Molecular Detection of Borrelia burgdorferi Sensu Lato and Anaplasma phagocytophilum in Ticks Collected from Dogs in Urban Areas of North-Eastern Poland
Abstract
:1. Introduction
2. Results
2.1. Tick Collection
2.2. Molecular Identification of Pathogens
2.3. BLASTn Data Analysis
3. Discussion
4. Materials and Methods
4.1. Study Area and Tick Collection
4.2. DNA Extraction
4.3. PCR Conditions
4.4. PCR-RFLP Analysis
4.5. DNA Sequencing and Data Analysis
4.6. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Bengis, R.G.; Leighton, F.A.; Fischer, J.R.; Artois, M.; Mörner, T.; Tate, C.M. The role of wildlife in emerging and re-emerging zoonoses. Rev. Sci. Tech. 2004, 23, 497–511. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dantas-Torres, F.; Chomel, B.B.; Otranto, D. Ticks and tick-borne diseases: A one health perspective. Trends Parasitol. 2012, 28, 437–446. [Google Scholar] [CrossRef]
- Jongejan, F.; Uilenberg, G. The global importance of ticks. Parasitology 2004, 129, 3–14. [Google Scholar] [CrossRef] [PubMed]
- Kubiak, K.; Sielawa, H.; Dziekońska-Rynko, J.; Kubiak, D.; Rydzewska, M.; Dzika, E. Dermacentor reticulatus ticks (Acari: Ixodidae) distribution in north-eastern Poland: An endemic area of tick-borne diseases. Exp. Appl. Acarol. 2018, 75, 289–298. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vencliková, K.; Betášová, L.; Šikutová, S.; Jedličková, P.; Hubálek, Z.; Rudolf, I. Human pathogenic borreliae in Ixodes ricinus ticks in natural and urban ecosystem (Czech Republic). Acta Parasitol. 2014, 59, 717–720. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rauter, C.; Hartung, T. Prevalence of Borrelia burgdorferii sensu lato genospecies in Ixodes ricinus ticks in Europe: A metaanalysis. Appl. Environ. Microbiol. 2005, 71, 7203–7216. [Google Scholar] [CrossRef] [Green Version]
- Křiž, B.; Malý, M.; Balátová, P.; Kodym, P.; Kurzová, Z.; Daniel, M.; Kybicová, K. A serological study of antibodies to Anaplasma phagocytophilum and Borrelia burgdorferi sensu lato in the sera of healthy individuals collected two decades apart. Acta Parasitol. 2018, 63, 33–39. [Google Scholar] [CrossRef]
- Scott, J.D.; Foley, J.E.; Anderson, J.F.; Clark, K.L.; Durden, L.A. Detection of Lyme disease bacterium, Borrelia burgdorferi sensu lato, in blacklegged ticks collected in the Grand River Valley, Ontario, Canada. Int. J. Med. Sci. 2017, 14, 150–158. [Google Scholar] [CrossRef] [Green Version]
- Stanek, G.; Reiter, M. The expanding Lyme Borrelia complex—Clinical significance of genomic species? Clin. Microbiol. Infect. 2011, 17, 487–493. [Google Scholar] [CrossRef] [Green Version]
- Gil, H.; Barral, M.; Escudero, R.; García-Pérez, A.L.; Anda, P. Identification of a new Borrelia species among small mammals in areas of Northern Spain where Lyme disease is endemic. Appl. Environ. Microbiol. 2005, 71, 1336–1345. [Google Scholar] [CrossRef] [Green Version]
- Tälleklint, L.; Jaenson, T.G. Transmission of Borrelia burgdorferi s.l. from mammal reservoirs to the primary vector of Lyme borreliosis, Ixodes ricinus (Acari: Ixodidae), in Sweden. J. Med. Entomol. 1994, 31, 880–886. [Google Scholar] [CrossRef]
- Hovius, K.E.; Stark, L.A.; Bleumink-Pluym, N.M.; Van de Pol, I.; Verbeek-de Kruif, N.; Rijpkema, S.G.; Schouls, L.M.; Houwers, D.J. Presence and distribution of Borrelia burgdorferi sensu lato species in internal organs and skin of naturally infected symptomatic and asymptomatic dogs, as detected by polymerase chain reaction. Vet. Q. 1999, 21, 54–58. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sprong, H.; Dieuwertje Hoornstra, A.A.; Nijhof, A.M.; Knorr, S.; Baarsma, M.W.; Hovius, J.W. Control of Lyme borreliosis and other Ixodes ricinus-borne diseases. Parasites Vectors 2018, 11, 145. [Google Scholar] [CrossRef] [Green Version]
- Carrade, D.D.; Foley, J.E.; Borjesson, D.L.; Sykes, J.E. Canine granulocytic anaplasmosis: A reviev. J. Veter Int. Med. 2009, 23, 1129–1141. [Google Scholar] [CrossRef]
- Dumler, J.S.; Barbet, A.F.; Bekker, C.P.; Dasch, G.A.; Palmer, G.H.; Ray, S.C.; Rikihisa, Y.; Rurangirwa, F.R. Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: Unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and ‘HGE agent’ as subjective synonyms of Ehrlichia phagocytophila. Int. J. Syst. Evol. Microbiol. 2001, 51, 2145–2165. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sainz, Á.; Roura, X.; Miró, G.; Estrada-Peña, A.; Kohn, B.; Harrus, S.; Solano-Gallego, L. Guideline for veterinary practitioners on canine ehrlichiosis and anaplasmosis in Europe. Parasites Vectors 2015, 8, 75. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Strle, F. Human granulocytic ehrlichiosis in Europe. Int. J. Med. Mirobiol. 2004, 293, 27–35. [Google Scholar] [CrossRef]
- Bakken, J.S.; Dumler, J.S. Human granulocytic anaplasmosis. Infect. Dis. Clin. N. Am. 2015, 29, 341–355. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bakken, J.S.; Kreuth, J.; Wilson-Nordskog, C. Clinical and laboratory characteristics of human granulocytic ehrlichiosis. JAMA 1996, 275, 199–205. [Google Scholar] [CrossRef] [PubMed]
- Kohn, B.; Galke, D.; Beelitz, P.; Pfister, K. Clinical features of canine granulocytic anaplasmosis in 18 naturally infected dogs. J. Vet. Intern. Med. 2008, 22, 1289–1295. [Google Scholar] [CrossRef]
- Egenvall, A.E.; Hedhammar, A.A.; Bjöersdorff, A.I. Clinical features and serology of 14 dogs affected by granulocytic ehrlichiosis in Sweden. Vet. Rec. 1997, 140, 222–226. [Google Scholar] [CrossRef]
- Poitout, F.M.; Shinozaki, J.K.; Stockwell, P.J.; Holland, C.J.; Shukla, S.K. Genetic variants of Anaplasma phagocytophilum infecting dogs in Western Washington State. J. Clin. Microbiol. 2005, 43, 796–801. [Google Scholar] [CrossRef] [Green Version]
- Tarello, W. Canine granulocytic ehrlichiosis (CGE) in Italy. Acta Vet. Hung. 2003, 51, 73–90. [Google Scholar] [CrossRef] [PubMed]
- Kowalec, M.; Szewczyk, T.; Welc-Falęciak, R.; Siński, E.; Karbowiak, G.; Bajer, A. Ticks and the city—Are there any differences between city parks and natural forests in terms of tick abundance and prevalence of spirochaetes? Parasites Vectors 2017, 10, 573. [Google Scholar] [CrossRef] [PubMed]
- Michalski, M.M. Composition of tick species (Acari: Ixodida) on dogs in the urban agglomeration—A multi-year study. Med. Weter. 2017, 73, 698–701. [Google Scholar] [CrossRef] [Green Version]
- Uspensky, I. Tick pests and vectors (Acari: Ixodoidea) in European towns: Introduction, persistence and management. Ticks Tick Borne Dis. 2014, 5, 41–47. [Google Scholar] [CrossRef] [PubMed]
- Rizzoli, A.; Silaghi, C.; Obiegala, A.; Rudolf, I.; Hubálek, Z.; Földvári, G.; Plantard, O.; Vayssier-Taussat, M.; Bonnet, S.; Špitalská, E.; et al. Ixodes ricinus and its transmitted pathogens in urban and peri-urban areas in Europe: New hazards and relevance for public health. Front. Public Health 2014, 2, 25. [Google Scholar] [CrossRef]
- Król, N.; Kiewra, D.; Szymanowski, M.; Lonc, E. The role of domestic dogs and cats in the zoonotic cycles of ticks and pathogens. Preliminary studies in the Wroclaw Agglomeration (SW Poland). Vet. Parasitol. 2015, 214, 208–212. [Google Scholar] [CrossRef]
- Król, N.; Obiegala, A.; Pfeffer, M.; Lonc, E.; Kiewra, D. Detection of selected pathogens in ticks collected from cats and dogs in the Wroclaw agglomeration, South-West Poland. ParasitES Vectors 2016, 9, 351. [Google Scholar] [CrossRef] [Green Version]
- Kantar Public. 2017. Available online: http://www.tnsglobal.pl/archiwumraportow/files/2017/05/K.021_Zwierzeta_domowe_O04a-17.pdf+&cd=1&hl=pl&ct=clnk&gl=pl (accessed on 31 May 2017). (In Polish).
- Nowak-Chmura, M.; Siuda, K. Ticks of Poland. Review of contemporary issues and latest research. Ann. Parasitol. 2012, 58, 125–155. [Google Scholar]
- Zhioua, E.; Aeschlimann, A.; Gern, L. Infection of field-collected Ixodes ricinus (Acari: Ixodidae) larvae with Borrelia burgdorferi in Switzerland. J. Med. Entomol. 1994, 31, 763–766. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Franke, J.; Fritzsch, J.; Tomaso, H.; Straube, E.; Dorn, W.; Hildebrandt, A. Coexistence of pathogens in host-seeking and feeding ticks within a single natural habitat in central Germany. Appl. Environ. Microbiol. 2010, 76, 6829–6836. [Google Scholar] [CrossRef] [Green Version]
- Krčmar, S.; Ferizbegović, J.; Loni, E.; Kamberović, J. Hard tick infestation of dogs in the Tuzla area (Bosnia and Herzegovina). Vet. Arhiv 2014, 84, 177–182. [Google Scholar]
- Jouda, F.; Perret, J.-L.; Gern, L. Density of questing Ixodes ricinus nymphs and adults infected by Borrelia burgdorferi sensu lato in Switzerland: Spatio-temporal pattern at a regional scale. Vector Borne Zoonotic Dis. 2004, 4, 23–32. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Grzeszczuk, A. Anaplasma phagocytophilum in Ixodes ricinus ticks and human granulocytic anaplasmosis seroprevalence among forestry rangers in Bialystok region. Adv. Med. Sci. 2006, 51, 283–286. [Google Scholar] [PubMed]
- Grzeszczuk, A.; Stańczak, J. Highly variable year-to-year prevalence of Anaplasma phagocytophilum in Ixodes ricinus ticks in northeastern Poland: A 4-year follow-up. Ann. N. Y. Acad. Sci. 2006, 1078, 309–311. [Google Scholar] [CrossRef]
- Hovius, K.E.; Beijer, B.; Rijpkema, S.G.; Bleumink-Pluym, N.M.; Houwers, D.J. Identification of four Borrelia burgdorferi sensu lato species in Ixodes ricinus ticks collected from dutch dogs. Vet. Q. 1998, 20, 143–145. [Google Scholar] [CrossRef]
- Földvári, G.; Široký, P.; Szekeres, S.; Majors, G.; Sprang, H. Dermacentor reticulatus: A vector on the rise. Parasites Vectors 2016, 9, 314. [Google Scholar] [CrossRef] [Green Version]
- Reye, A.L.; Stegniy, V.; Mishaeva, N.P.; Velhin, S.; Hübschen, J.M.; Gnatyev, G.; Muller, C.P. Prevalence of tick-borne pathogens in Ixodes ricinus and Dermacentor reticulatus ticks from different geographical locations in Belarus. PLoS ONE 2013, 8, e54476. [Google Scholar] [CrossRef] [Green Version]
- Mierzejewska, E.J.; Pawełczyk, A.; Radkowski, M.; Welc-Faleciak, R.; Bajer, A. Pathogens vectored by the tick, Dermacentor reticulatus, in endemic regions and zones of expansion in Poland. Parasites Vectors 2015, 8, 490. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, S.-H.; Goo, Y.-K.; Geraldino, P.J.L.; Kwon, O.-D.; Kwak, D. Molecular detection and characterization of Borrelia garinii (Spirochaetales: Borreliaceae) in Ixodes nipponensis (Ixodida: Ixodidae) parasitizing a dog in Korea. Pathogens 2019, 8, 289. [Google Scholar] [CrossRef] [Green Version]
- Geurden, T.; Becskei, C.; Six, R.H.; Maeder, S.; Latrofa, M.S.; Otranto, D.; Farkas, R. Detection of tick-borne pathogens in ticks from dogs and cats in different European countries. Ticks Tick Borne Dis. 2018, 9, 1431–1436. [Google Scholar] [CrossRef]
- Kubiak, K.; Dziekońska-Rynko, J.; Szymańska, H.; Kubiak, D.; Dmitryjuk, M.; Dzika, E. Questing Ixodes ricinus (Acari, Ixodidae) as a vector of Borrelia burgdorferi sensu lato and Borrelia miyamotoi in an urban area of north-eastern Poland. Exp. Appl. Acarol. 2019, 78, 113–126. [Google Scholar] [CrossRef] [Green Version]
- Blanton, L.S.; Walker, D.H.; Bouyer, D.H. Rickettsiae and ehrlichiae within a city park: Is the urban dweller at risk? Vector Borne Zoo. Dis. 2014, 14, 168–170. [Google Scholar] [CrossRef]
- Brites-Neto, J.; Brasil, J. Epidemiological monitoring of ticks in public woods in a risk area for Brazilian Spotted Fever. Bol. Epidemiol. Paul. 2014, 11, 7–15. [Google Scholar] [CrossRef]
- Spolidorio, M.G.; Labruna, M.B.; Machado, R.Z.; Moraes-Filho, J.; Zago, A.M.; Donatele, D.M.; Pinheiro, S.R.; Silveira, J.; Caliari, K.M.; Yoshinari, N.H. Survey for tick-borne zoonoses in the State of Espirito Santo, Southeastern Brazil. Am. J. Trop. Med. Hyg. 2010, 83, 201–206. [Google Scholar] [CrossRef] [Green Version]
- Beichel, E.; Petney, T.N.; Hassler, D.; Brückner, M.; Maiwald, M. Tick infestation patterns and prevalence of Borrelia burgdorferi in ticks collected at a veterinary clinic in Germany. Vet. Parasitol. 1996, 65, 147–155. [Google Scholar] [CrossRef]
- Liebisch, G.; Sohns, B.; Bautsch, W. Detection and typing of Borrelia burgdorferi sensu lato in Ixodes ricinus ticks attached to human skin by PCR. J. Clin. Microbiol. 1998, 36, 3355–3358. [Google Scholar] [CrossRef] [Green Version]
- Springer, A.; Raulf, M.-K.; Fingerle, V.; Strube, C.H. Borrelia prevalence and species distribution in ticks removed from humans in Germany, 2013–2017. Ticks Tick Borne Dis. 2020, 11, 101363. [Google Scholar] [CrossRef]
- Davies, S.; Abdullah, S.; Helps, C.; Tasker, S.; Newbury, H.; Wall, R. Prevalence of ticks and tick-borne pathogens: Babesia and Borrelia species ticks infesting cats of Great Britain. Vet. Parasitol. 2017, 244, 129–135. [Google Scholar] [CrossRef] [Green Version]
- Voordouw, M.J. Co-feeding transmission in Lyme disease pathogens. Parasitology 2015, 142, 290–302. [Google Scholar] [CrossRef] [Green Version]
- De la Fuente, J.; Antunes, S.; Bonnet, S.; Cabezas-Cruz, A.; Domingos, A.G.; Estrada-Peña, A.; Johnson, N.; Kocan, K.M.; Mansfield, K.L.; Nijhof, A.M.; et al. Tick-pathogen interactions and vector competence: Identification of molecular drivers for tick-borne diseases. Front. Cell. Infect. Microbiol. 2017, 7, 114. [Google Scholar] [CrossRef] [Green Version]
- Dumler, J.S.; Choi, K.-S.; Garcia-Garcia, J.C.; Barat, N.S.; Scorpio, D.G.; Garyu, J.W.; Grab, D.J.; Bakken, J.S. Human granulocytic anaplasmosis and Anaplasma phagocytophilum. Emerg. Infect. Dis. 2005, 11, 1828–1834. [Google Scholar] [CrossRef] [PubMed]
- Heyman, P.; Cochez, C.; Hofhuis, A.; Van der Giessen, J.; Sprong, H.; Porter, S.R.; Losson, B.; Saegerman, C.; Donoso-Mantke, O.; Niedrig, M.; et al. A clear and present danger: Tick-borne diseases in Europe. Expert Rev. Anti Infect. Ther. 2010, 8, 33–50. [Google Scholar] [CrossRef]
- Namina, A.; Capligina, V.; Seleznova, M.; Krumins, R.; Aleinikova, D.; Kivrane, A.; Akopjana, S.; Lazovska, M.; Berzina, I.; Ranka, R. Tick-borne pathogens in ticks collected from dogs, Latvia, 2011–2016. BMC Vet. Res. 2019, 15, 398. [Google Scholar] [CrossRef]
- Welc-Falęciak, R.; Kowalec, M.; Karbowiak, G.; Bajer, A.; Behnke, J.M.; Siński, E. Rickettsiaceae and Anaplasmataceae infections in Ixodes ricinus ticks from urban and natural forested areas of Poland. Parasites Vectors 2014, 7, 121. [Google Scholar] [CrossRef] [Green Version]
- Grzeszczuk, A.; Stańczak, J. High prevalence of Anaplasma phagocytophilum infection in ticks removed from human skin in north-eastern Poland. Ann. Agric. Environ. Med. 2006, 13, 45–48. [Google Scholar]
- Chen, S.M.; Dumler, J.S.; Bakken, J.S.; Walker, D.H. Identification of a granulocytotropic Ehrlichia species as the etiologic agent of human disease. J. Clin. Microbiol. 1994, 2, 589–595. [Google Scholar] [CrossRef] [Green Version]
- Stańczak, J.; Racewicz, M.; Kruminis-Łozowska, W.; Kubica-Biernat, B. Coinfection of Ixodes ricinus (Acari:Ixodidae) in northern Poland with the agents of Lyme borreliosis (LB) and human granulocytic ehrlichiosis (HGE). Int. J. Med. Microbiol. 2002, 33, 198–201. [Google Scholar] [CrossRef]
- Stańczak, J.; Gabre, R.M.; Kruminis-Łozowska, W.; Racewicz, M.; Kubica-Biernat, B. Ixodes ricinus as a vector of Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum and Babesia microti in urban and suburban forests. Ann. Agric. Environ. Med. 2004, 11, 109–114. [Google Scholar]
- Strzelczyk, J.K.; Gaździcka, J.; Cuber, P.; Asman, M.; Trapp, G.; Gołąbek, K.; Zalewska-Ziob, M.; Nowak-Chmura, M.; Siuda, K.; Wiczkowski, A.; et al. Prevalence of Borrelia burgdorferi sensu lato in Ixodes ricinus ticks collected from southern Poland. Acta Parasitol. 2015, 60, 666–674. [Google Scholar] [CrossRef]
- Chmielewska-Badora, J.; Zwoliński, J.; Cisak, E.; Wójcik-Fatla, A. Prevalence of Anaplasma phagocytophilum in Ixodes ricinus ticks determined by polymerase chain reaction with two pairs of primers detecting 16S rRNA and ankA genes. Ann. Agric. Environ. Med. 2007, 14, 281–285. [Google Scholar]
Ixodes ricinus | Dermacentor reticulatus | ||||||
---|---|---|---|---|---|---|---|
Pathogens | * NE Females (%) (95% CI) | ** E Females (%) (95% CI) | * NE Males (%) (95% CI) | * NE Females (%) (95% CI) | ** E Females (%) (95% CI) | * NE Males (%) (95% CI) | Total Ticks (%) (95% CI) |
B. garinii | 0/11 (0.0) | 113/402 (28.1) | 0/10 (0.0) | 0/28 (0.0) | 0/34 (0.0) | 1/37 (2.7) | 3 114/141 (80.9) |
(0.0–28.5) | (23.8–32.8) | (0.0–30.9) | (0.0–12.3) | (0.0–10.3) | (0.07–14.1) | (73.4–86.9) | |
B. afzelii | 1/11 (9.1) | 13/402 (3.2) | 0/10 (0.0) | 0/28 (0.0) | 0/34 (0.0) | 0/37 (0.0) | 3 14/141 (9.9) |
(0.2–41.3) | (1.7–5.4) | (0.0–30.9) | (0.0–12.3) | (0.0–10.3) | (0.0–9.5) | (5.5–16.1) | |
B. burgdorferi s.s. | 0/11 (0.0) | 8/402 (2.0) | 0/10 (0.0) | 0/28 (0.0) | 0/34 (0.0) | 5/37 (13.5) | 3 13/141 (9.2) |
(0.0–28.5) | (0.8–3.9) | (0.0–30.9) | (0.0–12.3) | (0.0–10.3) | (4.5–28.8) | (5.0–15.2) | |
Borrelia Monoinfections | 1/11 (9.1) | 134/402 (33.3) | 0/10 (0.0) | 0/28 (0.0) | 0/34 (0.0) | 6/37 (16.2) | 141/165 (85.4) |
(0.2–41.3) | (28.7–38.2) | (0.0–30.9) | (0.0–12.3) | (0.0–10.3) | (6.2–32.0) | (79.1–90.4) | |
B. garini/B. afzelii | 0/11 (0.0) | 9/402 (2.2) | 0/10 (0.0) | 0/28 (0.0) | 3/34 (8.8) | 0/37 (0.0) | 12/24 (50.0) |
(0.0–28.5) | (1.0–4.2) | (0.0–30.9) | (0.0–12.3) | (1.8–23.7) | (0.0–9.5) | (29.1–70.9) | |
B. garinii/B.burgdorferi s.s. | 0/11 (0.0) | 3/402 (0.75) | 0/10 (0.0) | 0/28 (0.0) | 3/34 (8.8) | 2/37 (5.4) | 5/24 (20.8) |
(0.0–28.5) | (0.15–2.1) | (0.0–30.9) | (0.0–12.3) | (1.8–23.7) | (0.6–18.2) | (7.1–42.1) | |
B. afzelii/B. burgdorferi s.s. | 0/11 (0.0) | 3/402 (0.75) | 0/10 (0.0) | 0/28 (0.0) | 0/34 (0.0) | 3/37 (8.1) | 6/24 (25.0) |
(0.0–28.5) | (0.15–2.1) | (0.0–30.9) | (0.0–12.3) | (0.0–10.3) | (1.7–21.9) | (9.7–46.7) | |
B. garinii/B. afzelii/B. burgdorferii s.s. | 0/11 (0.0) | 1/402 (0.25) | 0/10 (0.0) | 0/28 (0.0) | 0/34 (0.0) | 0/37 (0.0) | 1/24 (4.1) |
(0.0–28.5) | (0.006–1.4) | (0.0–30.9) | (0.0–12.3) | (0.0–10.3) | (0.0–9.5) | (0.1–21.1) | |
Borrelia Coinfections | 0/11 (0.0) | 16/402 (4.0) | 0/10 (0.0) | 0/28 (0.0) | 3/34 (8.8) | 5/37 (13.5) | 24/165 (14.5) |
(0.0–28.5) | (2.3–6.4) | (0.0–30.9) | (0.0–12.3) | (1.8–23.7) | (4.5–28.8) | (9.5–20.8) | |
Borrelia Total | 1 151/423 (35.7) | 1 14/99 (14.1) | 165/522 (31.6) | ||||
(31.1–40.4) | (7.9–22.6) | (27.6–35.8) | |||||
Borrelia Total ** E | 150/436 (34.4) | 3/436 (0.7) | 2 153/436 (35.1) | ||||
(29.9–39.1) | (0.14–2.0) | (30.6–39.8) | |||||
Borrelia Total * NE | 1/21 (4.7) | 11/65 (16.9) | 2 12/86 (13.9) | ||||
(0.12–23.8) | (8.7–28.2) | (7.4–23.1) | |||||
A. phagocytophilum | 0/11 (0.0) (0.0–28.5) | 5/402 (1.2) (0.4–2.9) | 0/10 (0.0) (0.0–30.9) | 0/28 (0.0) (0.0–12.3) | 0/34 (0.0) (0.0–10.3) | 0/37 (0.0) (0.0–9.5) | 5/522 (0.96) (0.3–2.2) |
Primer Name | Primer Sequence 5′→3′ | Product Size [bp] | Species Reference |
---|---|---|---|
BFL1 | GCTCAATATAACCAAATGCACATG | 442 | B. burgdorferi s.l. |
BFL2 | CAAGTCTATTTTGGAAAGCACCTAA | [62] | |
EHR521 | TGTAGGCGGTTCGGTAAGTTAAAG | 247 | A. phagocytophilum |
EHR747 | GCACTCATCGTTTACAGCGTG | [63] | |
TasI restriction patterns of BFL1/BFL2 products [bp] [62] | Genospecies | ||
28-93-321 | B. garinii | ||
28-81-89-93-151 | B. afzelii | ||
28-89-93-232 | B. burgdorferi s.s. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Michalski, M.M.; Kubiak, K.; Szczotko, M.; Chajęcka, M.; Dmitryjuk, M. Molecular Detection of Borrelia burgdorferi Sensu Lato and Anaplasma phagocytophilum in Ticks Collected from Dogs in Urban Areas of North-Eastern Poland. Pathogens 2020, 9, 455. https://doi.org/10.3390/pathogens9060455
Michalski MM, Kubiak K, Szczotko M, Chajęcka M, Dmitryjuk M. Molecular Detection of Borrelia burgdorferi Sensu Lato and Anaplasma phagocytophilum in Ticks Collected from Dogs in Urban Areas of North-Eastern Poland. Pathogens. 2020; 9(6):455. https://doi.org/10.3390/pathogens9060455
Chicago/Turabian StyleMichalski, Mirosław M., Katarzyna Kubiak, Magdalena Szczotko, Marta Chajęcka, and Małgorzata Dmitryjuk. 2020. "Molecular Detection of Borrelia burgdorferi Sensu Lato and Anaplasma phagocytophilum in Ticks Collected from Dogs in Urban Areas of North-Eastern Poland" Pathogens 9, no. 6: 455. https://doi.org/10.3390/pathogens9060455