [CrossRef]
- Ma, X.; Gao, M.; Zhang, X.; Ma, W.; Xue, F.; Wang, X.F.; Wang, X. Identification and characterization of linear epitopes of monoclonal antibodies against the capsid proteins of small ruminant lentiviruses. Front. Microbiol. 2024, 15, 1452063. [Google Scholar] [CrossRef] [PubMed]
- Gao, Y.; Gao, H.; Wang, X.; Li, J.; Deng, X.; Liu, W.; Wang, X. Immunogenicity of recombinant VP2 protein of infectious bursal disease virus expressed in recombinant baculoviruses. Chin. J. Prev. Vet. Med. 2007, 29, 427–431. [Google Scholar]
- Jardin, B.A.; Elias, C.B.; Prakash, S. Expression of a Secreted Protein in Mammalian Cells Using Baculovirus Particles. In Protein Expression in Mammalian Cells: Methods and Protocols; Hartley, J.L., Ed.; Humana Press: Totowa, NJ, USA, 2012; pp. 41–63. [Google Scholar]
- Rosenberg, S.A.; Yang, J.C.; Schwartzentruber, D.J.; Hwu, P.; Topalian, S.L.; Sherry, R.M.; Restifo, N.P.; Wunderlich, J.R.; Seipp, C.A.; Rogers-Freezer, L.; et al. Recombinant fowlpox viruses encoding the anchor-modified gp100 melanoma antigen can generate antitumor immune responses in patients with metastatic melanoma. Clin. Cancer Res. 2003, 9, 2973–2980. [Google Scholar]
- Kent, S.J.; Dale, C.J.; Ranasinghe, C.; Stratov, I.; De Rose, R.; Chea, S.; Montefiori, D.C.; Thomson, S.; Ramshaw, I.A.; Coupar, B.E.; et al. Mucosally-administered human-simian immunodeficiency virus DNA and fowlpoxvirus-based recombinant vaccines reduce acute phase viral replication in macaques following vaginal challenge with CCR5-tropic SHIVSF162P3. Vaccine 2005, 23, 5009–5021. [Google Scholar] [CrossRef]
- Townsend, D.G.; Trivedi, S.; Jackson, R.J.; Ranasinghe, C. Recombinant fowlpox virus vector-based vaccines: Expression kinetics, dissemination and safety profile following intranasal delivery. J. Gen. Virol. 2017, 98, 496–505. [Google Scholar] [CrossRef] [PubMed]
- Qiao, C.; Jiang, Y.; Tian, G.; Wang, X.; Li, C.; Xin, X.; Chen, H.; Yu, K. Recombinant fowlpox virus vector-based vaccine completely protects chickens from H5N1 avian influenza virus. Antivir. Res. 2009, 81, 234–238. [Google Scholar] [CrossRef]
- Sah, R.; Siddiq, A.; Padhi, B.K.; Mohanty, A.; Rabaan, A.A.; Chandran, D.; Chakraborty, C.; Dhama, K. Dengue virus and its recent outbreaks: Current scenario and counteracting strategies. Int. J. Surg. 2023, 109, 2841–2845. [Google Scholar] [CrossRef]
- Ribeiro dos Santos, G.; Jawed, F.; Mukandavire, C.; Deol, A.; Scarponi, D.; Mboera, L.E.G.; Seruyange, E.; Poirier, M.J.P.; Bosomprah, S.; Udeze, A.O.; et al. Global burden of chikungunya virus infections and the potential benefit of vaccination campaigns. Nat. Med. 2025, 31, 2342–2349. [Google Scholar] [CrossRef]
- King, S.; Rajko-Nenow, P.; Ashby, M.; Frost, L.; Carpenter, S.; Batten, C. Outbreak of African horse sickness in Thailand, 2020. Transbound. Emerg. Dis. 2020, 67, 1764–1767. [Google Scholar] [CrossRef]
- Li, N.; Meng, J.; He, Y.; Wang, W.; Wang, J. Potential roles of Culicoides spp. (Culicoides imicola, Culicoides oxystoma) as biological vectors of bluetongue virus in Yuanyang of Yunnan, P.R. China. Front. Cell Infect. Microbiol. 2023, 13, 1283216. [Google Scholar]
- Zhang, Y.; Na, L.; Guo, K.; Wang, J.; Hu, Z.; Du, C.; Wang, X.; Wang, X. Development and evaluation of a RT-RAA-combined CRISPR/Cas12a assay for the detection of African horse sickness virus. J. Integr. Agric. 2024, 23, 4267–4271. [Google Scholar] [CrossRef]
- Hu, X.; Xu, J.; Wang, X.; Tian, Z.; Guan, G.; Luo, J.; Yin, H.; Du, J. Identification of three novel linear B-cell epitopes on VP7 of African horse sickness virus using monoclonal antibodies. Vet. Microbiol. 2024, 298, 110258. [Google Scholar] [CrossRef] [PubMed]
- Roy, P.; Bishop, D.H.; Howard, S.; Aitchison, H.; Erasmus, B. Recombinant baculovirus-synthesized African horsesickness virus (AHSV) outer-capsid protein VP2 provides protection against virulent AHSV challenge. J. Gen. Virol. 1996, 77 Pt 9, 2053–2057. [Google Scholar] [CrossRef]
- du Plessis, M.; Cloete, M.; Aitchison, H.; Van Dijk, A.A. Protein aggregation complicates the development of baculovirus-expressed African horsesickness virus serotype 5 VP2 subunit vaccines. Onderstepoort J. Vet. Res. 1998, 65, 321–329. [Google Scholar] [PubMed]
- Martinez-Torrecuadrada, J.L.; Diaz-Laviada, M.; Roy, P.; Sanchez, C.; Vela, C.; Sanchez-Vizcaino, J.M.; Casal, J.I. Full protection against African horsesickness (AHS) in horses induced by baculovirus-derived AHS virus serotype 4 VP2, VP5 and VP7. J. Gen. Virol. 1996, 77 Pt 6, 1211–1221. [Google Scholar] [CrossRef]
- Stone-Marschat, M.A.; Moss, S.R.; Burrage, T.G.; Barber, M.L.; Roy, P.; Laegreid, W.W. Immunization with VP2 is sufficient for protection against lethal challenge with African horsesickness virus Type 4. Virology 1996, 220, 219–222. [Google Scholar] [CrossRef]
- Breathnach, C.C.; Clark, H.J.; Clark, R.C.; Olsen, C.W.; Townsend, H.G.; Lunn, D.P. Immunization with recombinant modified vaccinia Ankara (rMVA) constructs encoding the HA or NP gene protects ponies from equine influenza virus challenge. Vaccine 2006, 24, 1180–1190. [Google Scholar] [CrossRef]
- Minke, J.M.; Fischer, L.; Baudu, P.; Guigal, P.M.; Sindle, T.; Mumford, J.A.; Audonnet, J.C. Use of DNA and recombinant canarypox viral (ALVAC) vectors for equine herpes virus vaccination. Vet. Immunol. Immunopathol. 2006, 111, 47–57. [Google Scholar] [CrossRef]
- Minke, J.M.; Toulemonde, C.E.; Coupier, H.; Guigal, P.M.; Dinic, S.; Sindle, T.; Jessett, D.; Black, L.; Bublot, M.; Pardo, M.C.; et al. Efficacy of a canarypox-vectored recombinant vaccine expressing the hemagglutinin gene of equine influenza H3N8 virus in the protection of ponies from viral challenge. Am. J. Vet. Res. 2007, 68, 213–219. [Google Scholar] [CrossRef]
- Zhang, Y.; Li, J.; Wang, Z.; Kuang, Y.; Li, S.; Wang, X. Precision-engineered mRNA vaccines: Antigen design, structural optimization, and programmable delivery for emerging pathogens. Anim. Dis. 2025, 5, 32. [Google Scholar] [CrossRef]
- Yu, C.; Wu, Q.; Xin, J.; Yu, Q.; Ma, Z.; Xue, M.; Xu, Q.; Zheng, C. Designing a smallpox B-cell and T-cell multi-epitope subunit vaccine using a comprehensive immunoinformatics approach. Microbiol. Spectr. 2024, 12, e0046524. [Google Scholar] [CrossRef]
- van Rijn, P.A.; Maris-Veldhuis, M.A.; Potgieter, C.A.; van Gennip, R.G. African horse sickness virus (AHSV) with a deletion of 77 amino acids in NS3/NS3a protein is not virulent and a safe promising AHS Disabled Infectious Single Animal (DISA) vaccine platform. Vaccine 2018, 36, 1925–1933. [Google Scholar] [CrossRef] [PubMed]
- Guthrie, A.J.; Quan, M.; Lourens, C.W.; Audonnet, J.C.; Minke, J.M.; Yao, J.; He, L.; Nordgren, R.; Gardner, I.A.; Maclachlan, N.J. Protective immunization of horses with a recombinant canarypox virus vectored vaccine co-expressing genes encoding the outer capsid proteins of African horse sickness virus. Vaccine 2009, 27, 4434–4438. [Google Scholar] [CrossRef] [PubMed]
- El Garch, H.; Crafford, J.E.; Amouyal, P.; Durand, P.Y.; Edlund Toulemonde, C.; Lemaitre, L.; Cozette, V.; Guthrie, A.; Minke, J.M. An African horse sickness virus serotype 4 recombinant canarypox virus vaccine elicits specific cell-mediated immune responses in horses. Vet. Immunol. Immunopathol. 2012, 149, 76–85. [Google Scholar] [CrossRef] [PubMed]



| Primers | Sequence (5′–3′) | Description |
|---|---|---|
| VP2-F | GCGTCTGAATTTGGAATTCTATTGACC | Specific amplification of the full-length AHSV-1 VP2 gene (3171 bp). |
| VP2-R | CTCTATCTTCGACAATAACTTTGAGAAG | |
| id F | ATGAAATATTAGATTCTAGCGGTTGGTC | Targets the 5′ and 3′ homologous recombination arms of FPV; differentiates rFPV-VP2-LacZ (>7000 bp) from rFPV-VP2 (>4000 bp) based on PCR product size. |
| id R | ATCTCGTAAGATGCCTATATGAATATGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ma, X.; Zhang, M.; Zhang, X.; Qi, T.; Zhang, W.; Zhao, Y.; Na, L.; Zhang, Y.; Wang, X.-F.; Wang, X. Construction and Immunogenicity Evaluation of a Recombinant Fowlpox Virus Expressing VP2 Gene of African Horse Sickness Virus Serotype 1. Microorganisms 2025, 13, 2807. https://doi.org/10.3390/microorganisms13122807
Ma X, Zhang M, Zhang X, Qi T, Zhang W, Zhao Y, Na L, Zhang Y, Wang X-F, Wang X. Construction and Immunogenicity Evaluation of a Recombinant Fowlpox Virus Expressing VP2 Gene of African Horse Sickness Virus Serotype 1. Microorganisms. 2025; 13(12):2807. https://doi.org/10.3390/microorganisms13122807
Chicago/Turabian StyleMa, Xiaohua, Min Zhang, Xin Zhang, Ting Qi, Weiguo Zhang, Yang Zhao, Lei Na, Yingzhi Zhang, Xue-Feng Wang, and Xiaojun Wang. 2025. "Construction and Immunogenicity Evaluation of a Recombinant Fowlpox Virus Expressing VP2 Gene of African Horse Sickness Virus Serotype 1" Microorganisms 13, no. 12: 2807. https://doi.org/10.3390/microorganisms13122807
APA StyleMa, X., Zhang, M., Zhang, X., Qi, T., Zhang, W., Zhao, Y., Na, L., Zhang, Y., Wang, X.-F., & Wang, X. (2025). Construction and Immunogenicity Evaluation of a Recombinant Fowlpox Virus Expressing VP2 Gene of African Horse Sickness Virus Serotype 1. Microorganisms, 13(12), 2807. https://doi.org/10.3390/microorganisms13122807

