FISH–Flow Cytometry Reveals Microbiome-Wide Changes in Post-Translational Modification and Altered Microbial Abundance Among Children with Inflammatory Bowel Disease
Abstract
:1. Introduction
2. Material and Methods
2.1. Participants and Sample Collection
2.2. Microbiome Extraction
2.3. Microbial Viability Assessment Using Propidium Monoazide
2.4. DNA Extraction and PCR/qPCR
2.5. Immunoblotting
2.6. Fluorescence In Situ Hybridisation
2.7. Intracellular Staining (Immunostaining)
2.8. Flow Cytometry
2.9. Statistical Analysis
3. Results and Discussion
3.1. Optimisation and Validation of Microbiome FISH-FC
3.2. Patient Population and Sampling
3.3. Abundance and p-Tyr Signal Stratified by Bacterial Community
3.4. Effect of Age on p-Tyr
4. Summary and Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Pittayanon, R.; Lau, J.T.; Leontiadis, G.I.; Tse, F.; Yuan, Y.; Surette, M.; Moayyedi, P. Differences in Gut Microbiota in Patients With vs Without Inflammatory Bowel Diseases: A Systematic Review. Gastroenterology 2020, 158, 930–946.e931. [Google Scholar] [CrossRef] [PubMed]
- Lavelle, A.; Sokol, H. The Gut Microbiome in Inflammatory Bowel Disease. In Molecular Genetics of Inflammatory Bowel Disease; Springer: Berlin/Heidelberg, Germany, 2019; pp. 347–377. [Google Scholar]
- O’Toole, P.W.; Ghosh, T.S.; Goswami, S.; Manghi, P.; Segata, N.; Shanahan, F. Translating the Microbiome: What’s the Target? Gastroenterology 2023, 165, 317–319. [Google Scholar] [CrossRef] [PubMed]
- Galazzo, G.; van Best, N.; Benedikter, B.J.; Janssen, K.; Bervoets, L.; Driessen, C.; Oomen, M.; Lucchesi, M.; van Eijck, P.H.; Becker, H.E.F.; et al. How to Count Our Microbes? The Effect of Different Quantitative Microbiome Profiling Approaches. Front. Cell. Infect. Microbiol. 2020, 10, 403. [Google Scholar] [CrossRef] [PubMed]
- Human Microbiome Project, C. Structure, function and diversity of the healthy human microbiome. Nature 2012, 486, 207–214. [Google Scholar] [CrossRef]
- Kolmeder, C.A.; Salojarvi, J.; Ritari, J.; de Been, M.; Raes, J.; Falony, G.; Vieira-Silva, S.; Kekkonen, R.A.; Corthals, G.L.; Palva, A.; et al. Faecal Metaproteomic Analysis Reveals a Personalized and Stable Functional Microbiome and Limited Effects of a Probiotic Intervention in Adults. PLoS ONE 2016, 11, e0153294. [Google Scholar] [CrossRef]
- Macek, B.; Forchhammer, K.; Hardouin, J.; Weber-Ban, E.; Grangeasse, C.; Mijakovic, I. Protein post-translational modifications in bacteria. Nat. Rev. Microbiol. 2019, 17, 651–664. [Google Scholar] [CrossRef]
- Duan, H.; Zhang, X.; Figeys, D. An emerging field: Post-translational modification in microbiome. Proteomics 2023, 23, e2100389. [Google Scholar] [CrossRef]
- Bechet, E.; Guiral, S.; Torres, S.; Mijakovic, I.; Cozzone, A.J.; Grangeasse, C. Tyrosine-kinases in bacteria: From a matter of controversy to the status of key regulatory enzymes. Amino Acids 2009, 37, 499–507. [Google Scholar] [CrossRef]
- Bechet, E.; Gruszczyk, J.; Terreux, R.; Gueguen-Chaignon, V.; Vigouroux, A.; Obadia, B.; Cozzone, A.J.; Nessler, S.; Grangeasse, C. Identification of structural and molecular determinants of the tyrosine-kinase Wzc and implications in capsular polysaccharide export. Mol. Microbiol. 2010, 77, 1315–1325. [Google Scholar] [CrossRef]
- Getz, L.J.; Runte, C.S.; Rainey, J.K.; Thomas, N.A. Tyrosine Phosphorylation as a Widespread Regulatory Mechanism in Prokaryotes. J. Bacteriol. 2019, 201, e00205-19. [Google Scholar] [CrossRef]
- Corcionivoschi, N.; Alvarez, L.A.; Sharp, T.H.; Strengert, M.; Alemka, A.; Mantell, J.; Verkade, P.; Knaus, U.G.; Bourke, B. Mucosal reactive oxygen species decrease virulence by disrupting Campylobacter jejuni phosphotyrosine signaling. Cell Host Microbe 2012, 12, 47–59. [Google Scholar] [CrossRef] [PubMed]
- Morgan, X.C.; Tickle, T.L.; Sokol, H.; Gevers, D.; Devaney, K.L.; Ward, D.V.; Reyes, J.A.; Shah, S.A.; LeLeiko, N.; Snapper, S.B.; et al. Dysfunction of the intestinal microbiome in inflammatory bowel disease and treatment. Genome Biol. 2012, 13, R79. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Deeke, S.A.; Ning, Z.; Starr, A.E.; Butcher, J.; Li, J.; Mayne, J.; Cheng, K.; Liao, B.; Li, L.; et al. Metaproteomics reveals associations between microbiome and intestinal extracellular vesicle proteins in pediatric inflammatory bowel disease. Nat. Commun. 2018, 9, 2873. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Ning, Z.; Mayne, J.; Yang, Y.; Deeke, S.A.; Walker, K.; Farnsworth, C.L.; Stokes, M.P.; Couture, J.F.; Mack, D.; et al. Widespread protein lysine acetylation in gut microbiome and its alterations in patients with Crohn’s disease. Nat. Commun. 2020, 11, 4120. [Google Scholar] [CrossRef]
- Li, Z.; Wang, Y.; Yao, Q.; Justice, N.B.; Ahn, T.H.; Xu, D.; Hettich, R.L.; Banfield, J.F.; Pan, C. Diverse and divergent protein post-translational modifications in two growth stages of a natural microbial community. Nat. Commun. 2014, 5, 4405. [Google Scholar] [CrossRef]
- Rigottier-Gois, L.; Bourhis, A.G.; Gramet, G.; Rochet, V.; Dore, J. Fluorescent hybridisation combined with flow cytometry and hybridisation of total RNA to analyse the composition of microbial communities in human faeces using 16S rRNA probes. FEMS Microbiol. Ecol. 2003, 43, 237–245. [Google Scholar] [CrossRef]
- Levine, A.; Griffiths, A.; Markowitz, J.; Wilson, D.C.; Turner, D.; Russell, R.K.; Fell, J.; Ruemmele, F.M.; Walters, T.; Sherlock, M.; et al. Pediatric modification of the Montreal classification for inflammatory bowel disease: The Paris classification. Inflamm. Bowel Dis. 2011, 17, 1314–1321. [Google Scholar] [CrossRef]
- Levine, A.; Koletzko, S.; Turner, D.; Escher, J.C.; Cucchiara, S.; de Ridder, L.; Kolho, K.L.; Veres, G.; Russell, R.K.; Paerregaard, A.; et al. ESPGHAN revised porto criteria for the diagnosis of inflammatory bowel disease in children and adolescents. J. Pediatr. Gastroenterol. Nutr. 2014, 58, 795–806. [Google Scholar] [CrossRef]
- Watt, E.; Gemmell, M.R.; Berry, S.; Glaire, M.; Farquharson, F.; Louis, P.; Murray, G.I.; El-Omar, E.; Hold, G.L. Extending colonic mucosal microbiome analysis-assessment of colonic lavage as a proxy for endoscopic colonic biopsies. Microbiome 2016, 4, 61. [Google Scholar] [CrossRef]
- Hevia, A.; Delgado, S.; Margolles, A.; Sanchez, B. Application of density gradient for the isolation of the fecal microbial stool component and the potential use thereof. Sci. Rep. 2015, 5, 16807. [Google Scholar] [CrossRef]
- Wang, R.F.; Cao, W.W.; Cerniglia, C.E. PCR detection and quantitation of predominant anaerobic bacteria in human and animal fecal samples. Appl. Environ. Microbiol. 1996, 62, 1242–1247. [Google Scholar] [CrossRef] [PubMed]
- Tanner, J.J.; Parsons, Z.D.; Cummings, A.H.; Zhou, H.; Gates, K.S. Redox regulation of protein tyrosine phosphatases: Structural and chemical aspects. Antioxid. Redox Signal. 2011, 15, 77–97. [Google Scholar] [CrossRef] [PubMed]
- Grangeasse, C.; Cozzone, A.J.; Deutscher, J.; Mijakovic, I. Tyrosine phosphorylation: An emerging regulatory device of bacterial physiology. Trends Biochem. Sci. 2007, 32, 86–94. [Google Scholar] [CrossRef] [PubMed]
- Bonne Kohler, J.; Jers, C.; Senissar, M.; Shi, L.; Derouiche, A.; Mijakovic, I. Importance of protein Ser/Thr/Tyr phosphorylation for bacterial pathogenesis. FEBS Lett. 2020, 594, 2339–2369. [Google Scholar] [CrossRef] [PubMed]
- Lim, S. A Review of the Bacterial Phosphoproteomes of Beneficial Microbes. Microorganisms 2023, 11, 931. [Google Scholar] [CrossRef] [PubMed]
- Grangeasse, C.; Nessler, S.; Mijakovic, I. Bacterial tyrosine kinases: Evolution, biological function and structural insights. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2012, 367, 2640–2655. [Google Scholar] [CrossRef]
- Shah, R.; Cope, J.L.; Nagy-Szakal, D.; Dowd, S.; Versalovic, J.; Hollister, E.B.; Kellermayer, R. Composition and function of the pediatric colonic mucosal microbiome in untreated patients with ulcerative colitis. Gut Microbes 2016, 7, 384–396. [Google Scholar] [CrossRef]
- Assa, A.; Butcher, J.; Li, J.; Elkadri, A.; Sherman, P.M.; Muise, A.M.; Stintzi, A.; Mack, D. Mucosa-Associated Ileal Microbiota in New-Onset Pediatric Crohn’s Disease. Inflamm. Bowel Dis. 2016, 22, 1533–1539. [Google Scholar] [CrossRef]
- Frank, D.N.; St Amand, A.L.; Feldman, R.A.; Boedeker, E.C.; Harpaz, N.; Pace, N.R. Molecular-phylogenetic characterization of microbial community imbalances in human inflammatory bowel diseases. Proc. Natl. Acad. Sci. USA 2007, 104, 13780–13785. [Google Scholar] [CrossRef]
- Gevers, D.; Kugathasan, S.; Denson, L.A.; Vazquez-Baeza, Y.; Van Treuren, W.; Ren, B.; Schwager, E.; Knights, D.; Song, S.J.; Yassour, M.; et al. The treatment-naive microbiome in new-onset Crohn’s disease. Cell Host Microbe 2014, 15, 382–392. [Google Scholar] [CrossRef]
- Lee, J.Y.; Tsolis, R.M.; Baumler, A.J. The microbiome and gut homeostasis. Science 2022, 377, eabp9960. [Google Scholar] [CrossRef] [PubMed]
- Eun, C.S.; Kwak, M.J.; Han, D.S.; Lee, A.R.; Park, D.I.; Yang, S.K.; Kim, Y.S.; Kim, J.F. Does the intestinal microbial community of Korean Crohn’s disease patients differ from that of western patients? BMC Gastroenterol. 2016, 16, 28. [Google Scholar] [CrossRef] [PubMed]
- Ou, Y.; Belzer, C.; Smidt, H.; de Weerth, C. Development of the gut microbiota in healthy children in the first ten years of life: Associations with internalizing and externalizing behavior. Gut Microbes 2022, 14, 2038853. [Google Scholar] [CrossRef]
- Hollister, E.B.; Riehle, K.; Luna, R.A.; Weidler, E.M.; Rubio-Gonzales, M.; Mistretta, T.A.; Raza, S.; Doddapaneni, H.V.; Metcalf, G.A.; Muzny, D.M.; et al. Structure and function of the healthy pre-adolescent pediatric gut microbiome. Microbiome 2015, 3, 36. [Google Scholar] [CrossRef] [PubMed]
- Zhong, H.; Penders, J.; Shi, Z.; Ren, H.; Cai, K.; Fang, C.; Ding, Q.; Thijs, C.; Blaak, E.E.; Stehouwer, C.D.A.; et al. Impact of early events and lifestyle on the gut microbiota and metabolic phenotypes in young school-age children. Microbiome 2019, 7, 2. [Google Scholar] [CrossRef]
- Orfei, M.; Gasparetto, M.; Hensel, K.O.; Zellweger, F.; Heuschkel, R.B.; Zilbauer, M. Guidance on the interpretation of faecal calprotectin levels in children. PLoS ONE 2021, 16, e0246091. [Google Scholar] [CrossRef]
- Lin, M.H.; Sugiyama, N.; Ishihama, Y. Systematic profiling of the bacterial phosphoproteome reveals bacterium-specific features of phosphorylation. Sci. Signal. 2015, 8, rs10. [Google Scholar] [CrossRef]
Target Group | Primer | Sequence (5′–3′) | Amplicon Size |
---|---|---|---|
Bacterial 16S rRNA | Bact-8F | AGAGTTTGATCCTGGCTCAG | 794 bp |
802R | TACNVGGGTATCTAATCC | ||
Bifidobacterium adolescentis | BIA-1 | GGAAAGATTCTATCGGTATGG | 244 bp |
BIA-2 | CTCCCAGTCAAAAGCGGTT | ||
Bifidobacterium longum | BIL-1 | GTTCCCGACGGTCGTAGAG | 153 bp |
BIL-2 | GTGAGTTCCCGGCATAATCC | ||
Eubacterium biforme | EBI-1 | GCTAAGGCCATGAACATGGA | 463 bp |
EBI-2 | GCCGTCCTCTTCTGTTCTC | ||
Eubacterium limosum | ELI-1 | GGCTTGCTGGACAAATACTG | 274 bp |
ELI-2 | CTAGGCTCGTCAGAAGGATG | ||
Faecalibacterium prausnitzii | FPR-1 | AGATGGCCTCGCGTCCGA | 199 bp |
FPR-2 | CCGAAGACCTTCTTCCTCC | ||
Peptostreptococcus productus | PSP-1 | AACTCCGGTGGTATCAGATG | 268 bp |
PSP-2 | GGGGCTTCTGAGTCAGGTA | ||
Lactobacillus acidophilus | LAA-1 | CATCCAGTGCAAACCTAAGAG | 286 bp |
LAA-2 | GATCCGCTTGCCTTCGCA | ||
Escherichia coli | ECO-1 | GACCTCGGTTTAGTTCACAGA | 585 bp |
ECO-2 | CACACGCTGACGCTGACCA | ||
Bacteroides thetaiotaomicron | BT-1 | GGCAGCATTTCAGTTTGCTTG | 423 bp |
BT-2 | GGTACATACAAAATTCCACACGT | ||
Bacteroides vulgatus | BV-1 | GCATCATGAGTCCGCATGTTC | 287 bp |
BV-2 | TCCATACCCGACTTTATTCCTT | ||
Parabacteroides distasonis | BD-1 | GTCGGACTAATACCGCATGAA | 273 bp |
BD-2 | TTACGATCCATAGAACCTTCAT | ||
Enterocloster clostridiiformis | CC-1 | CCGCATGGCAGTGTGTGAAA | 255 bp |
CC-2 | CTGCTGATAGAGCTTTACATA |
Probe | Sequence (5′–3′) | Target Group | Fluorescence |
---|---|---|---|
Eub338 | GCT GCC TCC CGT AGG AGT | most Bacteria (16S rRNA) | Cyanine 5 (Cy5) |
NonEub338 | ACT CCT ACG GGA GGC AGC | control probe complementary to EUB338 (16s rRNA)- Negative control | Cyanine 5 (Cy5) |
Bac303 | CCA ATG TGG GGG ACC TT | most Bacteroidaceae and Prevotellaceae, some Porphyromonadaceae (16S rRNA) | Cyanine 5 (Cy5) |
Bif164 | CAT CCG GCA TTA CCA CCC | Bifidobacterium spp. (16S rRNA) | Cyanine 5 (Cy5) |
Fprau645 | CCT CTG CAC TAC TCA AGA AAA AC | Faecalibacterium (Fusobacterium) prausnitzii and relatives (16S rRNA) | Cyanine 5 (Cy5) |
GAM42a | GCC TTC CCA CTT CGT TT | Gammaproteobacteria (23S rRNA) | Cyanine 5 (Cy5) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ulas, M.; Hussey, S.; Broderick, A.; Fitzpatrick, E.; Dunne, C.; Cooper, S.; Dominik, A.; Bourke, B. FISH–Flow Cytometry Reveals Microbiome-Wide Changes in Post-Translational Modification and Altered Microbial Abundance Among Children with Inflammatory Bowel Disease. Pathogens 2024, 13, 1102. https://doi.org/10.3390/pathogens13121102
Ulas M, Hussey S, Broderick A, Fitzpatrick E, Dunne C, Cooper S, Dominik A, Bourke B. FISH–Flow Cytometry Reveals Microbiome-Wide Changes in Post-Translational Modification and Altered Microbial Abundance Among Children with Inflammatory Bowel Disease. Pathogens. 2024; 13(12):1102. https://doi.org/10.3390/pathogens13121102
Chicago/Turabian StyleUlas, Mevlut, Seamus Hussey, Annemarie Broderick, Emer Fitzpatrick, Cara Dunne, Sarah Cooper, Anna Dominik, and Billy Bourke. 2024. "FISH–Flow Cytometry Reveals Microbiome-Wide Changes in Post-Translational Modification and Altered Microbial Abundance Among Children with Inflammatory Bowel Disease" Pathogens 13, no. 12: 1102. https://doi.org/10.3390/pathogens13121102
APA StyleUlas, M., Hussey, S., Broderick, A., Fitzpatrick, E., Dunne, C., Cooper, S., Dominik, A., & Bourke, B. (2024). FISH–Flow Cytometry Reveals Microbiome-Wide Changes in Post-Translational Modification and Altered Microbial Abundance Among Children with Inflammatory Bowel Disease. Pathogens, 13(12), 1102. https://doi.org/10.3390/pathogens13121102