Ixodiphagus hookeri (Hymenoptera: Encyrtidae) and Tick-Borne Pathogens in Ticks with Sympatric Occurrence (and Different Activities) in the Slovak Karst National Park (Slovakia), Central Europe
Abstract
:1. Introduction
2. Material and Methods
2.1. Study Area
2.2. Tick Sampling
2.3. DNA Extraction
2.4. PCR Screening
Pathogen | Target Gene | Length (bp) | Primer Name | Primer Sequence (5′–3′) | PCR Annealing Temperature | Reference |
---|---|---|---|---|---|---|
Bacteria | ||||||
Anaplasma phagocytophilum | msp2 | 334 | MSP2f | CCA GCG TTT AGC AAG ATA AGA G | 55 °C | [41] |
MSP2r | GCC CAG TAA CAT CAT AAG C | |||||
Borreliella spp. | rrfA-rrlB | 222–255 | IGSa | CGA CCT TCT TCG CCT TAA AGC | 57 °C | [42] |
IGSb | AGC TCT TAT TCG CTG ATG GTA | |||||
Bartonella spp. | ssrA | 257 | ssrA-F | GCT ATG GTA ATA AAT GGA CAA TGA AAT AA | 60 °C | [43] |
ssrA-R | GCT TCT GTT GCC AGG TG | |||||
Rickettsia spp. | gltA nested | 381 | RpCS.877p RpCS.1258n | GGG GAC CTG CTC ACG GCG G ATT GCA AAA AGT ACA GTG AAC C | 58 °C | [44] |
338 | RpCS.896p | GGC TAA TGA AGC AGT GAT AA | ||||
RpCS.1233n | GCG ACG GTA TAC CCA TAG C | |||||
Wolbachia spp. | wsp | 590–632 | wsp81F | TGG TCC AAT AAG TGA TGA AGA AAC | 55 °C | [8] modified |
wsp691R | AAA AAT TAA ACG CTA CTC CA | |||||
Piroplasms | ||||||
Babesia/Theileria spp. | 18S rRNA | 433–489 | BJ1 | GTC TTG TAA TTG GAA TGA TGG | 58 °C | [45] |
BN2 | TAG TTT ATG GTT AGG ACT ACG | |||||
Hymenopterans | 28S rRNA | 560 | 28s-hym-F | AGACCGATAGCGAACAAGTA | 59 °C | [46] |
28s-hym-R | GGTCCTGAAAGTACCCAAA | |||||
Iph. hookeri | CO1 | 268 | 401F | TTTAGAATATTTATTGATTCAGGGACT | 53 °C | [8] |
44R | CTCCTGCTAAAACTGGTAAAGATAAT |
2.5. Statistical Analysis
2.6. Calculation of Odds Ratio
3. Results
3.1. Molecular Identification of Iph. hookeri
3.2. The Presence of Iph. hookeri and the Prevalence of Pathogens in Questing I. ricinus Ticks
3.3. The Presence of Iph. Hookeri and the Prevalence of Pathogens in Questing H. concinna Ticks
3.4. The Presence of Iph. hookeri and the Prevalence of Pathogens in Questing and Engorged H. inermis Ticks
3.5. The Presence of Iph. hookeri and the Prevalence of Pathogens in Questing and Engorged D. marginatus Ticks
3.6. The Presence of Iph. hookeri and the Prevalence of Pathogens in Questing and Engorged D. reticulatus Ticks
3.7. The Presence of Iph. hookeri and the Prevalence of Pathogens in Engorged I. trianguliceps Ticks
3.8. Genetic Variation, Phylogenetic Analyses, and Nucleotide Sequences Obtained in the Study
3.9. Molecular Detection of Microbes in Ticks
3.10. Statistical Evaluation of the Correlations between the Presence/Absence of Wasps and Microbes in Screened Ticks
3.11. Calculation of Odds Ratio
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Sonenshine, D.E.; Lane, R.S.; Nicholson, W.L. TICKS (Ixodida). In Medical and Veterinary Entomology; Mullen, G., Durden, L., Eds.; Academic Press: San Diego, CA, USA, 2002; pp. 517–558. ISBN 978-0-12-510451-7. [Google Scholar]
- Wikel, S.K. Ticks and Tick-Borne Infections: Complex Ecology, Agents, and Host Interactions. Vet. Sci. 2018, 5, 60. [Google Scholar] [CrossRef]
- Showler, A.T.; Saelao, P. Integrative Alternative Tactics for Ixodid Control. Insects 2022, 13, 302. [Google Scholar] [CrossRef]
- Budachetri, K.; Kumar, D.; Crispell, G.; Beck, C.; Dasch, G.; Karim, S. The Tick Endosymbiont Candidatus Midichloria Mitochondrii and Selenoproteins Are Essential for the Growth of Rickettsia Parkeri in the Gulf Coast Tick Vector. Microbiome 2018, 6, 141. [Google Scholar] [CrossRef]
- Lejal, E.; Chiquet, J.; Aubert, J.; Robin, S.; Estrada-Peña, A.; Rue, O.; Midoux, C.; Mariadassou, M.; Bailly, X.; Cougoul, A.; et al. Temporal Patterns in Ixodes Ricinus Microbial Communities: An Insight into Tick-Borne Microbe Interactions. Microbiome 2021, 9, 153. [Google Scholar] [CrossRef] [PubMed]
- Pollet, T.; Sprong, H.; Lejal, E.; Krawczyk, A.I.; Moutailler, S.; Cosson, J.-F.; Vayssier-Taussat, M.; Estrada-Peña, A. The Scale Affects Our View on the Identification and Distribution of Microbial Communities in Ticks. Parasit. Vectors 2020, 13, 36. [Google Scholar] [CrossRef]
- Shi, H.; Yu, X.; Cheng, G. Impact of the Microbiome on Mosquito-Borne Diseases. Protein Cell 2023, 14, 743–761. [Google Scholar] [CrossRef]
- Plantard, O.; Bouju-Albert, A.; Malard, M.-A.; Hermouet, A.; Capron, G.; Verheyden, H. Detection of Wolbachia in the Tick Ixodes Ricinus Is Due to the Presence of the Hymenoptera Endoparasitoid Ixodiphagus hookeri. PLoS ONE 2012, 7, e30692. [Google Scholar] [CrossRef] [PubMed]
- Duron, O.; Binetruy, F.; Noël, V.; Cremaschi, J.; McCoy, K.D.; Arnathau, C.; Plantard, O.; Goolsby, J.; Pérez De León, A.A.; Heylen, D.J.A.; et al. Evolutionary Changes in Symbiont Community Structure in Ticks. Mol. Ecol. 2017, 26, 2905–2921. [Google Scholar] [CrossRef]
- Guizzo, M.G.; Neupane, S.; Kucera, M.; Perner, J.; Frantová, H.; da Silva Vaz, I.J.; de Oliveira, P.L.; Kopacek, P.; Zurek, L. Poor Unstable Midgut Microbiome of Hard Ticks Contrasts With Abundant and Stable Monospecific Microbiome in Ovaries. Front. Cell. Infect. Microbiol. 2020, 10, 211. [Google Scholar] [CrossRef]
- Krawczyk, A.I.; Röttjers, L.; Fonville, M.; Takumi, K.; Takken, W.; Faust, K.; Sprong, H. Quantitative Microbial Population Study Reveals Geographical Differences in Bacterial Symbionts of Ixodes Ricinus. Microbiome 2022, 10, 120. [Google Scholar] [CrossRef]
- Lalah, J.O.; Otieno, P.O.; Odira, Z.; Ogunah, J.A.; Lalah, J.O.; Otieno, P.O.; Odira, Z.; Ogunah, J.A. Pesticides: Chemistry, Manufacturing, Regulation, Usage and Impacts on Population in Kenya. In Pesticides—Updates on Toxicity, Efficacy and Risk Assessment; Larramendy, M.L., Soloneski, S., Eds.; IntechOpen: London, UK, 2022; ISBN 978-1-80356-039-7. [Google Scholar] [CrossRef]
- Pathak, V.M.; Verma, V.K.; Rawat, B.S.; Kaur, B.; Babu, N.; Sharma, A.; Dewali, S.; Yadav, M.; Kumari, R.; Singh, S.; et al. Current Status of Pesticide Effects on Environment, Human Health and It’s Eco-Friendly Management as Bioremediation: A Comprehensive Review. Front. Microbiol. 2022, 13, 962619. [Google Scholar] [CrossRef] [PubMed]
- Samsináková, A.; Kálalová, S.; Daniel, M.; Dusbábek, F.; Honzáková, E.; Cerný, V. Entomogenous Fungi Associated with the Tick Ixodes ricinus (L.). Folia Parasitol. 1974, 21, 39–48. [Google Scholar]
- Samish, M.; Rehacek, J. Pathogens and Predators of Ticks and Their Potential in Biological Control. Annu. Rev. Entomol. 1999, 44, 159–182. [Google Scholar] [CrossRef] [PubMed]
- Samish, M.; Glazer, I. Entomopathogenic Nematodes for the Biocontrol of Ticks. Trends Parasitol. 2001, 17, 368–371. [Google Scholar] [CrossRef] [PubMed]
- Hu, R.; Hyland, K.E.; Oliver, J.H. A Review on the Use of Ixodiphagus Wasps (Hymenoptera: Encyrtidae) as Natural Enemies for the Control of Ticks (Acari: Ixodidae). Syst. Appl. Acarol. 1998, 3, 19–28. [Google Scholar] [CrossRef]
- Tóth, A.G.; Farkas, R.; Gyurkovszky, M.; Krikó, E.; Solymosi, N. First Detection of Ixodiphagus hookeri (Hymenoptera: Encyrtidae) in Ixodes Ricinus Ticks (Acari: Ixodidae) from Multiple Locations in Hungary. Sci. Rep. 2023, 13, 1624. [Google Scholar] [CrossRef] [PubMed]
- Collatz, J.; Selzer, P.; Fuhrmann, A.; Oehme, R.M.; Mackenstedt, U.; Kahl, O.; Steidle, J.L.M. A Hidden Beneficial: Biology of the Tick-Wasp Ixodiphagus hookeri in Germany. J. Appl. Entomol. 2011, 135, 351–358. [Google Scholar] [CrossRef]
- Takasu, K.; Nakamura, S. Life History of the Tick Parasitoid Ixodiphagus hookeri (Hymenoptera: Encyrtidae) in Kenya. Biol. Control 2008, 46, 114–121. [Google Scholar] [CrossRef]
- Demas, F.A.; Hassanali, A.; Mwangi, E.N.; Kunjeku, E.C.; Mabveni, A.R. Cattle and Amblyomma Variegatum Odors Used in Host Habitat and Host Finding by the Tick Parasitoid, Ixodiphagus hookeri|Semantic Scholar. Available online: https://www.semanticscholar.org/paper/Cattle-and-Amblyomma-variegatum-Odors-Used-in-Host-Demas-Hassanali/4ad918160efdac6dd5b05c40eca504be8ef3ce0a (accessed on 27 April 2024).
- Alfeev, N.I.; Klimas, Y.V. On the Possibility of Developing Ichneumon Flies, Hunterellus Hookeri in Climatic Conditions of the USSR. Sov. Vet. 1938, 15, 55. [Google Scholar]
- Hu, R.; Hyland, K.E. Prevalence and Seasonal Activity of the Wasp Parasitoid, Jxodiphagus Hookeri (Hymenoptera: Encyrtidae) in Its Tick Host, Ixodes Scapularis (Acari: Ixodidae). Syst. Appl. Acarol. 1997, 2, 95–100. [Google Scholar] [CrossRef]
- Logan, T.M.; Bowman, J.L.; Hair, J.A. Parthenogenesis and Overwintering Behavior in Ixodiphagus texanus Howard. J. Agric. Entomol. 1985, 2, 272–276. [Google Scholar]
- Davis, A.J. Bibliography of the Ixodiphagini (Hymenoptera, Chalcidoidea, Encyrtidae), Parasites of Ticks (Acari, Ixodidae), with Notes on Their Biology. Tijdschr. Voor Entomol. 1986, 129, 181–190. [Google Scholar]
- Davis, A.J.; Campbell, A. Ixodiphagus Texanus Howard (Hymenoptera: Encyrtidae) a Parasite of the Rabbit Tick in Nova Scotia. Can. J. Zool. 1979, 57, 1164–1166. [Google Scholar] [CrossRef]
- Bohacsova, M.; Mediannikov, O.; Kazimirova, M.; Raoult, D.; Sekeyova, Z. Arsenophonus Nasoniae and Rickettsiae Infection of Ixodes Ricinus Due to Parasitic Wasp Ixodiphagus hookeri. PLoS ONE 2016, 11, e0149950. [Google Scholar] [CrossRef] [PubMed]
- Lapin, M.; Faško, P.; Melo, M.; Šťastný, P.; Tomlain, J. Klimatické oblasti. In Atlas Krajiny Slovenskej Republiky; Ministry of Environment of the Slovak Republic Bratislava: Bratislava, Slovak Republic, 2002; p. 95. ISBN 80-88833-27-2. (In Slovak) [Google Scholar]
- Ginsberg, H.S.; Ewing, C.P. Comparison of Flagging, Walking, Trapping, and Collecting from Hosts as Sampling Methods for Northern Deer Ticks, Ixodes dammini, and Lone-Star Ticks, Amblyomma americanum (Acari:Ixodidae). Exp. Appl. Acarol. 1989, 7, 313–322. [Google Scholar] [CrossRef] [PubMed]
- Filippova, N.A. Arachnida Class: Ixodid Ticks of the Subfamily Ixodinae. 1977. Available online: https://scholar.google.com/scholar_lookup?&title=Ixodid%20ticks%20of%20the%20subfamily%20Ixodinae&journal=Fauna%20SSSR%2C%20Paukoobraznye&volume=4&publication_year=1977&author=Filippova%2CNA#d=gs_cit&t=1714220291288&u=%2Fscholar%3Fq%3Dinfo%3AMo0R8nGzA7wJ%3Ascholar.google.com%2F%26output%3Dcite%26scirp%3D0%26hl%3Den (accessed on 27 April 2024).
- Buczek, A.; Buczek, W.; Bartosik, K.; Kulisz, J.; Stanko, M. Ixodiphagus hookeri Wasps (Hymenoptera: Encyrtidae) in Two Sympatric Tick Species Ixodes Ricinus and Haemaphysalis Concinna (Ixodida: Ixodidae) in the Slovak Karst (Slovakia): Ecological and Biological Considerations. Sci. Rep. 2021, 11, 11310. [Google Scholar] [CrossRef] [PubMed]
- Heglasová, I.; Víchová, B.; Kraljik, J.; Mošanský, L.; Miklisová, D.; Stanko, M. Molecular Evidence and Diversity of the Spotted-Fever Group Rickettsia Spp. in Small Mammals from Natural, Suburban and Urban Areas of Eastern Slovakia. Ticks Tick-Borne Dis. 2018, 9, 1400–1406. [Google Scholar] [CrossRef]
- Heglasová, I.; Rudenko, N.; Golovchenko, M.; Zubriková, D.; Miklisová, D.; Stanko, M. Ticks, Fleas and Rodent-Hosts Analyzed for the Presence of Borrelia Miyamotoi in Slovakia: The First Record of Borrelia Miyamotoi in a Haemaphysalis Inermis Tick. Ticks Tick-Borne Dis. 2020, 11, 101456. [Google Scholar] [CrossRef]
- Radzijevskaja, J.; Paulauskas, A.; Aleksandraviciene, A.; Jonauskaite, I.; Stanko, M.; Karbowiak, G.; Petko, B. New Records of Spotted Fever Group Rickettsiae in Baltic Region. Microbes Infect. 2015, 17, 874–878. [Google Scholar] [CrossRef]
- Cowling, D.W.; Gardner, I.A.; Johnson, W.O. Comparison of Methods for Estimation of Individual-Level Prevalence Based on Pooled Samples. Prev. Vet. Med. 1999, 39, 211–225. [Google Scholar] [CrossRef]
- Guy, E.C.; Stanek, G. Detection of Borrelia Burgdorferi in Patients with Lyme Disease by the Polymerase Chain Reaction. J. Clin. Pathol. 1991, 44, 610–611. [Google Scholar] [CrossRef] [PubMed]
- Krawczyk, A.I.; Bakker, J.W.; Koenraadt, C.J.M.; Fonville, M.; Takumi, K.; Sprong, H.; Demir, S. Tripartite Interactions among Ixodiphagus hookeri, Ixodes Ricinus and Deer: Differential Interference with Transmission Cycles of Tick-Borne Pathogens. Pathogens 2020, 9, 339. [Google Scholar] [CrossRef]
- de Leeuw, B.H.C.G.M.; Maraha, B.; Hollemans, L.; Sprong, H.; Brandenburg, A.H.; Westenend, P.J.; Kusters, J.G. Evaluation of Borrelia Real Time PCR DNA Targeting OspA, FlaB and 5S-23S IGS and Borrelia 16S rRNA RT-qPCR. J. Microbiol. Methods 2014, 107, 41–46. [Google Scholar] [CrossRef]
- Coipan, E.C.; Fonville, M.; Tijsse-Klasen, E.; van der Giessen, J.W.B.; Takken, W.; Sprong, H.; Takumi, K. Geodemographic Analysis of Borrelia Burgdorferi Sensu Lato Using the 5S-23S rDNA Spacer Region. Infect. Genet. Evol. J. Mol. Epidemiol. Evol. Genet. Infect. Dis. 2013, 17, 216–222. [Google Scholar] [CrossRef]
- Azagi, T.; Hoeve-Bakker, B.J.A.; Jonker, M.; Roelfsema, J.H.; Sprong, H.; Kerkhof, K. Technical Evaluation of qPCR Multiplex Assays for the Detection of Ixodes Ricinus-Borne Pathogens. Microorganisms 2022, 10, 2222. [Google Scholar] [CrossRef]
- Eberts, M.D.; Vissotto de Paiva Diniz, P.P.; Beall, M.J.; Stillman, B.A.; Chandrashekar, R.; Breitschwerdt, E.B. Typical and Atypical Manifestations of Anaplasma Phagocytophilum Infection in Dogs. J. Am. Anim. Hosp. Assoc. 2011, 47, e86–e94. [Google Scholar] [CrossRef]
- Derdáková, M.; Beati, L.; Pet’ko, B.; Stanko, M.; Fish, D. Genetic Variability within Borrelia Burgdorferi Sensu Lato Genospecies Established by PCR-Single-Strand Conformation Polymorphism Analysis of the rrfA-rrlB Intergenic Spacer in Ixodes Ricinus Ticks from the Czech Republic. Appl. Environ. Microbiol. 2003, 69, 509–516. [Google Scholar] [CrossRef]
- Diaz, M.H.; Bai, Y.; Malania, L.; Winchell, J.M.; Kosoy, M.Y. Development of a Novel Genus-Specific Real-Time PCR Assay for Detection and Differentiation of Bartonella Species and Genotypes. Available online: https://www.researchgate.net/publication/221874549_Development_of_a_Novel_Genus-Specific_Real-Time_PCR_Assay_for_Detection_and_Differentiation_of_Bartonella_Species_and_Genotypes (accessed on 27 April 2024).
- Regnery, R.L.; Spruill, C.L.; Plikaytis, B.D. Genotypic Identification of Rickettsiae and Estimation of Intraspecies Sequence Divergence for Portions of Two Rickettsial Genes. J. Bacteriol. 1991, 173, 1576–1589. [Google Scholar] [CrossRef]
- Casati, S.; Sager, H.; Gern, L.; Piffaretti, J.C. Presence of Potentially Pathogenic Babesia Sp. for Human in Ixodes Ricinus in Switzerland. Ann. Agric. Environ. Med. 2006, 13, 65–70. [Google Scholar] [PubMed]
- Gaye, M.; Amanzougaghene, N.; Laidoudi, Y.; Niang, E.H.A.; Sekeyová, Z.; Laroche, M.; Bérenger, J.-M.; Raoult, D.; Kazimírová, M.; Fenollar, F.; et al. Hymenopteran Parasitoids of Hard Ticks in Western Africa and the Russian Far East. Microorganisms 2020, 8, 1992. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
- Klyushkina, E.A. A Parasite of the Ixodid Ticks, Hunterellus hookeri How. in the Crimea. Zool. Zh 1958, 37, 1561–1563. [Google Scholar]
- Howard, L.O. “A Chalcidoid Parasite of a Tick”. Entomological News, and Proceedings of the Entomological Section of the Academy of Natural Sciences of Philadelphia 18, 375–378. 1907. Available online: https://ia801707.us.archive.org/12/items/biostor-3844/biostor-3844.pdf (accessed on 1 January 2023).
- Stafford, K.C.; Denicola, A.J.; Kilpatrick, H.J. Reduced Abundance of Ixodes Scapularis (Acari: Ixodidae) and the Tick Parasitoid Ixodiphagus hookeri (Hymenoptera: Encyrtidae) with Reduction of White-Tailed Deer. J. Med. Entomol. 2003, 40, 642–652. [Google Scholar] [CrossRef] [PubMed]
- Ramos, R.A.N.; de Macedo, L.O.; Bezerra-Santos, M.A.; de Carvalho, G.A.; Verocai, G.G.; Otranto, D. The Role of Parasitoid Wasps, Ixodiphagus Spp. (Hymenoptera: Encyrtidae), in Tick Control. Pathogens 2023, 12, 676. [Google Scholar] [CrossRef]
- Cooley, R.A.; Kohls, G.M.; Cooley, R.A.; Kohls, G.M. A Summary on Tick Parasites. Proc. Pac. Sci. Congr. Pac. Sci. Assoc. 1933, 5, 3375–3381. [Google Scholar]
- Wood, H.P. Notes on the Life History of the Tick Parasite. J. Econ. Entomol. 1911, 4, 425–431. [Google Scholar] [CrossRef]
- Stafford, K.C.; Denicola, A.J.; Magnarelli, L.A. Presence of Ixodiphagus hookeri (Hymenoptera: Encyrtidae) in Two Connecticut Populations of Ixodes Scapularis (Acari: Ixodidae). J. Med. Entomol. 1996, 33, 183–188. [Google Scholar] [CrossRef]
- Mather, T.N.; Piesman, J.; Spielman, A. Absence of Spirochaetes (Borrelia burgdorferi) and Piroplasms (Babesia microti) in Deer Ticks (Ixodes dammini) Parasitized by Chalcid Wasps (Hunterellus hookeri). Med. Vet. Entomol. 1987, 1, 3–8. [Google Scholar] [CrossRef]
- Bouček, Z.; Černỳ, V. Cizopasník Klístat, Chalcidka Hunterellus Hookeri How. v CSR. Folia Zool. Entomol. 1954, 3, 109–111. [Google Scholar]
- Doby, J.M.; Van Laere, G. Hunterellus hookeri Howard, 1907, Hymenoptère Chalcididae Parasite de La Tique Ixodes Ricinus Dans l’ouest et Le Centre de La France. Bull. Société Fr. Parasitol. 1993, 11, 265–270. [Google Scholar]
- Japoshvili, G. New Records of Encyrtids (Hymenoptera: Chalcidoidea: Encyrtidae) from Georgia, with Description of Seven New Species. J. Asia-Pac. Entomol. 2017, 20, 866–877. [Google Scholar] [CrossRef]
- Collatz, J.; Fuhrmann, A.; Selzer, P.; Oehme, R.M.; Hartelt, K.; Kimmig, P.; Meiners, T.; Mackenstedt, U.; Steidle, J.L.M. Being a Parasitoid of Parasites: Host Finding in the Tick Wasp Ixodiphagus hookeri by Odours from Mammal. Entomol. Exp. Appl. 2010, 134, 131–137. [Google Scholar] [CrossRef]
- Walter, G. Beitrag zur Biologie der Schlupfwespe Hunterellus hookeri Howard (Hymenoptera: Encyrtidae) in Norddeutschland. Beitr. Naturkunde Niedersachs. 1980, 33, 129–133. [Google Scholar]
- Tijsse-Klasen, E.; Braks, M.; Scholte, E.-J.; Sprong, H. Parasites of Vectors—Ixodiphagus hookeri and Its Wolbachia Symbionts in Ticks in The Netherlands. Parasit. Vectors 2011, 4, 228. [Google Scholar] [CrossRef] [PubMed]
- Sormunen, J.J.; Sippola, E.; Kaunisto, K.M.; Vesterinen, E.J.; Sääksjärvi, I.E. First evidence of Ixodiphagus hookeri (Hymenoptera: Encyrtidae) parasitization in Finnish castor bean ticks (Ixodes ricinus). Exp. Appl. Acarol. 2019, 79, 395–404. [Google Scholar] [CrossRef] [PubMed]
- Luu, L.; Palomar, A.M.; Farrington, G.; Schilling, A.-K.; Premchand-Branker, S.; McGarry, J.; Makepeace, B.L.; Meredith, A.; Bell-Sakyi, L. Bacterial Pathogens and Symbionts Harboured by Ixodes Ricinus Ticks Parasitising Red Squirrels in the United Kingdom. Pathogens 2021, 10, 458. [Google Scholar] [CrossRef]
- Rehácek, J.; Kocianová, E. Attempt to Infect Hunterellus Hookeri Howard (Hymenoptera, Encyrtidae), an Endoparasite of Ticks, with Coxiella Burnetti. Acta Virol. 1992, 36, 492. [Google Scholar] [PubMed]
- Slovak, M. Finding of the Endoparasitoid Ixodiphagus hookeri (Hymenoptera, Encyrtidae) in Haemaphysalis Concinna Ticks in Slovakia. Biologia 2003, 58, 890–894. [Google Scholar]
- Tay, S.T.; Kho, K.L.; Lye, S.F.; Ngeow, Y.F. Phylogeny and Putative Virulence Gene Analysis of Bartonella Bovis. J. Vet. Med. Sci. 2018, 80, 653–661. [Google Scholar] [CrossRef] [PubMed]
- Deng, H.; Le Rhun, D.; Buffet, J.-P.R.; Cotté, V.; Read, A.; Birtles, R.J.; Vayssier-Taussat, M. Strategies of Exploitation of Mammalian Reservoirs by Bartonella Species. Vet. Res. 2012, 43, 15. [Google Scholar] [CrossRef]
- Alfeev, N.I. The utilization of Hunterellus hookeri How. for the control of the ticks, Ixodes ricinus L. and Ixodes persulcatus P. Sch. with reference to peculiarities of their metamorphosis under conditions of the Province of Lenningrad. Rev. Appl. Ent. B 1946, 34, 108–109. [Google Scholar]
- Wang, F.; Wang, D.; Guo, G.; Hu, Y.; Wei, J.; Liu, J. Species Delimitation of the Dermacentor Ticks Based on Phylogenetic Clustering and Niche Modeling. PeerJ 2019, 7, e6911. [Google Scholar] [CrossRef] [PubMed]
- Bobo, C.G. Molecular Characterization of Wolbachia and Its Impact on the Microbiome of Exotic and United States Ticks. Honors Theses. 2020. Available online: https://aquila.usm.edu/honors_theses/702 (accessed on 1 January 2023).
- Parola, P.; Paddock, C.D.; Socolovschi, C.; Labruna, M.B.; Mediannikov, O.; Kernif, T.; Abdad, M.Y.; Stenos, J.; Bitam, I.; Fournier, P.-E.; et al. Update on Tick-Borne Rickettsioses around the World: A Geographic Approach. Clin. Microbiol. Rev. 2013, 26, 657–702. [Google Scholar] [CrossRef] [PubMed]
- Ouarti, B.; Hamzaoui, B.E.; Stanko, M.; Laroche, M.; Mediannikov, O.; Parola, P.; Sekeyová, Z. Detection of Rickettsia Raoultii in Dermacentor Reticulatus and Haemaphysalis Inermis Ticks in Slovakia. Biologia 2022, 77, 1611–1617. [Google Scholar] [CrossRef]
- Ibarra, V.; Oteo, J.A.; Portillo, A.; Santibáñez, S.; Blanco, J.R.; Metola, L.; Eiros, J.M.; Pérez-Martínez, L.; Sanz, M. Rickettsia slovaca Infection: DEBONEL/TIBOLA—IBARRA—2006—Annals of the New York Academy of Sciences—Wiley Online Library. Available online: https://nyaspubs.onlinelibrary.wiley.com/doi/abs/10.1196/annals.1374.040 (accessed on 27 April 2024).
- Oteo, J.A.; Ibarra, V.; Blanco, J.R.; Martínez De Artola, V.; Márquez, F.J.; Portillo, A.; Raoult, D.; Anda, P. Dermacentor-Borne Necrosis Erythema and Lymphadenopathy: Clinical and Epidemiological Features of a New Tick-Borne Disease. Clin. Microbiol. Infect. 2004, 10, 327–331. [Google Scholar] [CrossRef] [PubMed]
- Selmi, M.; Bertolotti, L.; Tomassone, L.; Mannelli, A. Rickettsia Slovaca in Dermacentor Marginatus and Tick-Borne Lymphadenopathy, Tuscany, Italy. Emerg. Infect. Dis. 2008, 14, 817–820. [Google Scholar] [CrossRef] [PubMed]
- Špitalská, E.; Sparagano, O.; Stanko, M.; Schwarzová, K.; Špitalský, Z.; Škultéty, Ľ.; Havlíková, S.F. Diversity of Coxiella-like and Francisella-like Endosymbionts, and Rickettsia spp., Coxiella Burnetii as Pathogens in the Tick Populations of Slovakia, Central Europe. Ticks Tick-Borne Dis. 2018, 9, 1207–1211. [Google Scholar] [CrossRef] [PubMed]
- Buffet, J.-P.; Pisanu, B.; Brisse, S.; Roussel, S.; Félix, B.; Halos, L.; Chapuis, J.-L.; Vayssier-Taussat, M. Deciphering Bartonella Diversity, Recombination, and Host Specificity in a Rodent Community. PLoS ONE 2013, 8, e68956. [Google Scholar] [CrossRef] [PubMed]
- Kraljik, J.; Stanko, M.; Blaňárová, L.; Miklisová, D.; Mošanský, L.; Bona, M. Ticks and Fleas on Small Mam-Mals in Natural Foci of Eastern Slovakia. In Proceedings of the Joint 8th International Ticks and Tick-Borne Pathogens (TTP-8) and 12th Biennial Society for Tropical Veterinary Medicine (STVM) Conference, Cape Town, South Africa, 24–29 August 2014. [Google Scholar]
- Kraljik, J.; Paziewska-Harris, A.; Miklisová, D.; Blaňarová, L.; Mošanský, L.; Bona, M.; Stanko, M. Genetic Diversity of Bartonella Genotypes Found in the Striped Field Mouse (Apodemus agrarius) in Central Europe. Parasitology 2016, 143, 1437–1442. [Google Scholar] [CrossRef]
- Burgdorfer, W.; Brinton, L.P. Mechanisms of Transovarial Infection of Spotted Fever Rickettsiae in Ticks. Ann. N. Y. Acad. Sci. 1975, 266, 61–72. [Google Scholar] [CrossRef]
- Socolovschi, C.; Mediannikov, O.; Raoult, D.; Parola, P. The Relationship between Spotted Fever Group Rickettsiae and Ixodid Ticks. Vet. Res. 2009, 40, 34. [Google Scholar] [CrossRef]
- Scoles, G.A.; Papero, M.; Beati, L.; Fish, D. A Relapsing Fever Group Spirochete Transmitted by Ixodes Scapularis Ticks. Vector Borne Zoonotic Dis. Larchmt. N 2001, 1, 21–34. [Google Scholar] [CrossRef] [PubMed]
- Knap, N.; Duh, D.; Birtles, R.; Trilar, T.; Petrovec, M.; Avšič-Županc, T. Molecular Detection of Bartonella Species Infecting Rodents in Slovenia. FEMS Immunol. Med. Microbiol. 2007, 50, 45–50. [Google Scholar] [CrossRef] [PubMed]
- Berglund, E.C.; Ellegaard, K.M.; Granberg, F.; Xie, Z.; Maruyama, S.; Kosoy, M.Y.; Birtles, R.J.; Andersson, S.G. Rapid Diversification by Recombination in Bartonella Grahamii from Wild Rodents in Asia Contrasts with Low Levels of Genomic Divergence in Northern Europe and America. Mol. Ecol. 2010, 19, 2241–2255. [Google Scholar] [CrossRef] [PubMed]
- Paziewska, A.; Harris, P.D.; Zwolińska, L.; Bajer, A.; Siński, E. Recombination Within and Between Species of the Alpha Proteobacterium Bartonella Infecting Rodents. Microb. Ecol. 2011, 61, 134–145. [Google Scholar] [CrossRef] [PubMed]
- Pangrácová, L.; Derdáková, M.; Pekárik, L.; Hviščová, I.; Víchová, B.; Stanko, M.; Hlavatá, H.; Peťko, B. Ixodes Ricinus Abundance and Its Infection with the Tick-Borne Pathogens in Urban and Suburban Areas of Eastern Slovakia. Parasit. Vectors 2013, 6, 238. [Google Scholar] [CrossRef]
- Blaňarová, L.; Stanko, M.; Carpi, G.; Miklisová, D.; Víchová, B.; Mošanský, L.; Bona, M.; Derdáková, M. Distinct Anaplasma Phagocytophilum Genotypes Associated with Ixodes Trianguliceps Ticks and Rodents in Central Europe. Ticks Tick-Borne Dis. 2014, 5, 928–938. [Google Scholar] [CrossRef] [PubMed]
- Bona, M.; Blaňárová, L.; Stanko, M.; Mošanský, L.; Čepčeková, E.; Víchová, B. Impact of Climate Factors on the Seasonal Activity of Ticks and Temporal Dynamics of Tick-Borne Pathogens in an Area with a Large Tick Species Diversity in Slovakia, Central Europe. Biologia 2022, 77, 1619–1631. [Google Scholar] [CrossRef]
- Richter, D.; Debski, A.; Hubalek, Z.; Matuschka, F.-R. Absence of Lyme Disease Spirochetes in Larval Ixodes Ricinus Ticks. Vector Borne Zoonotic Dis. Larchmt. 2012, 12, 21–27. [Google Scholar] [CrossRef]
- Hayes, S.F.; Burgdorfer, W.; Aeschlimann, A. Sexual Transmission of Spotted Fever Group Rickettsiae by Infected Male Ticks: Detection of Rickettsiae in Immature Spermatozoa of Ixodes Ricinus. Infect. Immun. 1980, 27, 638–642. [Google Scholar] [CrossRef]
- Gaber, M.S.; Khalil, G.M.; Hoogstraal, H. Borrelia Crocidurae: Venereal Transfer in Egyptian Ornithodoros Erraticus Ticks. Exp. Parasitol. 1982, 54, 182–184. [Google Scholar] [CrossRef]
Prevalence of Pathogens Detected in Questing I. ricinus (%) | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
Developmental Stage | Total No. of Examined Ticks | Infestation with Iph. hookeri | Prevalence (%) MIR * (%) | Iph. hookeri | Wolbachia spp. | Borreliella spp. | Babesia spp./Theileria spp. | Anaplasma spp. | Bartonella spp. | Rickettsia spp. |
Male | 154 | Negative | Prevalence (%) (no. of positive ticks) | 0 | 0 | (n = 29) 18.83 | 0 | (n = 14) 9.09 | (n = 5) 3.25 | (n = 14) 9.09 |
Female | 149 | 0 | 0 | (n = 34) 22.81 | (n = 2) 1.34 | (n = 8) 5.37 | (n = 8) 5.37 | (n = 16) 10.74 | ||
Nymph | 279 | 0 | (n = 1) 0.36 | (n = 49) 17.56 | (n = 2) 0.72 | (n = 1) 0.36 | (n = 60) 21.51 | (n = 24) 8.60 | ||
21 | Positive | (n = 21) 100 | (n = 21) 100 | (n = 6) 28.57 | 0 | 0 | (n = 7) 33.33 | (n = 1) 4.76 | ||
Total no. of wasp-free ticks | 582 | Negative | 0 | (n = 1) 0.17 | (n = 112) 19.24 | (n = 4) 0.69 | (n = 23) 3.95 | (n = 73) 12.54 | (n = 54) 9.28 | |
Total | 603 | Overall prevalence (%) | (n = 21) 3.48 | (n = 22) 3.65 | (n = 118) 19.57 | (n = 4) 0.66 | (n = 23) 3.81 | (n = 80) 13.27 | (n = 55) 9.12 | |
Larvae | 100 pools of 10 larvae | MIR (%) | 0 | 0 | 0 | (n = 2) 2 | (n = 4) 4 | (n = 4) 4 | (n = 28) 28 | |
Prevalence of Pathogens Detected in Questing H. concinna (%) | ||||||||||
Female | 3 | Negative | Prevalence (%) (no. of positive ticks) | 0 | 2/3 | 0 | 0 | 0 | 0 | 0 |
Nymph | 274 | 0 | (n = 1) 0.37 | 0 | (n = 27) 9.85 | 0 | (n = 7) 2.56 | (n = 6) 2.19 | ||
23 | Positive | (n = 23) 100 | (n = 21) 91.3 | 0 | 0 | (n = 1) 4.35 | 0 | 0 | ||
Total no. of wasp-free ticks | 277 | Negative | 0 | (n = 3) 1.08 | 0 | (n = 27) 9.75 | 0 | (n = 7) 2.53 | (n = 6) 2.17 | |
Total | 300 | Overall prevalence (%) | (n = 23) 7.67 | (n = 24) 8.00 | 0 | (n = 27) 9.00 | (n = 1) 0.33 | (n = 7) 2.33 | (n = 6) 2.00 | |
Larvae | 92 pools of 10 larvae | Negative | MIR (%) | 0 | 0 | 0 | (n = 2) 2.17 | 0 | 0 | (n = 3) 3.26 |
2 pools of 10 larvae | Positive | 2/2 | 0 | 0 | 0 | 0 | 0 | 1/2 | ||
Total | 94 pools | Overall MIR (%) | (n = 2) 2.13 | 0 | 0 | (n = 2) 2.13 | 0 | 0 | (n = 4) 4.26 |
Prevalence of Pathogens Detected in Questing D. marginatus (%) | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
Developmental Stage | Total No. of Examined Ticks | Infestation with Iph. hookeri | Prevalence (%) | Iph. hookeri | Wolbachia spp. | Borreliella spp. | Babesia spp./Theileria spp. | Anaplasma spp. | Bartonella spp. | Rickettsia spp. |
Male | 12 | Negative | Prevalence (%) (no. of positive ticks) | 0 | 0 | 0 | 0 | (n = 3) 25 | (n = 1) 8.33 | (n = 9) 75 |
Female | 7 | 0 | 0 | (n = 1) 14.29 | 0 | 0 | 0 | (n = 4) 57.14 | ||
Nymph | 8 | 0 | 0 | (n = 1) 12.5 | 0 | 0 | (n = 1) 12.5 | (n = 1) 12.5 | ||
Larvae | 12 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | ||
Total | 39 | Overall prevalence (%) | 0 | 0 | (n = 2) 5.13 | 0 | (n = 3) 7.69 | (n = 2) 5.13 | (n = 14) 35.9 | |
Prevalence of Pathogens Detected in Questing D. reticulatus (%) | ||||||||||
Male | 18 | Negative | 0 | 0 | 0 | 0 | (n = 3) 15.79 | 0 | (n = 10) 55.56 | |
1 | Positive | 1/1 | 0 | 0 | 0 | 0 | 0 | 1/1 | ||
Female | 31 | Negative | Prevalence (%) (no. of positive ticks) | 0 | 0 | 0 | (n = 1) 3.22 | (n = 8) 25.81 | 0 | (n = 14) 45.16 |
Nymph | 7 | 0 | 0 | 0 | 0 | 0 | 0 | (n = 2) 28.6 | ||
Total no. of wasp-free ticks | 56 | Negative | 0 | 0 | 0 | (n = 1) 1.79 | (n = 11) 19.64 | 0 | (n = 26) 46.43 | |
Total | 57 | Overall prevalence (%) | (n = 1) 1.75 | 0 | 0 | (n = 1) 1.75 | (n = 11) 19.3 | 0 | (n = 27) 47.37 | |
Prevalence of Pathogens Detected in Questing H. inermis (%) | ||||||||||
Male | 55 | Negative | Prevalence (%) (no. of positive ticks) | 0 | 0 | 0 | 0 | (n = 7) 12.73 | (n = 2) 3.64 | (n = 25) 45.45 |
Female | 60 | 0 | 0 | 0 | 0 | (n = 5) 8.33 | (n = 2) 3.33 | (n = 3) 5 | ||
Nymph | 9 | 0 | 0 | 0 | 0 | (n = 1) 11.11 | 0 | (n = 9) 100 | ||
Total | 124 | Overall prevalence (%) | 0 | 0 | 0 | 0 | (n = 13) 10.48 | (n = 4) 3.23 | (n = 37) 29.84 |
Prevalence of Pathogens in Different Tick Species from Rodents (%) | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
Tick Species | Developmental Stage | Total no. of Examined Ticks | Infestation with Iph. hookeri | Prevalence (%) | Iph. hookeri | Wolbachia spp. | Borreliella spp. | Babesia spp./Theileria spp. | Anaplasma spp. | Bartonella spp. | Rickettsia spp. |
I. trianguliceps | Larvae | 19 | Negative | 0 | 0 | 0 | 0 | 0 | 0 | (n = 1) 5.26 | |
H. inermis | Larvae | 2 | Negative | 0 | 0 | 0 | 1/2 | 0 | 0 | 0 | |
D. marginarus | Larvae | 92 | Negative | Prevalence (%) (no. of positive ticks) | 0 | 0 | (n = 10) 10.87 | 0 | 0 | (n = 8) 8.71 | (n = 10) 10.87 |
3 | Positive | 3/3 | 3/3 | 0 | 1/3 | 0 | 0 | 0 | |||
95 | Total | (n = 3) 3.16 | (n = 3) 3.16 | (n = 10) 10.53 | (n = 1) 1.1 | 0 | (n = 8) 8.42 | (n = 10) 10.53 | |||
D. reticulatus | Larvae | 60 | Negative | 0 | 0 | (n = 4) 6.67 | (n = 6) 10 | 0 | (n = 1) 1.67 | (n = 2) 3.33 | |
12 | Positive | (n = 12) 100 | (n = 11) 91.67 | (n = 1) 8.33 | (n = 1) 8.33 | 0 | 0 | (n = 3) 25 | |||
72 | Total | (n = 12) 16.67 | (n = 11) 15.27 | (n = 5) 6.94 | (n = 7) 9.72 | 0 | (n = 1) 1.39 | (n = 5) 6.94 |
Host | Organism | Gene Fragment | Accession Number |
---|---|---|---|
I. ricinus | Iph. hookeri | cox1 | PP079108-PP079110 |
I. ricinus | Iph. hookeri | 28S rRNA | PP085018-PP085022 |
I. ricinus | B. microti | 18S rRNA | PP086648; PP086656 |
I. ricinus | A. phagocytophilum | msp2 | PP239200-202 |
I. ricinus | Borreliella afzelii | rrfA-rrlB | PP230799 |
I. ricinus | R. helvetica | gltA | PP230811-PP230815 |
Rickettsia sp. | gltA | PP230816 | |
B. bovis | ssrA | PP230802-PP230805 | |
Bartonella sp. | ssrA | PP230809 | |
H. concinna | Iph. hookeri | cox1 | PP079105-PP079107 |
H. concinna | Iph. hookeri | 28S rRNA | PP084992-PP085001 |
H. concinna | B. canis | 18S rRNA | PP086528; PP086530 |
H. concinna | Babesia sp. 2 (Eurasia) | 18S rRNA | PP086565 |
H. concinna | Th. capreoli | 18S rRNA | PP086524; PP086526; PP086532; PP086645-46; PP086675-76 |
H. concinna | Babesia sp. | 18S rRNA | PP213167 |
H. concinna | R. helvetica | gltA | PP230818, PP230819 |
Rickettsia sp. | gltA | PP230817 | |
D. marginatus | Iph. hookeri | 28S rRNA | PP085019 |
B. grahamii | ssrA | PP230800, PP230806-PP230808 | |
D. reticulatus | Bartonella sp. | ssrA | PP230810 |
I. ricinus | H. concinna | D. marginatus | D. reticulatus | |
---|---|---|---|---|
Observed Co-occurrence | 12 | 2 | 1 | 6 |
Odds ratio | 2.12 | 0.66 | 0.92 | 1.46 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Blažeková, V.; Stanko, M.; Sprong, H.; Kohl, R.; Zubriková, D.; Vargová, L.; Bona, M.; Miklisová, D.; Víchová, B. Ixodiphagus hookeri (Hymenoptera: Encyrtidae) and Tick-Borne Pathogens in Ticks with Sympatric Occurrence (and Different Activities) in the Slovak Karst National Park (Slovakia), Central Europe. Pathogens 2024, 13, 385. https://doi.org/10.3390/pathogens13050385
Blažeková V, Stanko M, Sprong H, Kohl R, Zubriková D, Vargová L, Bona M, Miklisová D, Víchová B. Ixodiphagus hookeri (Hymenoptera: Encyrtidae) and Tick-Borne Pathogens in Ticks with Sympatric Occurrence (and Different Activities) in the Slovak Karst National Park (Slovakia), Central Europe. Pathogens. 2024; 13(5):385. https://doi.org/10.3390/pathogens13050385
Chicago/Turabian StyleBlažeková, Veronika, Michal Stanko, Hein Sprong, Robert Kohl, Dana Zubriková, Lucia Vargová, Martin Bona, Dana Miklisová, and Bronislava Víchová. 2024. "Ixodiphagus hookeri (Hymenoptera: Encyrtidae) and Tick-Borne Pathogens in Ticks with Sympatric Occurrence (and Different Activities) in the Slovak Karst National Park (Slovakia), Central Europe" Pathogens 13, no. 5: 385. https://doi.org/10.3390/pathogens13050385
APA StyleBlažeková, V., Stanko, M., Sprong, H., Kohl, R., Zubriková, D., Vargová, L., Bona, M., Miklisová, D., & Víchová, B. (2024). Ixodiphagus hookeri (Hymenoptera: Encyrtidae) and Tick-Borne Pathogens in Ticks with Sympatric Occurrence (and Different Activities) in the Slovak Karst National Park (Slovakia), Central Europe. Pathogens, 13(5), 385. https://doi.org/10.3390/pathogens13050385