Characterization of Broad Spectrum Bacteriophage vB ESM-pEJ01 and Its Antimicrobial Efficacy Against Shiga Toxin-Producing Escherichia coli in Green Juice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Phage Isolation and Host Range Determination
2.2. Transmission Electron Microscopy (TEM) Analysis
2.3. Bacteriolytic Activity
2.4. Adsorption and One-Step Growth
2.5. Thermal and pH Stability
2.6. Anti-Biofilm Ability
2.7. Whole-Genome Sequencing and Bioinformatics Analysis
2.8. Evaluation of Phage Biocontrol Efficacy Against STEC-Contaminated Green Juice
2.9. Statistical Analysis
3. Results
3.1. Morphology of STEC Phage vB_ESM-pEJ01
3.2. Host Range of STEC Phage vB_ESM-pEJ01
3.3. Bacteriolytic Activity of STEC Phage vB_ESM-pEJ01
3.4. Adsorption Rate and One-Step Growth Curve of STEC Phage vB_ESM-pEJ01
3.5. Environmental Stability of STEC Phage vB_ESM-pEJ01
3.6. Anti-Biofilm Activity of STEC Phage vB_ESM-pEJ01
3.7. Genomic Characteristics of STEC Phage vB_ESM-pEJ01
3.8. Phylogenetic and Genomic Comparison Analysis of STEC Phage vB_ESM-pEJ01
3.9. Biocontrol Efficacy of STEC Phage vB_ESM-pEJ01 Against STEC-Contaminated Green Juice
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Kim, J.S.; Lee, M.S.; Kim, J.H. Recent updates on outbreaks of Shiga toxin-producing Escherichia coli and its potential reservoirs. Front. Cell. Infect. Microbiol. 2020, 10, 273. [Google Scholar] [CrossRef]
- Barlow, R.S.; Gobius, K.S.; Desmarchelier, P.M. Shiga toxin-producing Escherichia coli in ground beef and lamb cuts: Results of a one-year study. Int. J. Food Microbiol. 2006, 111, 1–5. [Google Scholar] [CrossRef]
- Leonard, S.R.; Mammel, M.K.; Lacher, D.W.; Elkins, C.A. Application of metagenomic sequencing to food safety: Detection of Shiga toxin-producing Escherichia coli on fresh bagged spinach. Appl. Environ. Microbiol. 2015, 81, 8183–8191. [Google Scholar] [CrossRef]
- Gómez-Aldapa, C.A.; Rangel-Vargas, E.; Bautista-De León, H.; Castro-Rosas, J. Presence of non-O157 Shiga toxin-producing Escherichia coli, enterotoxigenic E. coli, enteropathogenic E. coli and Salmonella in fresh beetroot (Beta vulgaris L.) juice from public markets in Mexico. J. Sci. Food Agric. 2014, 94, 2705–2711. [Google Scholar] [CrossRef] [PubMed]
- Cufaoğlu, G.; Onaran Acar, B.; Ayaz, N.; Göncüoğlu, M.; Ormanci, F. Biocontrol of Escherichia coli O157: H7 in ready-to-eat salad using a lytic bacteriophage. Med. Water 2017, 73, 422–424. [Google Scholar] [CrossRef]
- Beshiru, A.; Okoh, A.I.; Igbinosa, E.O. Processed ready-to-eat (RTE) foods sold in Yenagoa Nigeria were colonized by diarrheagenic Escherichia coli which constitute a probable hazard to human health. PLoS ONE 2022, 17, e0266059. [Google Scholar] [CrossRef]
- Szych, J.; Wolkowicz, T.; La Ragione, R.; Madajczak, G. Impact of antibiotics on the intestinal microbiota and on the treatment of Shiga-toxin-producing Escherichia coli and Salmonella infections. Curr. Pharm. Des. 2014, 20, 4535–4548. [Google Scholar] [CrossRef] [PubMed]
- Ray, R.; Singh, P. Prevalence and implications of Shiga toxin-producing E. coli in farm and wild ruminants. Pathogens 2022, 11, 1332. [Google Scholar] [CrossRef] [PubMed]
- Sillankorva, S.M.; Oliveira, H.; Azeredo, J. Bacteriophages and their role in food safety. Int. J. Microbiol. 2012, 2012, 863945. [Google Scholar] [CrossRef] [PubMed]
- Carter, C.D.; Parks, A.; Abuladze, T.; Li, M.; Woolston, J.; Magnone, J.; Senecal, A.; Kropinski, A.M.; Sulakvelidze, A. Bacteriophage cocktail significantly reduces Escherichia coli O157: H7 contamination of lettuce and beef, but does not protect against recontamination. Bacteriophage 2012, 2, 178–185. [Google Scholar] [CrossRef] [PubMed]
- Abuladze, T.; Li, M.; Menetrez, M.Y.; Dean, T.; Senecal, A.; Sulakvelidze, A. Bacteriophages reduce experimental contamination of hard surfaces, tomato, spinach, broccoli, and ground beef by Escherichia coli O157: H7. Appl. Environ. Microbiol. 2008, 74, 6230–6238. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Niu, Y.D.; Nan, Y.; Stanford, K.; Holley, R.; McAllister, T.; Narváez-Bravo, C. SalmoFresh™ effectiveness in controlling Salmonella on romaine lettuce, mung bean sprouts and seeds. Int. J. Food Microbiol. 2019, 305, 108250. [Google Scholar] [CrossRef] [PubMed]
- Moye, Z.D.; Woolston, J.; Sulakvelidze, A. Bacteriophage applications for food production and processing. Viruses 2018, 10, 205. [Google Scholar] [CrossRef]
- Kumar, A.; Malik, H.; Dubal, Z.B.; Jaiswal, R.K.; Kumar, S.; Kumar, B.; Agarwal, R.K. Isolation and characterization of Salmonella phages and phage cocktail mediated biocontrol of Salmonella enterica serovar Typhimurium in chicken meat. LWT 2022, 155, 112957. [Google Scholar] [CrossRef]
- Costa, P.; Pereira, C.; Gomes, A.T.; Almeida, A. Efficiency of single phage suspensions and phage cocktail in the inactivation of Escherichia coli and Salmonella Typhimurium: An in vitro preliminary study. Microorganisms 2019, 7, 94. [Google Scholar] [CrossRef]
- Li, C.; Shi, T.; Sun, Y.; Zhang, Y. A novel method to create efficient phage cocktails via use of phage-resistant bacteria. Appl. Environ. Microbiol. 2022, 88, 6. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Ye, M.; Zhang, X.; Sun, M.; Zhang, Z.; Chao, H.; Huang, D.; Wan, J.; Zhang, S.; Jiang, X. Comparing polyvalent bacteriophage and bacteriophage cocktails for controlling antibiotic-resistant bacteria in soil-plant system. Sci. Total Environ. 2019, 657, 918–925. [Google Scholar] [CrossRef] [PubMed]
- Hamdi, S.; Rousseau, G.M.; Labrie, S.J.; Tremblay, D.M.; Kourda, R.S.; Ben Slama, K.; Moineau, S. Characterization of two polyvalent phages infecting Enterobacteriaceae. Sci. Rep. 2017, 7, 40349. [Google Scholar] [CrossRef] [PubMed]
- Duc, H.M.; Son, H.M.; Yi, H.P.S.; Sato, J.; Ngan, P.H.; Masuda, Y.; Honjoh, K.-i.; Miyamoto, T. Isolation, characterization and application of a polyvalent phage capable of controlling Salmonella and Escherichia coli O157: H7 in different food matrices. Int. Food Res. 2020, 131, 108977. [Google Scholar] [CrossRef] [PubMed]
- Kurtböke, D.I.; Palk, A.; Marker, A.; Neuman, C.; Moss, L.; Streeter, K.; Katouli, M. Isolation and characterization of Enterobacteriaceae species infesting post-harvest strawberries and their biological control using bacteriophages. Appl. Microbiol. Biotechnol. 2016, 100, 8593–8606. [Google Scholar] [CrossRef] [PubMed]
- Hou, P.F.; Tang, R.J.; Huang, J.; Luo, D. Isolation, characterization and application of a novel polyvalent bacteriophage SF02 for the control of Salmonella and Escherichia coli O157: H7 in foods. LWT 2024, 203, 116383. [Google Scholar] [CrossRef]
- Park, S.Y.; Kwon, H.; Kim, S.G.; Park, S.C.; Kim, J.H.; Seo, S. Characterization of two lytic bacteriophages, infecting Streptococcus bovis/equinus complex (SBSEC) from Korean ruminant. Sci. Rep. 2023, 13, 9110. [Google Scholar] [CrossRef] [PubMed]
- Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 2012, 9, 671–675. [Google Scholar] [CrossRef] [PubMed]
- Manohar, P.; Tamhankar, A.J.; Lundborg, C.S.; Nachimuthu, R. Therapeutic characterization and efficacy of bacteriophage cocktails infecting Escherichia coli, Klebsiella pneumoniae, and Enterobacter species. Front. Microbiol. 2019, 10, 574. [Google Scholar] [CrossRef]
- Kwon, H.; Park, S.Y.; Kim, M.-S.; Kim, S.G.; Park, S.C.; Kim, J.H. Characterization of a lytic bacteriophage vB_SurP-PSU3 infecting Staphylococcus ureilyticus and its efficacy against biofilm. Front. Microbiol. 2022, 13, 925866. [Google Scholar] [CrossRef]
- Bankevich, A.; Nurk, S.; Antipov, D.; Gurevich, A.A.; Dvorkin, M.; Kulikov, A.S.; Lesin, V.M.; Nikolenko, S.I.; Pham, S.; Prjibelski, A.D. SPAdes: A new genome assembly algorithm and its applications to single-cell sequencing. Comput. Biol. 2012, 19, 455–477. [Google Scholar] [CrossRef] [PubMed]
- Aziz, R.K.; Bartels, D.; Best, A.A.; DeJongh, M.; Disz, T.; Edwards, R.A.; Formsma, K.; Gerdes, S.; Glass, E.M.; Kubal, M. The RAST Server: Rapid annotations using subsystems technology. BMC Genom. 2008, 9, 75. [Google Scholar] [CrossRef]
- Paysan-Lafosse, T.; Blum, M.; Chuguransky, S.; Grego, T.; Pinto, B.L.; Salazar, G.A.; Bileschi, M.L.; Bork, P.; Bridge, A.; Colwell, L. InterPro in 2022. Nucleic Acids Res. 2023, 51, D418–D427. [Google Scholar] [CrossRef] [PubMed]
- Mistry, J.; Chuguransky, S.; Williams, L.; Qureshi, M.; Salazar, G.A.; Sonnhammer, E.L.; Tosatto, S.C.; Paladin, L.; Raj, S.; Richardson, L.J. Pfam: The protein families database in 2021. Nucleic Acids Res. 2021, 49, D412–D419. [Google Scholar] [CrossRef]
- Hallgren, J.; Tsirigos, K.; Pedersen, M.D.; Almagro Armenteros, J.J.; Marcatili, P.; Nielsen, H.; Krogh, A.; Winther, O. DeepTMHMM predicts alpha and beta transmembrane proteins using deep neural networks. bioRxiv 2022. [Google Scholar] [CrossRef]
- Teufel, F.; Almagro Armenteros, J.J.; Johansen, A.R.; Gíslason, M.H.; Pihl, S.I.; Tsirigos, K.D.; Winther, O.; Brunak, S.; von Heijne, G.; Nielsen, H. SignalP 6.0 predicts all five types of signal peptides using protein language models. Nat. Biotechnol. 2022, 40, 1023–1025. [Google Scholar] [CrossRef] [PubMed]
- Chan, P.P.; Lin, B.Y.; Mak, A.J.; Lowe, T.M. tRNAscan-SE 2.0: Improved detection and functional classification of transfer RNA genes. Nucleic Acids Res. 2021, 49, 9077–9096. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Yang, J.; Yu, J.; Yao, Z.; Sun, L.; Shen, Y.; Jin, Q. VFDB: A reference database for bacterial virulence factors. Nucleic Acids Res. 2005, 33, D325–D328. [Google Scholar] [CrossRef] [PubMed]
- Gupta, S.K.; Padmanabhan, B.R.; Diene, S.M.; Lopez-Rojas, R.; Kempf, M.; Landraud, L.; Rolain, J.-M. ARG-ANNOT, a new bioinformatic tool to discover antibiotic resistance genes in bacterial genomes. Antimicrob. Agents Chemother. 2014, 58, 212–220. [Google Scholar] [CrossRef] [PubMed]
- Garneau, J.R.; Depardieu, F.; Fortier, L.-C.; Bikard, D.; Monot, M. PhageTerm: A tool for fast and accurate determination of phage termini and packaging mechanism using next-generation sequencing data. Sci. Rep. 2017, 7, 8292. [Google Scholar] [CrossRef] [PubMed]
- Grant, J.R.; Enns, E.; Marinier, E.; Mandal, A.; Herman, E.K.; Chen, C.-y.; Graham, M.; Van Domselaar, G.; Stothard, P. Proksee: In-depth characterization and visualization of bacterial genomes. Nucleic Acids Res. 2023, 51, W484–W492. [Google Scholar] [CrossRef]
- Meier-Kolthoff, J.P.; Göker, M. VICTOR: Genome-based phylogeny and classification of prokaryotic viruses. Bioinformatics 2017, 33, 3396–3404. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
- Moraru, C.; Varsani, A.; Kropinski, A.M. VIRIDIC—A novel tool to calculate the intergenomic similarities of prokaryote-infecting viruses. Viruses 2020, 12, 1268. [Google Scholar] [CrossRef] [PubMed]
- Nishimura, Y.; Yoshida, T.; Kuronishi, M.; Uehara, H.; Ogata, H.; Goto, S. ViPTree: The viral proteomic tree server. Bioinformatics 2017, 33, 2379–2380. [Google Scholar] [CrossRef]
- Chui, L.; Couturier, M.R.; Chiu, T.; Wang, G.; Olson, A.B.; McDonald, R.R.; Antonishyn, N.A.; Horsman, G.; Gilmour, M.W. Comparison of Shiga toxin-producing Escherichia coli detection methods using clinical stool samples. J. Mol. Diagn. 2010, 12, 469–475. [Google Scholar] [CrossRef]
- Adriaenssens, E.M.; Brister, J.R. How to name and classify your phage: An informal guide. Viruses 2017, 9, 70. [Google Scholar] [CrossRef] [PubMed]
- Alves, D.; Cerqueira, M.A.; Pastrana, L.M.; Sillankorva, S. Entrapment of a phage cocktail and cinnamaldehyde on sodium alginate emulsion-based films to fight food contamination by Escherichia coli and Salmonella Enteritidis. Int. Food Res. 2020, 128, 108791. [Google Scholar] [CrossRef]
- Poojari, K.; Akhila, D.S.; Raj, J.M.; Santhosh, K.S.; Kenjar, A.; Ashwath, P. Biocontrol of Escherichia coli and Salmonella in poultry meat using phage cocktail. Iran. J. Vet. Res. 2022, 23, 270. [Google Scholar] [CrossRef]
- Zhang, Y.; Zou, G.; Islam, M.S.; Liu, K.; Xue, S.; Song, Z.; Ye, Y.; Zhou, Y.; Shi, Y.; Wei, S. Combine thermal processing with polyvalent phage LPEK22 to prevent the Escherichia coli and Salmonella enterica contamination in food. Int. Food Res. 2023, 165, 112454. [Google Scholar] [CrossRef]
- Zhou, Y.; Li, L.; Han, K.; Wang, L.; Cao, Y.; Ma, D.; Wang, X. A polyvalent broad-spectrum Escherichia phage tequatrovirus EP01 capable of controlling Salmonella and Escherichia coli contamination in foods. Viruses 2022, 14, 286. [Google Scholar] [CrossRef] [PubMed]
- Abdelhadi, I.M.; Sofy, A.R.; Hmed, A.A.; Refaey, E.E.; Soweha, H.E.; Abbas, M.A. Discovery of Polyvalent Myovirus (vB_STM-2) Phage as a natural antimicrobial system to lysis and biofilm removal of Salmonella Typhimurium Isolates from various food sources. Sustainability 2021, 13, 11602. [Google Scholar] [CrossRef]
- Liao, Y.-T.; Zhang, Y.; Salvador, A.; Harden, L.A.; Wu, V.C. Characterization of a T4-like bacteriophage vB_EcoM-Sa45lw as a potential biocontrol agent for Shiga toxin-producing Escherichia coli O45 contaminated on mung bean seeds. Microbiol. Spectr. 2022, 10, e02220–e02221. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.-H.; Park, Y.-R.; Jung, H.; Park, M.-K. Characterization of a lytic phage KFS-EC3 infecting multiple foodborne pathogens. Korean J. Food Preserv. 2022, 29, 1022–1034. [Google Scholar] [CrossRef]
- Jończyk-Matysiak, E.; Łodej, N.; Kula, D.; Owczarek, B.; Orwat, F.; Międzybrodzki, R.; Neuberg, J.; Bagińska, N.; Weber-Dąbrowska, B.; Górski, A. Factors determining phage stability/activity: Challenges in practical phage application. Expert Rev. Anti. Infect. Ther. 2019, 17, 583–606. [Google Scholar] [CrossRef]
- Vogeleer, P.; Tremblay, Y.D.; Mafu, A.A.; Jacques, M.; Harel, J. Life on the outside: Role of biofilms in environmental persistence of Shiga-toxin producing Escherichia coli. Front. Microbiol. 2014, 5, 317. [Google Scholar] [CrossRef] [PubMed]
- Zuber, S.; Ngom-Bru, C.; Barretto, C.; Bruttin, A.; Brüssow, H.; Denou, E. Genome analysis of phage JS98 defines a fourth major subgroup of T4-like phages in Escherichia coli. J. Bacteriol. 2007, 189, 8206–8214. [Google Scholar] [CrossRef]
- Desplats, C.; Dez, C.; Tétart, F.; Eleaume, H.d.; Krisch, H. Snapshot of the genome of the pseudo-T-even bacteriophage RB49. J. Bacteriol. 2002, 184, 2789–2804. [Google Scholar] [CrossRef]
- Efimov, A.D.; Golomidova, A.K.; Kulikov, E.E.; Belalov, I.S.; Ivanov, P.A.; Letarov, A.V. RB49-like bacteriophages recognize O antigens as one of the alternative primary receptors. Int. J. Mol. Sci. 2022, 23, 11329. [Google Scholar] [CrossRef] [PubMed]
- Filik, K.; Szermer-Olearnik, B.; Oleksy, S.; Brykała, J.; Brzozowska, E. Bacteriophage tail proteins as a tool for bacterial pathogen recognition—A literature review. Antibiotics 2022, 11, 555. [Google Scholar] [CrossRef] [PubMed]
- Chan, B.K.; Abedon, S.T. Phage therapy pharmacology: Phage cocktails. Adv. Appl. Microbiol. 2012, 78, 1–23. [Google Scholar] [CrossRef] [PubMed]
- Malik, D.J.; Sokolov, I.J.; Vinner, G.K.; Mancuso, F.; Cinquerrui, S.; Vladisavljevic, G.T.; Clokie, M.R.J.; Garton, N.J.; Stapley, A.G.F.; Kirpichnikova, A. Formulation, stabilisation and encapsulation of bacteriophage for phage therapy. Adv. Colloid Interface Sci. 2017, 249, 100–133. [Google Scholar] [CrossRef]
- León, M.; Bastías, R. Virulence reduction in bacteriophage resistant bacteria. Front. Microbiol. 2015, 6, 343. [Google Scholar] [CrossRef] [PubMed]
- Bielaszewska, M.; Idelevich, E.A.; Zhang, W.; Bauwens, A.; Schaumburg, F.; Mellmann, A.; Peters, G.; Karch, H. Effects of antibiotics on Shiga toxin 2 production and bacteriophage induction by epidemic Escherichia coli O104: H4 strain. Antimicrob. Agents Chemother. 2012, 56, 3277–3282. [Google Scholar] [CrossRef] [PubMed]
- Riley, L.M.; Veses-Garcia, M.; Hillman, J.D.; Handfield, M.; McCarthy, A.J.; Allison, H.E. Identification of genes expressed in cultures of E. coli lysogens carrying the Shiga toxin-encoding prophage Φ24 B. BMC Microbiol. 2012, 12, 42. [Google Scholar] [CrossRef] [PubMed]
- Ramstad, S.N.; Taxt, A.M.; Naseer, U.; Wasteson, Y.; Bjørnholt, J.V.; Brandal, L.T. Effects of antimicrobials on Shiga toxin production in high-virulent Shiga toxin-producing Escherichia coli. Microb. Pathog. 2021, 152, 104636. [Google Scholar] [CrossRef] [PubMed]
- Paton, A.W.; Paton, J.C. Detection and characterization of Shiga toxigenic Escherichia coli by using multiplex PCR assays for stx 1, stx 2, eaeA, enterohemorrhagic E. coli hlyA, rfb O111, and rfb O157. J. Clin. Microbiol. 1998, 36, 598–602. [Google Scholar] [CrossRef] [PubMed]
Genes | Sequences (5′ to 3′) | Annealing Temperature (°C) | Efficiency * | Amplicon Size (bp) |
---|---|---|---|---|
stx 1 | F: CATTACAGACTATTTCATCAGGAGGTA | 55 | 1.98 | 88 |
R: TCGTTCAACAATAAGCCGTAGATTA | ||||
stx 2 | F: GCGGTTTTATTTGCATTAGC | 55 | 1.91 | 75 |
R: TCCCGTCAACCTTCACTGTA |
Bacterial Species | Strains * | Sensitivity of Phage vB_ESM-pEJ01 |
---|---|---|
Escherichia spp. | ||
Shiga toxin-producing Escherichia coli (STEC) | ATCC 43895 | + |
KCCM 90572 | + | |
KCCM 90573 | + | |
KCCM 90574 | + | |
KCCM 90575 | + | |
KCCM 90576 | + | |
KCCM 90577 | + | |
KCCM 90578 | + | |
KCCM 90579 | + | |
KCCM 90580 | + | |
KCCM 90581 | + | |
KCCM 90582 | + | |
KCCM 90583 | + | |
KCCM 90584 | − | |
KCCM 90585 | + | |
Non-STEC | ATCC 13706 | + |
ATCC 11775 | + | |
ATCC 31616 | + | |
ATCC 31618 | + | |
ATCC 23545 | + | |
KCCM 90525 | + | |
KCCM 90526 | + | |
Enterohemorrhagic Escherichia coli (EHEC) | NCCP 13720 | + |
NCCP 13721 | + | |
Escherichia hermanni | ATCC 33650 | + |
Escherichia fergusonii | ATCC 35469 | + |
Salmonella spp. | ||
Salmonella (S.) enterica serovar Enteritidis | KCTC 82777 | + |
KCTC 82776 | + | |
KCCM 90531 | + | |
KCCM 90532 | − | |
KCCM 90533 | − | |
KCCM 90534 | − | |
KCCM 90535 | + | |
KCCM 90536 | − | |
KCCM 90537 | − | |
KCCM 90538 | − | |
KCCM 90539 | − | |
KCCM 90540 | + | |
KCCM 90541 | − | |
KCCM 90542 | − | |
KCCM 90543 | − | |
KCCM 90544 | − | |
KCCM 90545 | − | |
KCCM 90546 | + | |
KCCM 90547 | - | |
KCCM 90548 | + | |
KCCM 90549 | − | |
KCCM 90550 | − | |
KCCM 90551 | − | |
KCCM 90552 | − | |
KCCM 90553 | + | |
KCCM 90554 | + | |
KCCM 90555 | + | |
KCCM 90556 | − | |
S. enterica serovar Typhimurium | KCCM 90557 | − |
KCCM 90558 | + | |
KCCM 90559 | + | |
KCCM 90560 | + | |
KCCM 90561 | + | |
KCCM 90562 | − | |
KCCM 90563 | − | |
KCCM 90564 | + | |
KCCM 90565 | + | |
KCCM 90566 | + | |
S. enterica serovar Agona | KCCM 90567 | + |
S. enterica serovar Bareilly | KCCM 90568 | − |
S. enterica serovar Infantis | KCCM 90569 | − |
S. enterica serovar Senftenberg | KCCM 90571 | − |
S. enterica serovar Motevideo | KCCM 90570 | − |
S. enterica serovar Java | NCTC 9683 | + |
S. enterica serovar Heidelberg | NCTC 14765 | + |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Park, E.J.; Lee, S.; Na, J.B.; Kim, Y.B.; Lee, K.M.; Park, S.Y.; Kim, J.H. Characterization of Broad Spectrum Bacteriophage vB ESM-pEJ01 and Its Antimicrobial Efficacy Against Shiga Toxin-Producing Escherichia coli in Green Juice. Microorganisms 2025, 13, 103. https://doi.org/10.3390/microorganisms13010103
Park EJ, Lee S, Na JB, Kim YB, Lee KM, Park SY, Kim JH. Characterization of Broad Spectrum Bacteriophage vB ESM-pEJ01 and Its Antimicrobial Efficacy Against Shiga Toxin-Producing Escherichia coli in Green Juice. Microorganisms. 2025; 13(1):103. https://doi.org/10.3390/microorganisms13010103
Chicago/Turabian StylePark, Eun Jeong, Seungki Lee, Jong Beom Na, Ye Bin Kim, Kee Man Lee, Seon Young Park, and Ji Hyung Kim. 2025. "Characterization of Broad Spectrum Bacteriophage vB ESM-pEJ01 and Its Antimicrobial Efficacy Against Shiga Toxin-Producing Escherichia coli in Green Juice" Microorganisms 13, no. 1: 103. https://doi.org/10.3390/microorganisms13010103
APA StylePark, E. J., Lee, S., Na, J. B., Kim, Y. B., Lee, K. M., Park, S. Y., & Kim, J. H. (2025). Characterization of Broad Spectrum Bacteriophage vB ESM-pEJ01 and Its Antimicrobial Efficacy Against Shiga Toxin-Producing Escherichia coli in Green Juice. Microorganisms, 13(1), 103. https://doi.org/10.3390/microorganisms13010103