Growth Characteristics of Sheep-Derived Bacteroides fragilis and Preliminary Research on Effects in Mice and Lambs
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacteroides fragilis
2.2. Growth Characteristics of Bacteroides fragilis
2.2.1. Acid and Bile Salt Tolerance
2.2.2. Simulated Artificial Gastric Fluid and Artificial Intestinal Fluid Tolerance Test
2.2.3. Antibiotic Sensitivity Test
2.3. Effect of Bacteroides fragilis on Enterohemorrhagic Escherichia coli (EHEC)-Infected Mice
2.3.1. Animal Grouping and Treatment
2.3.2. Sample Collection
2.3.3. Histopathological Analysis
2.3.4. Measurement of Inflammatory Factors and Oxidative Stress Indicators
2.3.5. Gene Expression Analysis
2.4. Probiotic Effects of Bacteroides fragilis on Lambs
2.4.1. Animal Grouping and Treatment
2.4.2. Sample Collection
2.4.3. 16S rRNA Sequencing Analysis
2.5. Statistical Analysis
3. Results
3.1. Characteristics of Bacteroides fragilis
3.1.1. Acid and Bile Salt Tolerance and Artificial Intestinal Fluid and Artificial Gastric Fluid Cultivation
3.1.2. Antibiotic Sensitivity
3.2. Effects of Bacteroides fragilis on EHEC-Infected Mice
3.2.1. Body Weight Changes
3.2.2. Histopathological Changes in the Intestine
3.2.3. IL-6 and TNF-α Levels
3.2.4. Oxidative Stress Markers
3.2.5. ZO-1 and Occludin Expression
3.3. Probiotic Effects of Bacteroides fragilis on Lambs
3.3.1. Health Status of Lambs
3.3.2. Analysis of Intestinal Microbiota Abundance
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zhong, T.; Wang, Y.; Wang, X.; Freitas-de-Melo, A.; Li, H.; Zhan, S.; Wang, L.; Cao, J.; Dai, D.; Guo, J.; et al. Diarrhea in Suckling Lambs Is Associated with Changes in Gut Microbiota, Serum Immunological and Biochemical Parameters in an Intensive Production System. Front. Microbiol. 2022, 13, 1020657. [Google Scholar] [CrossRef] [PubMed]
- Sun, J.; Chen, W.; Yuan, Z. Characterization of Intestinal Microbiota in Lambs with Different Susceptibility to Escherichia coli F17. Vet. Sci. 2022, 9, 670. [Google Scholar] [CrossRef] [PubMed]
- Bhat, M.A.; Nishikawa, Y.; Wani, S.A. Prevalence and Virulence Gene Profiles of Shiga Toxin-Producing Escherichia coli and Enteropathogenic Escherichia coli from Diarrhoeic and Healthy Lambs in India. Small Rumin. Res. 2008, 75, 65–70. [Google Scholar] [CrossRef]
- Greco, G.; Madio, A.; Buonavoglia, D.; Totaro, M.; Corrente, M.; Martella, V.; Buonavoglia, C. Clostridium perfringens Toxin-Types in Lambs and Kids Affected with Gastroenteric Pathologies in Italy. Vet. J. 2005, 170, 346–350. [Google Scholar] [CrossRef] [PubMed]
- Meisenheimer, E.S.; Epstein, C.; Thiel, D. Acute Diarrhea in Adults. Am. Fam. Physician 2022, 106, 72–80. [Google Scholar]
- Abdulkhaleq, L.A.; Assi, M.A.; Abdullah, R.; Zamri-Saad, M.; Taufiq-Yap, Y.H.; Hezmee, M.N.M. The Crucial Roles of Inflammatory Mediators in Inflammation: A Review. Vet. World 2018, 11, 627–635. [Google Scholar] [CrossRef]
- Sies, H. Oxidative Stress: A Concept in Redox Biology and Medicine. Redox Biol. 2015, 4, 180–183. [Google Scholar] [CrossRef]
- Tang, Y.; Zhou, X.; Cao, T.; Chen, E.; Li, Y.; Lei, W.; Hu, Y.; He, B.; Liu, S. Endoplasmic Reticulum Stress and Oxidative Stress in Inflammatory Diseases. DNA Cell Biol. 2022, 41, 924–934. [Google Scholar] [CrossRef]
- Xu, F.; Xu, J.; Xiong, X.; Deng, Y. Salidroside Inhibits MAPK, NF-ΚB, and STAT3 Pathways in Psoriasis-Associated Oxidative Stress via SIRT1 Activation. Redox Rep. 2019, 24, 70–74. [Google Scholar] [CrossRef]
- Wang, J.; Ji, H. Tight Junction Proteins in the Weaned Piglet Intestine: Roles and Regulation. Curr. Protein Pept. Sci. 2019, 20, 652–660. [Google Scholar] [CrossRef]
- Zhou, B.; Yuan, Y.; Zhang, S.; Guo, C.; Li, X.; Li, G.; Xiong, W.; Zeng, Z. Intestinal Flora and Disease Mutually Shape the Regional Immune System in the Intestinal Tract. Front. Immunol. 2020, 11, 575. [Google Scholar] [CrossRef] [PubMed]
- Delgado, S.; Sánchez, B.; Margolles, A.; Ruas-Madiedo, P.; Ruiz, L. Molecules Produced by Probiotics and Intestinal Microorganisms with Immunomodulatory Activity. Nutrients 2020, 12, 391. [Google Scholar] [CrossRef] [PubMed]
- Gilmore, M.S.; Ferretti, J.J. Microbiology. The Thin Line between Gut Commensal and Pathogen. Science 2003, 299, 19992002. [Google Scholar] [CrossRef] [PubMed]
- Mazmanian, S.K.; Kasper, D.L. The Love-Hate Relationship between Bacterial Polysaccharides and the Host Immune System. Nat. Rev. Immunol. 2006, 6, 849–858. [Google Scholar] [CrossRef]
- Mazmanian, S.K.; Cui, H.L.; Tzianabos, A.O.; Kasper, D.L. An Immunomodulatory Molecule of Symbiotic Bacteria Directs Maturation of the Host Immune System. Cell 2005, 122, 107–118. [Google Scholar] [CrossRef]
- Tan, H.; Wang, C.; Zhang, Q.; Tang, X.; Zhao, J.; Zhang, H.; Zhai, Q.; Chen, W. Preliminary Safety Assessment of a New Bacteroides Fragilis Isolate. Food Chem. Toxicol. 2020, 135, 110934. [Google Scholar] [CrossRef]
- Hooper, L.V.; Midwedt, T.; Gordon, J.I. How Host-Microbial Interactions Shape the Nutrient Environment of the Mammalian Intestine. Annu. Rev. Nutr. 2002, 22, 283–307. [Google Scholar] [CrossRef]
- Patrick, S. A Tale of Two Habitats: Bacteroides Fragilis, a Lethal Pathogen and Resident in the Human Gastrointestinal Microbiome. Microbiology 2022, 168, 001156. [Google Scholar] [CrossRef]
- Wexler, H.M. Bacteroides: The Good, the Bad, and the Nitty-Gritty. Clin. Microbiol. Rev. 2007, 20, 593–621. [Google Scholar] [CrossRef]
- Zhu, S. Analysis of Intestinal Flora and Identification of Potential Probiotics in Preweaned Lambs. Master’s thesis, Yangzhou University, Yangzhou, China, 2023. (In Chinese). [Google Scholar]
- Wei, W.; Gao, Y.; Shi, X.; Zhen, Z.; Kang, Q.; Deng, X. Effect and Mechanism of “Liver-Soothing and Spleen-Invigorating” Therapies Against Liver Injury in Rats: An Exploration Based on TGR5 and Intestinal Mucosal Barrier Function. Chin. J. Exp. Tradit. Med. Formulae 2022, 28, 131–140. (In Chinese) [Google Scholar] [CrossRef]
- Ghotaslou, R.; Yekani, M.; Memar, M.Y. The Role of Efflux Pumps in Bacteroides Fragilis Resistance to Antibiotics. Microbiol. Res. 2018, 210, 1–5. [Google Scholar] [CrossRef] [PubMed]
- Riley, L.W.; Remis, R.S.; Helgerson, S.D.; McGee, H.B.; Wells, J.G.; Davis, B.R.; Hebert, R.J.; Olcott, E.S.; Johnson, L.M.; Hargrett, N.T.; et al. Hemorrhagic Colitis Associated with a Rare Escherichia coli Serotype. N. Engl. J. Med. 1983, 308, 681–685. [Google Scholar] [CrossRef] [PubMed]
- Vela, A.I.; García, N.; Latre, M.V.; Casamayor, A.; Sánchez-Porro, C.; Briones, V.; Ventosa, A.; Domínguez, L.; Fernández-Garayzábal, J.F. Aerococcus suis sp. Nov., Isolated from Clinical Specimens from Swine. Int. J. Syst. Evol. Microbiol. 2007, 57, 1291–1294. [Google Scholar] [CrossRef] [PubMed]
- Rückert, C.; Albersmeier, A.; Winkler, A.; Tauch, A. Complete Genome Sequence of Corynebacterium camporealensis DSM 44610, Isolated from the Milk of a Manchega Sheep with Subclinical Mastitis. Genome Announc. 2015, 3, e00572-15. [Google Scholar] [CrossRef]
- Fernández-Garayzábal, J.F.; Collins, M.D.; Hutson, R.A.; Gonzalez, I.; Fernández, E.; Domínguez, L. Corynebacterium camporealensis sp. Nov., Associated with Subclinical Mastitis in Sheep. Int. J. Syst. Bacteriol. 1998, 48 Pt 2, 463–468. [Google Scholar] [CrossRef]
- Takakura, W.; Pimentel, M. Small Intestinal Bacterial Overgrowth and Irritable Bowel Syndrome—An Update. Front. Psychiatry 2020, 11, 664. [Google Scholar] [CrossRef]
- Grine, G.; Boualam, M.A.; Drancourt, M. Methanobrevibacter Smithii, a Methanogen Consistently Colonising the Newborn Stomach. Eur. J. Clin. Microbiol. Infect. Dis. 2017, 36, 2449–2455. [Google Scholar] [CrossRef]
- Williams, N.T. Probiotics. Am. J. Health Syst. Pharm. 2010, 67, 449–458. [Google Scholar] [CrossRef]
- Zhong, C.; Qu, C.; Wang, B.; Liang, S.; Zeng, B. Probiotics for Preventing and Treating Small Intestinal Bacterial Overgrowth: A Meta-Analysis and Systematic Review of Current Evidence. J. Clin. Gastroenterol. 2017, 51, 300–311. [Google Scholar] [CrossRef]
- Magne, F.; Gotteland, M.; Gauthier, L.; Zazueta, A.; Pesoa, S.; Navarrete, P.; Balamurugan, R. The Firmicutes/Bacteroidetes Ratio: A Relevant Marker of Gut Dysbiosis in Obese Patients? Nutrients 2020, 12, 1474. [Google Scholar] [CrossRef]
- Mariat, D.; Firmesse, O.; Levenez, F.; Guimarǎes, V.D.; Sokol, H.; Doré, J.; Corthier, G.; Furet, J.P. The Firmicutes/Bacteroidetes Ratio of the Human Microbiota Changes with Age. BMC Microbiol. 2009, 9, 123. [Google Scholar] [CrossRef] [PubMed]
- Guangorena-Gómez, J.O.; Lozano-Ochoa, I.I.; Rivera-Medina, I.L.; Méndez-Hernández, A.; Espinosa-Fematt, J.A.; Muñoz-Yáñez, C. Relationship Among Blastocystis, the Firmicutes/Bacteroidetes Ratio and Chronic Stress in Mexican University Students. Curr. Microbiol. 2022, 79, 72. [Google Scholar] [CrossRef] [PubMed]
- Kapoor, P.; Tiwari, A.; Sharma, S.; Tiwari, V.; Sheoran, B.; Ali, U.; Garg, M. Effect of Anthocyanins on Gut Health Markers, Firmicutes-Bacteroidetes Ratio and Short-Chain Fatty Acids: A Systematic Review via Meta-Analysis. Sci. Rep. 2023, 13, 1729. [Google Scholar] [CrossRef] [PubMed]
Item | Score | |||
0 | 1 | 2 | 3 | |
Epithelial defects | None | Mild | Moderate | Severe |
Edema | None | Mild | Moderate | Severe |
Lymphocyte, monocyte, and plasma cell infiltration | None | Mild | Moderate | Severe |
Neutrophil infiltration | None | Mild | Moderate | Severe |
Eosinophil infiltration | None | Mild | Moderate | Severe |
Gene | Primers |
---|---|
ZO-1 | F: CGGGCTACCTTATTGAATGTCC |
R: GAGCGAACTGAATGGTCTGATG | |
Occludin | F: GGATGACTACAGAGAGGAGAGGG |
R: CATAGTCTCCCACCATCCTCTTG |
Solution | Survival Rate (%) |
---|---|
Artificial intestinal fluid | 92.22 |
Artificial gastric fluid | 38.89 |
0.1% bile salt | 82.31 |
0.2% bile salt | 42.42 |
0.3% bile salt | 13.92 |
Antibiotic | Inhibition Zone (mm) | Evaluation |
---|---|---|
Amoxicillin | 0 | R |
Florfenicol | 13 | I |
Compound Sulfamethoxazole Tablets | 0 | R |
Ciprofloxacin | 0 | R |
Cefotaxime | 0 | R |
Clarithromycin | 0 | R |
Tetracycline | 6 | R |
Doxycycline | 10 | R |
Ceftriaxone | 0 | R |
Norfloxacin | 0 | R |
Amikacin | 0 | R |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cheng, C.; Du, J.; Tao, J.; Cheng, D. Growth Characteristics of Sheep-Derived Bacteroides fragilis and Preliminary Research on Effects in Mice and Lambs. Microorganisms 2025, 13, 87. https://doi.org/10.3390/microorganisms13010087
Cheng C, Du J, Tao J, Cheng D. Growth Characteristics of Sheep-Derived Bacteroides fragilis and Preliminary Research on Effects in Mice and Lambs. Microorganisms. 2025; 13(1):87. https://doi.org/10.3390/microorganisms13010087
Chicago/Turabian StyleCheng, Cheng, Jinye Du, Jianping Tao, and Darong Cheng. 2025. "Growth Characteristics of Sheep-Derived Bacteroides fragilis and Preliminary Research on Effects in Mice and Lambs" Microorganisms 13, no. 1: 87. https://doi.org/10.3390/microorganisms13010087
APA StyleCheng, C., Du, J., Tao, J., & Cheng, D. (2025). Growth Characteristics of Sheep-Derived Bacteroides fragilis and Preliminary Research on Effects in Mice and Lambs. Microorganisms, 13(1), 87. https://doi.org/10.3390/microorganisms13010087