PeVL1 Novel Elicitor Protein, from Verticillium lecanii 2, Enhances Systemic Resistance against Rice Leaf Roller (Marasmia ruralis Wlk.) in Rice (Oryza sativa L.)
Abstract
1. Introduction
2. Materials and Methods
2.1. Establishment of M. ruralis Colonies and O. sativa Cultivation
2.2. PeVL1 Evaluation
2.3. Marasmia ruralis Infestation on the Plant
2.4. Growth Rate of M. ruralis
2.5. Marasmia ruralis Bioassay
2.6. PeVL1 Impacts on O. sativa Development and Structure
2.7. HPLC/MS
2.8. Gene Expressions
2.9. Data Analysis
3. Results
3.1. Marasmia ruralis Indoors
3.2. PeVL1 Influenced M. ruralis Larval Development and Fecundity
3.3. PeVL1 Influenced the Development and Structure of O. sativa
3.4. SA, JA, and ET Quantities
3.5. Defense-Related Gene Expression Fold Change
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Silipo, A.; Erbs, G.; Shinya, T.; Maxwell Dow, J.M.; Parrilli, M.; Lanzetta, R.; Shibuya, N.; Newman, M.A.; Molinaro, A. Glycoconjugates as elicitors or suppressors of plant innate immunity. Glycobiology 2009, 20, 406–419. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, W.; Berkowitz, G.A. The grateful dead: Calcium and cell death in plant innate immunity. Cell. Microbiol. 2007, 9, 2571–2585. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Garcia-Brugger, A.; Lamotte, O.; Vandelle, E.; Bourque, S.; Lecourieux, D.; Poinssot, B.; Wendehenne, D.; Pugin, A. Early signaling events induced by elicitors of plant defenses. Mol. Plant-Microbe Interact. 2006, 19, 711–724. [Google Scholar] [CrossRef] [Scilit]
- Nürnberger, T.; Brunner, F. Innate immunity in plants and animals: Emerging parallels between the recognition of general elicitors and pathogen-associated molecular patterns. Curr. Opin. Plant Biol. 2002, 5, 318–324. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thomma, B.P.H.J.; Nu, T.; Joosten, M.H.A.J. Of PAMPs and Effectors: The Blurred PTI-ETI Dichotomy. Plant Cell 2011, 23, 4–15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yano, A.; Suzuki, K.; Uchimiya, H.; Shinshi, H. Induction of hypersensitive cell death by a fungal protein in cultures of tobacco cells. Mol. Plant-Microbe Interact. 1998, 11, 115–123. [Google Scholar] [CrossRef] [Scilit]
- Zhao, L.Y.; Chen, J.L.; Cheng, D.F.; Sun, J.R.; Liu, Y.; Tian, Z. Biochemical and molecular characterizations of Sitobion avenae-induced wheat defense responses. Crop Prot. 2009, 28, 435–442. [Google Scholar] [CrossRef] [Scilit]
- Ellis, J.G.; Rafiqi, M.; Gan, P.; Chakrabarti, A.; Dodds, P.N. Recent progress in discovery and functional analysis of effector proteins of fungal and oomycete plant pathogens. Curr. Opin. Plant Biol. 2009, 12, 399–405. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bent, A.F.; Mackey, D. Elicitors, effectors, and R genes: The new paradigm and a lifetime supply of questions. Annu. Rev. Phytopathol. 2008, 45, 399–436. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Foyer, C.H.; Noctor, G. Oxidant and antioxidant signalling in plants: A re-evaluation of the concept of oxidative stress in a physiological context. Plant Cell Environ. 2005, 28, 1056–1071. [Google Scholar] [CrossRef] [Scilit]
- Montesano, M.; Brader, G.; Palva, E.T. Pathogen derived elicitors: Searching for receptors in plants. Mol. Plant Pathol. 2003, 4, 73–79. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hael-Conrad, V.; Perato, S.M.; Arias, M.E.; Martínez-Zamora, M.G.; Di Peto, P.D.L.Á.; Martos, G.G.; Castagnaro, A.P.; Díaz-Ricci, J.C.; Chalfoun, N.R. The elicitor protein AsES induces a systemic acquired resistance response accompanied by systemic microbursts and micro-hypersensitive responses in Fragaria ananassa. Mol. Plant-Microbe Interact. 2018, 31, 46–60. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Javed, K.; Javed, H.; Qiu, D. PeBL1 of Brevibacillus laterosporus a new biocontrol tool for wheat aphid management (Sitobion avenae) in triticum aestivum. Int. J. Trop. Insect Sci. 2021. [Google Scholar] [CrossRef] [Scilit]
- Javed, K.; Javed, H.; Qiu, D. Biocontrol Potential of Purified Elicitor Protein PeBL1 Extracted from Brevibacillus laterosporus Strain A60 and Its Capacity in the Induction of Defense Process against Cucumber Aphid (Myzus persicae ) in Cucumber (Cucumis sativus). Biology 2020, 9, 179. [Google Scholar] [CrossRef] [Scilit]
- Javed, K.; Javed, H.; Mukhtar, T.; Qiu, D. Pathogenicity of some entomopathogenic fungal strains to green peach aphid, Myzus persicae Sulzer (Homoptera: Aphididae). Egypt. J. Biol. Pest Control 2019, 29, 92. [Google Scholar] [CrossRef] [Scilit]
- Javed, K.; Javed, H.; Mukhtar, T.; Qiu, D. Efficacy of Beauveria bassiana and Verticillium lecanii for the management of whitefly and aphid. Pak. J. Agric. Sci. 2019, 56, 669–674. [Google Scholar] [CrossRef]
- Javed, K.; Talha, H.; Ayesha, H.; Wang, Y.; Javed, H. PeaT1 and PeBC1 Microbial Protein Elicitors Enhanced Resistance against Myzus persicae Sulzer in Chili. Microorganisms 2021, 9, 2197. [Google Scholar] [CrossRef] [Scilit]
- Jakobs, R.; Schweiger, R.; Müller, C. Aphid infestation leads to plant part-specific changes in phloem sap chemistry, which may indicate niche construction. New Phytol. 2019, 221, 503–514. [Google Scholar] [CrossRef] [Scilit]
- Nouri-Ganbalani, G.; Borzoui, E.; Shahnavazi, M.; Nouri, A. Induction of resistance against Plutella xylostella (L.) (Lep.: Plutellidae) by jasmonic acid and mealy cabbage aphid feeding in Brassica napus L. Front. Physiol. 2018, 9, 859. [Google Scholar] [CrossRef] [Scilit]
- Salzman, R.A.; Brady, J.A.; Finlayson, S.A.; Buchanan, C.D.; Summer, E.J.; Sun, F.; Klein, P.E.; Klein, R.R.; Pratt, L.H.; Cordonnier-Pratt, M.M.; et al. Transcriptional profiling of sorghum induced by methyl jasmonate, salicylic acid, and aminocyclopropane carboxylic acid reveals cooperative regulation and novel gene responses. Plant Physiol. 2005, 138, 352–368. [Google Scholar] [CrossRef] [Scilit]
- Lazebnik, J.; Frago, E.; Dicke, M.; van Loon, J.J.A. Phytohormone Mediation of Interactions Between Herbivores and Plant Pathogens. J. Chem. Ecol. 2014, 40, 730–741. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ali, J.G.; Agrawal, A.A. Asymmetry of plant-mediated interactions between specialist aphids and caterpillars on two milkweeds. Funct. Ecol. 2014, 28, 1404–1412. [Google Scholar] [CrossRef] [Scilit]
- Sandoya, G.V.; de Oliveira Buanafina, M.M. Differential responses of Brachypodium distachyon genotypes to insect and fungal pathogens. Physiol. Mol. Plant Pathol. 2014, 85, 53–64. [Google Scholar] [CrossRef] [Scilit]
- Nisar, M.S. Comparative effect of termiticides and plant extracts on mortality and tunnel formation of Odontotermes obesus. Pur. and Appl. Biol. 2020, 9, 1903–1910. [Google Scholar] [CrossRef] [Scilit]
- Kabaluk, J.T.; Ericsson, J.D. Metarhizium anisopliae seed treatment increases yield of field corn when applied for wireworm control. Agr. Jour. 2007, 99, 1377–1381. [Google Scholar] [CrossRef] [Scilit]
- Thaler, J.S.; Agrawal, A.A.; Rayko, H. Salicylate-mediated interactions between pathogens and herbivores. Ecology 2010, 91, 1075–1082. [Google Scholar] [CrossRef] [Scilit]
- Liao, X.; O’Brien, T.R.; Fang, W.; St. Leger, R.J. The plant beneficial effects of Metarhizium species correlate with their association with roots. App. Micro. Biotech. 2014, 98, 7089–7096. [Google Scholar] [CrossRef] [Scilit]
- Thaler, J.S.; Humphrey, P.T.; Whiteman, N.K. Evolution of jasmonate and salicylate signal crosstalk. Trends Plant Sci. 2012, 17, 260–270. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, F.; Liu, H.; Jia, Q.; Wu, X.; Guo, X.; Zhang, S.; Song, F.; Dong, H. The internal glycine-rich motif and cysteine suppress several effects of the HpaGXooc protein in plants. Phytopathology 2006, 96, 1052–1059. [Google Scholar] [CrossRef] [Scilit]
- Mishra, A.K.; Sharma, K.; Misra, R.S. Elicitor recognition, signal transduction and induced resistance in plants. J. Plan. Int. 2012, 7, 95–120. [Google Scholar] [CrossRef] [Scilit]
- Nam, T.D.; Abdulle, Y.A.; Javed, K.; Sokea, T.; Qiu, D. A Novel Protein Elicitor PevL1, from Verticillium lecanii 2, Induces Systemic Resistance against Bean Aphid (Megoura Japonica Matsumura) in Phaseolus Vulgaris L. Int. J. Plan. Ani. Env. Sci. 2020, 10, 81–94. [Google Scholar]
- Li, Y.H.; Wei, F.; Dong, X.Y.; Peng, J.H.; Liu, S.Y.; Chen, H. Simultaneous analysis of multiple endogenous plant hormones in leaf tissue of oilseed rape by solid-phase extraction coupled with high-performance liquid chromatography-electrospray ionisation tandem mass spectrometry. Phyto. Anal. 2011, 22, 442–449. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jarošová, J.; Kundu, J.K. Validation of reference genes as internal control for studying viral infections in cereals by quantitative real-time RT-PCR. BMC. Pla. Biol. 2010, 10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Javed, K.; Qiu, D. Protein Elicitor PeBL1 of Brevibacillus laterosporus Enhances Resistance Against Myzus persicae in Tomato. Pathogens 2020, 9, 57. [Google Scholar] [CrossRef] [Scilit]
- Boughton, A.J.; Hoover, K.; Felton, G.W. Impact of chemical elicitor applications on greenhouse tomato plants and population growth of the green peach aphid, Myzus persicae. Entomol. Exp. Appl. 2006, 120, 175–188. [Google Scholar] [CrossRef] [Scilit]
- Mallinger, R.E.; Hogg, D.B.; Gratton, C. Methyl Salicylate Attracts Natural Enemies and Reduces Populations of Soybean Aphids (Hemiptera: Aphididae) in Soybean Agroecosystems. J. Econ. Entomol. 2011, 104, 115–124. [Google Scholar] [CrossRef] [Scilit]
- Schaller, F.; Schaller, A.; Stintzi, A. Biosynthesis and metabolism of jasmonates. J. Plant Growth Regul. 2004, 23, 179–199. [Google Scholar] [CrossRef] [Scilit]
- Glas, J.J.; Schimmel, B.C.J.; Alba, J.M.; Escobar-Bravo, R.; Schuurink, R.C.; Kant, M.R. Plant glandular trichomes as targets for breeding or engineering of resistance to herbivores. Int. J. Mol. Sci. 2012, 13, 17077–17103. [Google Scholar] [CrossRef] [Scilit]
- Shenashen, M.; Derbalah, A.; Hamza, A.; Mohamed, A.; El Safty, S. Antifungal activity of fabricated mesoporous alumina nanoparticles against root rot disease of tomato caused by Fusarium oxysporium. Pest Manag. Sci. 2017, 73, 1121–1126. [Google Scholar] [CrossRef] [Scilit]
- Tian, D.; Tooker, J.; Peiffer, M.; Chung, S.H.; Felton, G.W. Role of trichomes in defense against herbivores: Comparison of herbivore response to woolly and hairless trichome mutants in tomato (Solanum lycopersicum). Planta 2012, 236, 1053–1066. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.; Sheng, L.; Zhang, H.; Du, X.; An, C.; Xia, X.; Chen, F.; Jiang, J.; Chen, S. CmMYB19 over-expression improves aphid tolerance in Chrysanthemum by promoting lignin synthesis. Int. J. Mol. Sci. 2017, 18, 619. [Google Scholar] [CrossRef] [Scilit]
- dos Santos Tozin, L.R.; Marques, M.O.M.; Rodrigues, T.M. Herbivory by leaf-cutter ants changes the glandular trichomes density and the volatile components in an aromatic plant model. AoB Plants 2017, 9, plx057. [Google Scholar] [CrossRef] [Scilit]
- Boughton, A.J.; Hoover, K.; Felton, G.W. Methyl jasmonate application induces increased densities of glandular trichomes on tomato, Lycopersicon esculentum. J. Chem. Ecol. 2005, 31, 2211–2216. [Google Scholar] [CrossRef] [Scilit]
- Ni, Y.; Wang, J.; Song, C.; Xia, R.-E.; Sun, Z.-Y.; Guo, Y.-J.; Li, J.-N. Effects of SA Induction on Leaf Cuticular Wax and Resistance to Sclerotinia sclerotiorurn in Brassica napus. Acta Agron. Sin. 2013, 39, 110. [Google Scholar] [CrossRef] [Scilit]
- Farmer, E.E.; Johnson, R.R.; Ryan, C.A. Regulation of expression of proteinase inhibitor genes by methyl jasmonate and jasmonic acid. Plant Physiol. 1992, 98, 995–1002. [Google Scholar] [CrossRef] [Scilit]
- Mahmoud, F.; Mahfouz, H. Effects of salicylic acid elicitor against aphids on wheat and detection of infestation using infrared thermal imaging technique in Ismailia, Egypt. Pestic. Fitomed. 2015, 30, 91–97. [Google Scholar] [CrossRef] [Scilit]
- Hammond-Kosack, K.E.; Parker, J.E. Deciphering plant-pathogen communication: Fresh perspectives for molecular resistance breeding. Curr. Opin. Biotechnol. 2003, 14, 177–193. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, H.S.; Delaney, T.P. Over-expression of TGA5, which encodes a bZIP transcription factor that interacts with NIM1/NPR1, confers SAR-independent resistance in Arabidopsis thaliana to Peronospora parasitica. Plant J. 2002, 32, 151–163. [Google Scholar] [CrossRef] [Scilit]
- Chaerle, L.; Lenk, S.; Hagenbeek, D.; Buschmann, C.; Van Der Straeten, D. Multicolor fluorescence imaging for early detection of the hypersensitive reaction to tobacco mosaic virus. J. Plant Physiol. 2007, 164, 253–262. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nicholson, R.L.; Hammerschmidt, R. Phenolic Compounds And Their Role In Disease Resistance. Annu. Rev. Phytopathol. 1992, 30, 369–389. [Google Scholar] [CrossRef]
- De Vos, M.; Van Oosten, V.R.; Van Poecke, R.M.P.; Van Pelt, J.A.; Pozo, M.J.; Mueller, M.J.; Buchala, A.J.; Métraux, J.P.; Van Loon, L.C.; Dicke, M.; et al. Signal signature and transcriptome changes of Arabidopsis during pathogen and insect attack. Mol. Plant-Microbe Interact. 2005, 18, 923–937. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ali, J.G.; Agrawal, A.A. Specialist versus generalist insect herbivores and plant defense. Trends Plant Sci. 2012, 17, 293–302. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| JA/SA/ET Pathways | Test Genes | Forward Sequence (5′…… 3′) | Reverse Sequence (5′…… 3′) |
|---|---|---|---|
| JA | LOC_Os12g37350.1 | CTCCATGGTTGGTGGAACGA | TAGGGGTACTGGCCGAAGTT |
| JA | LOC_Os11g39220.1 | GCTCACACTTGCGGAATCAC | GGCTTTGTTTGGGGCAACAT |
| JA | LOC_Os06g23760.1 | AGCTCAGGTCACCGACTTTG | ATGAAACGGGAATTCGGCCT |
| JA | LOC_Os08g39850.1 | GAGATGAGGAGTTCGCGAGG | ACGGCAAGAAGAGGTCATGG |
| SA | LOC_Os11g15040.4 | TTCAATGCAGGAGGGACGAC | AGTCATGCATGCGGTTCTCA |
| SA | LOC_Os01g56380.1 | GCATCAACGTCGTGCCTTTC | GATCGGAGCAGTAGACGACG |
| SA | LOC_Os03g53200.1 | TCTTCGACAAGAACGGCGAT | AGGCCAAGAGAACGAGTCAC |
| SA | LOC_Os05g41210.1 | GCGACGGTTGCATCACTACT | GCCTCAGTTGGGTTCTGACC |
| ET | LOC_Os11g08380.1 | TAGCAATGGCCGCTTCAAGA | CTTGAAGCTCGGGTAGTCGG |
| ET | LOC_Os03g01130.1 | GCGGAGCTGTACCTCAACAT | CTTGGAAGACTCCGCTGGTT |
| ET | LOC_Os01g10940.1 | CGGAGACGTTCCTCTTCACC | CTTCTCGTAGTCGACGCTGG |
| ET | LOC_Os03g37710.1 | TGAGAGGAGCCATAGGTGGT | GTAGCGGCTCATGTCGAAGT |
| 18S | GTGACGGGTGACGGAGAATT | GACACTAATGCGCCCGGTAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Javed, K.; Wang, Y.; Javed, H. PeVL1 Novel Elicitor Protein, from Verticillium lecanii 2, Enhances Systemic Resistance against Rice Leaf Roller (Marasmia ruralis Wlk.) in Rice (Oryza sativa L.). Microorganisms 2023, 11, 317. https://doi.org/10.3390/microorganisms11020317
Javed K, Wang Y, Javed H. PeVL1 Novel Elicitor Protein, from Verticillium lecanii 2, Enhances Systemic Resistance against Rice Leaf Roller (Marasmia ruralis Wlk.) in Rice (Oryza sativa L.). Microorganisms. 2023; 11(2):317. https://doi.org/10.3390/microorganisms11020317
Chicago/Turabian StyleJaved, Khadija, Yong Wang, and Humayun Javed. 2023. "PeVL1 Novel Elicitor Protein, from Verticillium lecanii 2, Enhances Systemic Resistance against Rice Leaf Roller (Marasmia ruralis Wlk.) in Rice (Oryza sativa L.)" Microorganisms 11, no. 2: 317. https://doi.org/10.3390/microorganisms11020317
APA StyleJaved, K., Wang, Y., & Javed, H. (2023). PeVL1 Novel Elicitor Protein, from Verticillium lecanii 2, Enhances Systemic Resistance against Rice Leaf Roller (Marasmia ruralis Wlk.) in Rice (Oryza sativa L.). Microorganisms, 11(2), 317. https://doi.org/10.3390/microorganisms11020317

