Molecular Screening for Digital Dermatitis-Associated Treponemes in Bovine Ischaemic Teat Necrosis Lesions and Milk in Dairy Cattle
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Sample Collection
2.2.1. Tissue Samples
2.2.2. Swab Samples
2.3. Collection of Milk for Assessment of Treponeme Detection in Milk
2.4. Detection of Digital Dermatitis Treponemes in Milk
2.5. DNA Extraction
2.5.1. Extraction from Swabs and Tissue of ITN Lesions
2.5.2. Extraction from Liquid Culture
2.5.3. Extraction from Milk
2.5.4. Assessing Quality of Extracted DNA
2.6. Polymerase Chain Reaction
2.6.1. Nested PCR for Detection of Digital Dermatitis Treponemes
2.6.2. PCR for Detection of Treponema Genus Specific 16S rRNA Gene
2.7. Validation of PCR
2.8. Assessment of Treponeme Detection in Milk
2.9. Treponeme Detection from Fresh Foremilk from DD Symptomatic and Asymptomatic Cows
2.10. Detection of Treponemes in Fresh Foremilk from DD Symptomatic and Asymptomatic Cows
2.11. Statistical Analysis
3. Results
3.1. Validation of the DD-Associated Treponeme PCR Assays
3.2. Screening ITN Samples for DD-Associated Treponemes
3.3. Detection of DD-Associated Treponemes in Milk
3.4. Detection of DD-Associated Treponemes in Foremilk from DD Symptomatic and Asymptomatic Cows
4. Discussion
4.1. PCR Screening of Teat Samples for DD-Associated Treponemes
4.2. The Assessment of DD-Associated Treponemes in Milk
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Clegg, S.R.; Carter, S.D.; Stewart, J.P.; Amin, D.M.; Blowey, R.W.; Evans, N.J. Bovine ischaemic teat necrosis: A further potential role for digital dermatitis treponemes. Vet. Rec. 2016, 178, 71. [Google Scholar] [CrossRef] [PubMed]
- Crosby-Durrani, H.E.; Carter, S.D.; Blundell, R.J.; Manning, A.; Blowey, R.; Evans, N.J. Clinical and pathological features of ovine ischaemic teat necrosis. J. Comp. Pathol. 2022, 198, 6–15. [Google Scholar] [CrossRef] [PubMed]
- Crosby-Durrani, H.E.; Manning, A.; Blowey, R.; Afonso, J.S.; Carter, S.D.; Evans, N.J.; Angell, J.W. An observational study investigating potential risk factors and economic impact for bovine ischaemic teat necrosis on dairy farms in Great Britain. Front. Vet. Sci. 2022, 9, 134. [Google Scholar]
- Robcis, R.; Ferchiou, A.; Berrada, M.; Ndiaye, Y.; Herman, N.; Lhermie, G.; Raboisson, D. Cost of lameness in dairy herds: An intergrated bioeconomic modeling approach. J. Dairy Sci. 2023, 104, 2519–2534. [Google Scholar]
- Evans, N.J.; Brown, J.M.; Demirkan, I.; Murray, R.D.; Vink, W.D.; Blowey, R.W.; Hart, C.A.; Carter, S.D. Three unique groups of spirochetes isolated from digital dermatitis lesions in UK cattle. Vet. Microbiol. 2008, 130, 141–150. [Google Scholar] [CrossRef] [PubMed]
- Evans, N.J.; Brown, J.M.; Demirkan, I.; Singh, P.; Getty, B.; Timofte, D.; Vink, W.D.; Murray, R.D.; Blowey, R.W.; Birtles, R.J.; et al. Association of unique, isolated treponemes with bovine digital dermatitis lesions. J. Clin. Microbiol. 2009, 47, 689–696. [Google Scholar] [CrossRef]
- Zinicola, M.; Higgins, H.; Lima, S.; Machado, V.; Guard, C.; Bicalho, R. Shotgun metagenomic sequencing reveals functional genes and microbiome associated with bovine digital dermatitis. PLoS ONE 2015, 10, e0133674. [Google Scholar]
- Klitgaard, K.; Bretó, A.F.; Boye, M.; Jensen, T.K. Targeting the treponemal microbiome of digital dermatitis infections by high-resolution phylogenetic analyses and comparison with fluorescent in situ hybridization. J. Clin. Microbiol. 2013, 51, 2212–2219. [Google Scholar] [CrossRef]
- Caddey, B.; De Buck, J. Meta-analysis of bovine digital dermatitis microbiota reveals distinct microbial community structures associated with lesions. Front. Cell. Infect. Microbiol. 2021, 11, 685861. [Google Scholar] [CrossRef]
- Wilson-Welder, J.H.; Alt, D.P.; Nally, J.E. Digital dermatitis in cattle: Current bacterial and immunological findings. Animals 2015, 5, 1114–1135. [Google Scholar] [CrossRef]
- Moreira, T.F.; Facury Filho, E.J.; Carvalho, A.U.; Strube, M.L.; Nielsen, M.W.; Klitgaard, K.; Jensen, T.K. Pathology and bacteria related to digital dermatitis in dairy cattle in all year round grazing system in Brazil. PLoS ONE 2018, 13, e0193870. [Google Scholar]
- Staton, G.J.; Sullivan, L.E.; Blowey, R.W.; Carter, S.D.; Evans, N.J. Surveying bovine digital dermatitis and non-healing bovine foot lesions for the presence of Fusobacterium necrophorum, Porphyromonas endodontalis and Treponema pallidum. Vet. Rec. 2020, 186, 450. [Google Scholar] [CrossRef] [PubMed]
- Sullivan, L.E.; Clegg, S.R.; Angell, J.W.; Newbrook, K.; Blowey, R.W.; Carter, S.D.; Bell, J.; Duncan, J.S.; Grove-White, D.H.; Murray, R.D.; et al. High-level association of bovine digital dermatitis Treponema spp. with contagious ovine digital dermatitis lesions and presence of Fusobacterium necrophorum and Dichelobacter nodosus. J. Clin. Microbiol. 2015, 53, 1628–1638. [Google Scholar] [CrossRef] [PubMed]
- Sullivan, L.E.; Evans, N.J.; Clegg, S.R.; Carter, S.D.; Horsfield, J.E.; Grove-White, D.; Duncan, J.S. Digital dermatitis treponemes associated with a severe foot disease in dairy goats. Vet. Rec. 2015, 176, 283. [Google Scholar] [CrossRef] [PubMed]
- Clegg, S.R.; Mansfield, K.G.; Newbrook, K.; Sullivan, L.E.; Blowey, R.W.; Carter, S.D.; Evans, N.J. Isolation of digital dermatitis treponemes from hoof lesions in Wild North American Elk (Cervus elaphus) in Washington State, USA. J. Clin. Microbiol. 2015, 53, 88–94. [Google Scholar] [CrossRef]
- Wilson-Welder, J.H.; Mansfield, K.; Han, S.; Bayles, D.O.; Alt, D.P.; Olsen, S.C. Lesion material from Treponema-associated hoof disease of wild elk induces disease pathology in the sheep digital dermatitis model. Front. Vet. Sci. 2022, 8, 12. [Google Scholar] [CrossRef]
- Clegg, S.R.; Sullivan, L.E.; Bell, J.; Blowey, R.W.; Carter, S.D.; Evans, N.J. Detection and isolation of digital dermatitis treponemes from skin and tail lesions in pigs. Res. Vet. Sci. 2016, 104, 64–70. [Google Scholar] [CrossRef] [PubMed]
- Karlsson, F.; Svartstrom, O.; Belak, K.; Fellstrom, C.; Pringle, M. Occurrence of Treponema spp. in porcine skin ulcers and gingiva. Vet. Microbiol. 2013, 165, 402–409. [Google Scholar] [CrossRef] [PubMed]
- Svartstrom, O.; Karlsson, F.; Fellstrom, C.; Pringle, M. Characterization of Treponema spp. isolates from pigs with ear necrosis and shoulder ulcers. Vet. Microbiol. 2013, 166, 617–623. [Google Scholar] [CrossRef]
- Evans, N.J.; Timofte, D.; Carter, S.D.; Brown, J.M.; Scholey, R.; Read, D.H.; Blowey, R.W. Association of treponemes with bovine ulcerative mammary dermatitis. Vet. Rec. 2010, 166, 532–533. [Google Scholar] [CrossRef]
- Stamm, L.V.; Walker, R.L.; Read, D.H. Genetic diversity of bovine ulcerative mammary dermatitis-associated Treponema. Vet. Microbiol. 2009, 136, 192–196. [Google Scholar] [CrossRef] [PubMed]
- Sobhy, N.M.; Mahmmod, Y.S.; Refaai, W.; Awad, A. Molecular detection of Treponema species organisms in foremilk and udder cleft skin of dairy cows with digital dermatitis. Trop. Anim. Health Prod. 2020, 52, 815–821. [Google Scholar] [CrossRef] [PubMed]
- Clegg, S.R.; Crosby-Durrani, H.E.; Bell, J.; Blundell, R.; Blowey, R.W.; Carter, S.D.; Evans, N. Detection and isolation of digital dermatitis treponemes from bovine pressure sores. J. Comp. Pathol. 2016, 154, 273–282. [Google Scholar] [CrossRef] [PubMed]
- Klitgaard, K.; Nielsen, M.W.; Ingerslev, H.C.; Boye, M.; Jensen, T.K. Discovery of bovine digital dermatitis-associated Treponema spp. in the dairy herd environment by a targeted deep-sequencing approach. Appl. Environ. Microbiol. 2014, 80, 4427. [Google Scholar] [CrossRef] [PubMed]
- Gillespie, A.; Carter, S.D.; Blowey, R.W.; Evans, N. Survival of bovine digital dermatitis treponemes on hoof knife blades and the effects of various disinfectants. Vet. Rec. 2020, 186, 67. [Google Scholar] [CrossRef] [PubMed]
- Clegg, S.R.; Bell, J.; Ainsworth, S.; Blowey, R.W.; Bell, N.J.; Carter, S.D.; Evans, N.J. Isolation of digital dermatitis treponemes from cattle hock skin lesions. Vet. Dermatol. 2016, 27, 106-e30. [Google Scholar] [CrossRef] [PubMed]
- Bell, J.; Crosby-Durrani, H.E.; Blowey, R.W.; Carter, S.D.; Evans, N.J. Survival of bovine digital dermatitis treponemes in conditions relevant to the host and farm environment. Anaerobe 2023, 82, 102766. [Google Scholar] [CrossRef] [PubMed]
- Rurangirwa, F.R.; Dilbeck, P.M.; Crawford, T.B.; McGuire, T.C.; McElwain, T.F. Analysis of the 16S rRNA gene of micro-organism WSU 86-1044 from an aborted bovine foetus reveals that it is a member of the order Chlamydiales: Proposal of Waddliaceae fam. nov., Waddlia chondrophila gen. nov., sp. nov. Int. J. Syst. Bacteriol. 1999, 49 Pt 2, 577–581. [Google Scholar] [CrossRef]
- Moore, L.J.; Woodward, M.J.; Grogono-Thomas, R. The occurrence of treponemes in contagious ovine digital dermatitis and the characterisation of associated Dichelobacter nodosus. Vet. Microbiol. 2005, 111, 199–209. [Google Scholar] [CrossRef]
- Watts, K.M.; Fodor, C.; Beninger, C.; Lahiri, P.; Arrazuri, R.; De Buck, J.; Knight, C.G.; Orsel, K.; Barkema, H.W.; Cobo, E.R. A differential innate immune response in active and chronic stages of bovine infectious digital dermatitis. Front. Microbiol. 2018, 9, 1586. [Google Scholar] [CrossRef]
- Blowey, R.W. Ischaemic necrosis of the base of the teat in dairy cows. Vet. Rec. 2004, 154, 214. [Google Scholar] [PubMed]
- Evans, N.J.; Blowey, R.W.; Timofte, D.; Isherwood, D.R.; Brown, J.M.; Murray, R.; Paton, R.J.; Carter, S.D. Association between bovine digital dermatitis treponemes and a range of “non-healing” bovine hoof disorders. Vet. Rec. 2011, 168, 214. [Google Scholar] [CrossRef] [PubMed]
- Evans, N.J.; Timofte, D.; Isherwood, D.R.; Brown, J.M.; Williams, J.M.; Sherlock, K.; Lehane, M.J.; Murray, R.D.; Birtles, R.J.; Hart, C.A.; et al. Host and environmental reservoirs of infection for bovine digital dermatitis treponemes. Vet. Microbiol. 2012, 156, 102–109. [Google Scholar] [CrossRef] [PubMed]
- Singh, A.; Duche, R.T.; Wandhare, A.G.; Sian, J.K.; Singh, B.P.; Sihag, M.K.; Singh, K.S.; Sangwan, V.; Talan, S.; Panwar, H. Milk-derived antimicrobial peptides: Overview, applications, and future perspectives. Probiotics Antimicrob. Proteins 2023, 15, 44–62. [Google Scholar]
- Newbrook, K.; Staton, G.J.; Clegg, S.R.; Birtles, R.J.; Carter, S.D.; Evans, N.J. Treponema ruminis sp. nov., a spirochaete isolated from the bovine rumen. Int. J. Syst. Evol. Microbiol. 2017, 67, 1349–1354. [Google Scholar] [CrossRef]
| Primer | Primer Sequence (5′-3′) (Forward and Reverse) | 16S rRNA Gene Position | Band Size (bp) | Reference |
|---|---|---|---|---|
| Universal 16S rRNA gene | AGAGTTTGATCCTGG TACCTTGTTACGACTT | 7–26 1491–1506 | 1526 | [28] |
| T. medium phylogroup | GAATGCTCATCTGATGACGGTAATCGACG CCGGCCTTATCTAAGACCTTCTACTAG | 472–500 1001–1029 | 475 | [6] |
| T. phagedenis phylogroup | GAAATACTCAAGCTTAACTTGAGAACTTGC CTACGCTACCATATCTCTATAATATTGC | 612–640 1006–1029 | 400 | [6] |
| T. pedis phylogroup | GGAGATGAGGGAATGCGTCTTCGATG CAAGAGTCGTATTGCTACGCTGATATATC | 459–484 1017–1045 | 475 | [6] |
| Treponema genus | AARCATGCAAGTCGARCGGCAAG TCCATTGCGGAATATTCTTA | 49–71 365–384 | 335 | [29] |
| Initial Denaturation | Denaturation | Annealing | Elongation | Final Elongation | |
|---|---|---|---|---|---|
| Universal bacterial 16 S rRNA gene [28] | |||||
| Temperature | 95 °C | 94 °C | 55 °C | 72 °C | 72 °C |
| Time | 5 min | 1 min | 3 min | 3 min | 7 min |
| Cycles | 1 | 24 | |||
| Treponema medium phylogroup [6] | |||||
| Temperature | 95 °C | 95 °C | 68 °C | 72 °C | 72 °C |
| Time | 5 min | 1 min | 1 min | 2 min | 10 min |
| Cycles | 1 | 39 | |||
| Treponema phagedenis phylogroup [6] | |||||
| Temperature | 95 °C | 95 °C | 64 °C | 72 °C | 72 °C |
| Time | 5 min | 1 min | 1 min | 2 min | 10 min |
| Cycles | 1 | 39 | |||
| Treponema pedis phylogroup [6] | |||||
| Temperature | 95 °C | 95 °C | 68 °C | 72°C | 72 °C |
| Time | 5 min | 1 min | 30 s | 2 min | 10 min |
| Cycles | 1 | 39 | |||
| Treponema genus specific 16S rRNA gene [29] | |||||
| Temperature | 95 °C | 64 °C | 72 °C | 72 °C | |
| Time | 30 s | 1 min | 1 min | 10 min | |
| Cycles | 40 | ||||
| Sample (ITN +/− Teat and +/− Cow) | Sample Type (Swab/Tissue) | Number | Treponema Genus | Group 1 | Group 2 | Group 3 |
|---|---|---|---|---|---|---|
| ITN positive teat | Swab | 62 | 21/62 (33.8%) | 12/62 (19.4%) | 10/62 (16.1%) | 17/62 (27.4%) |
| ITN positive teat | Tissue | 33 | 13/33 (39.4%) | 4/33 (12.1%) | 6/33 (18.2%) | 10/33 (30.3%) |
| Total ITN positive teat samples (both swabs and tissue) | Swab and Tissue | 95 | 34 (35.8%) | 16 (16.8%) | 16 (16.8%) | 27 (28.4%) |
| Asymptomatic teat from ITN positive cow | Swab | 18 | 1/18 (5.6%) | 0 | 0 | 1/18 (5.6%) |
| Matched ITN negative cow | Swab | 10 | 0 | 0 | 0 | 0 |
| Time | ||||||||
|---|---|---|---|---|---|---|---|---|
| PCR Assay | 10 min | 30 min | 1 h | 2 h | 4 h | 8 h | 24 h | Negative Control |
| T. phagedenis | + | + | + | + | − | − | − | − |
| Treponema genus | + | + | + | + | + | + | − | − |
| Foremilk Sample | Number | Treponema Genus | Group 1 | Group 2 | Group 3 |
|---|---|---|---|---|---|
| Cows with healthy hind feet | 31 | 6 (19.4%) | 0 | 0 | 0 |
| Cows with DD lesions on hind feet | 19 | 1 (5.3%) | 0 | 0 | 0 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Crosby-Durrani, H.E.; Carter, S.D.; Blowey, R.W.; Evans, N.J. Molecular Screening for Digital Dermatitis-Associated Treponemes in Bovine Ischaemic Teat Necrosis Lesions and Milk in Dairy Cattle. Pathogens 2024, 13, 427. https://doi.org/10.3390/pathogens13050427
Crosby-Durrani HE, Carter SD, Blowey RW, Evans NJ. Molecular Screening for Digital Dermatitis-Associated Treponemes in Bovine Ischaemic Teat Necrosis Lesions and Milk in Dairy Cattle. Pathogens. 2024; 13(5):427. https://doi.org/10.3390/pathogens13050427
Chicago/Turabian StyleCrosby-Durrani, Hayley E., Stuart D. Carter, Roger W. Blowey, and Nicholas J. Evans. 2024. "Molecular Screening for Digital Dermatitis-Associated Treponemes in Bovine Ischaemic Teat Necrosis Lesions and Milk in Dairy Cattle" Pathogens 13, no. 5: 427. https://doi.org/10.3390/pathogens13050427
APA StyleCrosby-Durrani, H. E., Carter, S. D., Blowey, R. W., & Evans, N. J. (2024). Molecular Screening for Digital Dermatitis-Associated Treponemes in Bovine Ischaemic Teat Necrosis Lesions and Milk in Dairy Cattle. Pathogens, 13(5), 427. https://doi.org/10.3390/pathogens13050427

