Efficient Elimination of Viruses from Garlic Using a Combination of Shoot Meristem Culture, Thermotherapy, and Chemical Treatment
Abstract
:1. Introduction
2. Results
2.1. Treatments and Plant Regeneration
2.2. Virus Elimination
2.3. Absolute Quantification of Allexivirus
3. Discussion
4. Conclusions
5. Material and Methods
5.1. Plant Material and Treatments
5.2. Media Preparation and Clove Sterilization
5.3. Methodology of Treatments
5.4. RNA Isolation and Multiplex PCR Reaction
5.5. Real-Time qPCR Reaction
5.6. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Asemani, Y.; Zamani, N.; Bayat, M.; Amirghofran, Z. Allium vegetables for possible future of cancer treatment. Phytother. Res. 2019, 33, 3019–3039. [Google Scholar] [CrossRef]
- Fredotović, Ž.; Puizina, J. Edible Allium species: Chemical composition, biological activity and health effects. Ital. J. Food Sci. 2019, 31, 19–39. [Google Scholar]
- Lawande, K.E.; Khar, A.; Mahajan, V.; Srinivas, P.S.; Sankar, V.; Singh, R.P. Onion and garlic research in India. J. Hortic. Sci. 2009, 4, 91–119. [Google Scholar]
- Benke, A.P.; Krishna, R.; Mahajan, V.; Ansari, W.A.; Gupta, A.J.; Khar, A.; Shelke, P.; Thangasamy, A.; Shabeer, T.P.A.; Singh, M.; et al. Genetic diversity of Indian garlic core germplasm using agro-biochemical traits and SRAP markers. Saudi J. Biol. Sci. 2021, 28, 4833–4844. [Google Scholar] [CrossRef] [PubMed]
- Benke, A.P.; Nair, A.; Krishna, R.; Anandhan, S.; Mahajan, V.; Singh, M. Molecular screening of Indian garlic genotypes (Allium sativum L.) for bolting using DNA based Bltm markers. Veg. Sci. 2020, 47, 116–120. [Google Scholar]
- Kamenetsky, R.; Faigenboim, A.; Mayer, E.S.; Ben Michael, T.; Gershberg, C.; Kimhi, S.; Esquira, I.; Shalom, S.R.; Eshel, D.; Rabinowitch, H.D.; et al. Integrated transcriptome catalogue and organ-specific profiling of gene expression in fertile garlic (Allium sativum L.). BMC Genom. 2015, 16, 12. [Google Scholar] [CrossRef] [Green Version]
- Walkey, D.G.A.; Antill, D.N. Agronomic evaluation of virus-free and virus infected garlic (Allium sativum L.). J. Hortic. Sci. 1989, 64, 53–60. [Google Scholar] [CrossRef]
- Conci, V.C.; Lunello, P.; Buraschi, D.; Italia, R.R.; Nome, S.F. Variations of Leek yellow stripe virus concentration in garlic and its incidence in Argentina. Plant Dis. 2002, 86, 1085–1088. [Google Scholar] [CrossRef] [Green Version]
- Abraham, A.D.; Kidanemariam, D.B.; Holton, T.A. Molecular identification, incidence and phylogenetic analysis of seven viruses infecting garlic in Ethiopia. Eur. J. Plant Pathol. 2019, 155, 181–191. [Google Scholar] [CrossRef] [Green Version]
- Bereda, M.; Paduch-Cichal, E.; Dabrowska, E. Occurrence and phylogenetic analysis of Allexiviruses identified on garlic from China, Spain and Poland commercially available on the polish retail market. Eur. J. Plant Pathol. 2017, 149, 227–237. [Google Scholar] [CrossRef] [Green Version]
- Mituti, T.; Moura, M.F.; Marubayashi, J.M.; Oliveira, M.L.; Imaizumi, V.M.; Sakate, R.K.; Pavan, M.A. Survey of viruses belonging to different genera and species in noble garlic in Brazil. Sci. Agric. 2015, 72, 278–281. [Google Scholar] [CrossRef] [Green Version]
- Wylie, S.J.; Li, H.; Saqib, M.; Jones, M.G. The global trade in fresh produce and the vagility of plant viruses: A case study in garlic. PLoS ONE 2014, 9, e105044. [Google Scholar] [CrossRef] [Green Version]
- Cafrune, E.E.; Perotto, M.C.; Conci, V.C. Effect of two Allexivirus isolates on garlic yield. Plant Dis. 2006, 90, 898–904. [Google Scholar] [CrossRef] [PubMed]
- Pramesh, D.; Baranwal, V.K. Production of virus-free garlic (Allium sativum L.) through meristem tip culture after solar or hot air treatment of cloves. J. Hortic. Sci. Biotechnol. 2015, 90, 180–186. [Google Scholar] [CrossRef]
- Majumder, A.; Baranwal, V.K. Simultaneous detection of four garlic viruses by multiplex reverse transcription PCR and their distribution in Indian garlic accessions. J. Virol. Methods 2014, 202, 34–38. [Google Scholar] [CrossRef]
- Conci, V.C.; Canavelli, A.; Lunello, P.; Di Rienzo, J.; Nome, S.F.; Zumelzu, G.; Italia, R. Yield losses associated with virus-infected garlic plants during five successive years. Plant Dis. 2003, 87, 1411–1415. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Perotto, M.C.; Cafrune, E.E.; Conci, V.C. The effect of additional viral infections on garlic plants initially infected with Allexiviruses. Eur. J. Plant Pathol. 2010, 126, 489–495. [Google Scholar] [CrossRef]
- Ghosh, D.K.; Ahlawat, Y.S. Filamentous viruses associated with mosaic disease of garlic in India. Indian Phytopathol. 1997, 50, 266–276. [Google Scholar]
- Majumder, S.; Baranwal, V.K. First report of Garlic common latent virus in garlic from India. Plant Dis. 2009, 93, 106. [Google Scholar] [CrossRef] [PubMed]
- Gawande, S.J.; Khar, A.; Lawande, K.E. First report of Iris yellow spot virus on garlic in India. Plant Dis. 2010, 94, 1066. [Google Scholar] [CrossRef] [PubMed]
- Baranwal, V.K.; Singh, P.; Jain, R.K.; Joshi, S. First report of Garlic virus X infecting garlic in India. Plant Dis. 2011, 95, 1197. [Google Scholar] [CrossRef]
- Gupta, N.; Prabha, K.; Islam, S.; Baranwal, V.K. First report of Leek yellow stripe virus in garlic from India. J. Plant Pathol. 2013, 95, 4–75. [Google Scholar] [CrossRef]
- Khan, I.; Sharma, A.; Dhatt, A.S.; Kang, S.S.; Kaur, G. First report of Garlic virus D infecting onion in India. J. Plant Pathol. 2015, 97, 69. [Google Scholar] [CrossRef]
- Gawande, S.J.; Gurav, V.S.; Ingle, A.A.; Gopal, J. First report of Garlic virus A in garlic from India. Plant Dis. 2015, 99, 1288. [Google Scholar] [CrossRef]
- Roylawar, P.B.; Khandagale, K.S.; Gawai, T.; Gawande, S.J.; Singh, M. First report of garlic virus C infecting garlic in India. Plant Dis. 2019, 103, 1439. [Google Scholar] [CrossRef]
- Roylawar, P.B.; Khandagale, K.S.; Randive, P.M.; Atre, G.E.; Gawande, S.J.; Singh, M. First Report of Garlic Virus B Infecting Garlic in India. Plant Dis. 2021, 105, 1232. [Google Scholar] [CrossRef]
- Ibrahim, A.S.; Magdy, A.; El-Kosary, S.; Hamed, A. In Vitro Eradication of Banana Bunchy Top Virus from Natural Infected Grandnan Banana by Using Chemotherapy. Plant Arch. 2019, 19, 1146–1150. [Google Scholar]
- Wang, M.R.; Hamborg, Z.; Blystad, D.R.; Wang, Q.C. Combining thermotherapy with meristem culture for improved eradication of Onion yellow dwarf virus and shallot latent virus from infected in vitro-cultured shallot shoots. Ann. Appl. Biol. 2020, 178, 142–149. [Google Scholar] [CrossRef]
- Bhojwani, S.S.; Cohen, D.; Fry, P.F. Production of virus-free garlic and field performance of micro propagate plants. Sci. Hortic. 1982, 18, 39–43. [Google Scholar] [CrossRef]
- Conci, V.C.; Nome, S.F. Virus-free garlic (Allium sativum L.) plants obtained by thermotherapy and meristem tip culture. J. Phytopathol. 1991, 132, 186–192. [Google Scholar] [CrossRef]
- Ma, Y.; Wang, H.I.; Zhang, C.J.; Kang, Y.Q. High rate of virus-free plantlet regeneration via garlic scape-tip culture. Plant Cell Rep. 1994, 14, 65–68. [Google Scholar] [CrossRef]
- Ucman, R.; Zel, J.; Ravnikar, M. Thermotherapy in virus elimination from garlic: Influence on shoot multiplication from meristems and bulb formation in vitro. Sci. Hortic. 1998, 73, 193–202. [Google Scholar]
- Verbeek, M.; van Dijk, P.; van Well, P.M. Efficiency of eradication of four viruses from garlic (Allium sativum) by meristem-tip culture. Eur. J. Plant Pathol. 1995, 101, 231–239. [Google Scholar] [CrossRef]
- Haque, M.S.; Hattori, K.; Suzuki, A.; Tsuneyoshi, T. An efficient novel method of producing virus-free plants from garlic root meristem. In Biotechnology and Sustainable Agriculture 2006 and Beyond, Proceedings of the 11th IAPTC&B Congress, Beijing, China, 13–18 August 2006; Volume 2, pp. 107–110. Available online: https://link.springer.com/chapter/10.1007/978-1-4020-6635-1_11 (accessed on 26 November 2022). [CrossRef]
- Kim, H.H.; Lee, J.K.; Hwang, H.S.; Engelmann, F. Cryopreservation of garlic germplasm collections using the droplet-vitrification technique. Cryo Lett. 2007, 28, 471–482. [Google Scholar]
- Shiboleth, Y.M. Molecular Diagnosis of Garlic (Allium sativum L.) Viruses in Israel and Evaluation of Tissue Culture Methods for Their Elimination. Master’s Thesis, The Hebrew University of Jerusalem, Faculty of Agricultural, Food and Environmental Sciences, Jerusalem, Israel, 1998. [Google Scholar]
- Senula, A.; Keller, E.R.J.; Leseman, D.E. Elimination of Viruses through Meristem Culture and Thermotherapy for the Establishment of an In Vitro Collection of Garlic (Allium sativum). In International Symposium on Methods and Markers for Quality Assurance in Micropropagation; ISHS Acta Horticulturae: White River, South Africa, 1999; Volume 530, pp. 121–128. [Google Scholar]
- Pateña, L.; Dolores, L.; Bariring, A.; Alcachupas, A.; Laude, N.; Barg, E.; Green, S.; Barba, R. Improved technique for virus elimination in and production of certified planting materials of garlic (Allium sativum L.). Acta Hortic. 2004, 694, 271–276. [Google Scholar] [CrossRef]
- Vieira, R.L.; da Silva, A.L.; Zaffari, G.R.; Steinmacher, D.A.; de Freitas Fraga, H.P.; Guerra, M.P. Efficient elimination of virus complex from garlic (Allium sativum L.) by cryotherapy of shoot tips. Acta. Physiol. Plant 2015, 37, 1733. [Google Scholar] [CrossRef]
- Vivek, M.; Modgil, M. Elimination of viruses through thermotherapy and meristem culture in apple cultivar ‘Oregon Spur-II’. Virus Dis. 2018, 29, 75–82. [Google Scholar] [CrossRef]
- Nakabonge, G.; Nangonzi, R.; Tumwebaze, B.S.; Kazibwe, A.; Samukoya, C.; Baguma, Y. Production of virus-free cassava through hot water therapy and two rounds of meristem tip culture. Cogent Food Agric. 2020, 6, 1800923. [Google Scholar] [CrossRef]
- Dĩaz-Barrita, A.J.; Norton, M.; Martĩnez-Peniche, R.A.; Uchanski, M.; Mulwa, R.; Skirvin, R.M. The use of thermotherapy and in vitro meristem culture to produce virus-free’ chancellor’grapevines. Int. J. Fruit Sci. 2008, 7, 15–25. [Google Scholar] [CrossRef]
- Zhang, Z.; Wang, Q.C.; Spetz, C.; Blystad, D.R. In vitro therapies for virus elimination of potato-valuable germplasm in Norway. Sci. Hortic. 2019, 249, 7–14. [Google Scholar] [CrossRef]
- Buko, D.H.; Spetz, C.; Hvoslef-Eide, A.K. Next generation sequencing as a method to verify virus elimination using heat treatment and meristem tip culture in the five most widely used sweet potato varieties in Ethiopia. Afr. J. Biotech. 2020, 19, 458–463. [Google Scholar]
- Kritzman, A.; Lampel, M.; Raccah, B.; Gera, A. Distribution and transmission of Iris yellow spot virus. Plant Dis. 2001, 85, 838–842. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jemal, N.; Feyissa, T. Production of Virus Free Sweet Potato (Ipomoea batatas (L.) Lam.) through Meristem Culture and Chemotherapy. Ethiop. J. Sci. 2020. [Google Scholar] [CrossRef]
- Yulianingsih, R.; Hidayat, S.H.; Dinarti, D. Elimination of Garlic common latent virus from garlic through meristem culture and thermotherapy. IOP Conf. Ser. Earth Environ. Sci. 2020, 468, 012028. [Google Scholar] [CrossRef]
- Kereša, S.; Kurtović, K.; Ban, S.G.; Vončina, D.; Jerčić, I.H.; Bolarić, S.; Lazarević, B.; Godena, S.; Ban, D.; Mihovilović, A.B. Production of virus-free garlic plants through somatic embryogenesis. Agronomy 2021, 11, 876. [Google Scholar] [CrossRef]
- Abel, D. Comparison of Meristem Culture and Heat Therapy to Clean Garlic (Allium sativum L.) Infecting Virus in Ethiopia. Ethiop. J. Agric. Sci. 2017, 27, 1–8. [Google Scholar]
- Walkey, D.G.A.; Webb, M.J.W.; Bolland, C.J.; Miller, A. Production of virus-free garlic (Allium sativum L.) and shallot (A. ascalonicum L.) by meristem-tip culture. J. Hortic. Sci. 1887, 62, 211–220. [Google Scholar] [CrossRef]
- Ramírez-Malagón, R.; Pérez-Moreno, L.; Borodanenko, A.; Salinas-González, G.J.; Ochoa-Alejo, N. Differential organ infection studies, potyvirus elimination, and field performance of virus-free garlic plants produced by tissue culture. Plant Cell Tissue Organ Cult. 2006, 86, 103–110. [Google Scholar] [CrossRef]
- Ghaemizadeh, F.; Dashti, F.; Khodakaramian, G.; Sarikhani, H. Combination of stem-disc dome culture and thermotherapy to eliminate Allexiviruses and Onion yellow dwarf virus from garlic (Allium sativum cv. Hamedan). Arc. Phytopathol. Plant Protect. 2014, 47, 499–507. [Google Scholar] [CrossRef]
- Conci, V.C.; Perotto, M.C.; Cafrune, E.; Lunello, P. Program for intensive production of virus-free garlic plants. In Proceedings of the IV International Symposium on Edible Alliaceae; 2004; Volume 688, pp. 195–200. Available online: https://www.researchgate.net/publication/259575669_Program_for_Intensive_Production_of_Virus-Free_Garlic_Plants (accessed on 26 November 2022).
- Mekuria, G.; Ramesh, S.A.; Alberts, E.; Bertozzi, T.; Wirthensohn, M.; Collins, G.; Sedgley, M. Comparison of ELISA and RT-PCR for the detection of Prunus necrotic ring spot virus and prune dwarf virus in almond (Prunus dulcis). J. Virol. Methods 2003, 114, 65–69. [Google Scholar] [CrossRef]
- Putri, P.H.; Hidayat, S.H.; Dinarti, D. Elimination of Potyvirus and Carlavirus from Infected shallot bulbs. J. Appl. Hortic. 2019, 21, 42–46. [Google Scholar] [CrossRef]
- Cassells, A.C. In Vitro Induction of Virus-Free Potatoes by Chemotherapy. In Potato; Springer: Berlin/Heidelberg, Germany, 1987; pp. 40–50. [Google Scholar]
- AlMaarri, K.; Massa, R.; AlBiski, F. Evaluation of some therapies and meristem culture to eliminate Potato Y potyvirus from infected potato plants. Plant Biotech. 2012, 29, 237–243. [Google Scholar] [CrossRef] [Green Version]
- Dawson, W.O.; Lozoya-Saldana, H. Examination of the mode of action of ribavirin against tobacco mosaic virus. Intervirology 1984, 22, 77–84. [Google Scholar] [CrossRef] [PubMed]
- Lerch, B. On the inhibition of plant virus multiplication by ribavirin. Antivir. Res. 1987, 7, 257–270. [Google Scholar] [CrossRef] [PubMed]
- Hu, G.; Dong, Y.; Zhang, Z.; Fan, X.; Ren, F.; Zhou, J. Virus elimination from in vitro apple by thermotherapy combined with chemotherapy. Plant Cell Tissue Organ Cult. 2015, 121, 435–443. [Google Scholar] [CrossRef]
- Murashige, T.; Skoog, F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol. Plant 1962, 15, 473–497. [Google Scholar] [CrossRef]
- Gamborg, O.L.; Miller, R.; Ojima, K. Nutrient requirements of suspension cultures of soybean root cells. Exp. Cell Res. 1968, 50, 151–158. [Google Scholar] [CrossRef]
- Benke, A.P.; Shelke, P.; Mahajan, V. Three step protocol for regeneration of plantlets in Indian garlic varieties using root meristem. Indian J. Agric. Res. 2018, 52, 66–70. [Google Scholar] [CrossRef]
- Dovas, C.I.; Hatziloukas, E.; Salomon, R.; Barg, E.; Shiboleth, Y.; Katis, N.I. Comparison of methods for virus detection in Allium spp. J. Phytopathol. 2001, 149, 731–737. [Google Scholar] [CrossRef]
- Shafiq, M.; Iqbal, Z.; Ali, I.; Abbas, Q.; Mansoor, S.; Briddon, R.W.; Amin, I. Real-time quantitative PCR assay for the quantification of virus and satellites causing leaf curl disease in cotton in Pakistan. J. Virol. Methods 2017, 248, 54–60. [Google Scholar] [CrossRef]
Treatments | Code | Plant Regeneration Percent | Plant Growth | Percentage of Virus-Free Plants | ||||
---|---|---|---|---|---|---|---|---|
Control | Treatment | GCLV | SLV | OYDV | Allexi | |||
Shoot meristem culture | SMC | 93.0 ± 3.2 b | 93.0 ± 2.7 b | Good | 66.0 ± 2.2 d | 55.0 ± 1.68 d | 13.0 ± 0.3 e | 0 |
Thermotherapy direct culture | TDC | 100 ± 0 a | 98.9 ± 1.0 a | Good | 80.0 ± 0.6 c | 63.0 ± 2.1 c | 18.0 ± 0.5 d | 0 |
Chemotherapy direct culture | CDC | 100 ± 0 a | 95.0 ± 1.8 ab | Average | 65.0 ± 2.1 d | 55.0 ± 1.8 d | 35.0 ± 0.8 c | 0 |
Chemotherapy + meristem culture | CMC | 93.0 ± 1.8 b | 87.0 ± 3.6 c | Poor | 85.0 ± 0.1 b | 65.0 ± 2.3 c | 50.0 ± 1.2 b | 0 |
Thermotherapy + meristem culture | TMC | 93.0 ± 2.1 b | 91.7 ± 3.1 b | Average | 85.0 ± 0.2 b | 85.0 ± 3.2 b | 20.0 ± 0.6 d | 0 |
Thermotherapy + chemotherapy direct culture | TCDC | 100 ± 0 a | 96.4 ± 1.6 a | Average | 100 ± 0 a | 66.0 ± 2.2 c | 100 ± 0 a | 0 |
Thermotherapy + chemotherapy + meristem culture | TCMC | 92.5 ± 3.3 b | 66.0 ± 2.0 d | Poor | 100 ± 0 a | 100 ± 0 a | 100 ± 0 a | 0 |
Name of Primer | Primer Sequences (5′-3′) | Genome Location | Gene/ Reference | Annealing Temperature | Amplicon Size |
---|---|---|---|---|---|
SLV-F | AAACCTTTTGGTTCACTTTAGG | 7040 | JF320811 [14] | 57 | 650 |
SLV NABP-R | AAYAACATCTAATTCCA | 7693 | 46 | ||
GCLVNABCP-F | AAATGTTAATCGCTAAACGACC | 7854 | JF320810 [14] | 60 | 586 |
GCLVNABCP-R | CTTTGTGGATTTTCGGTAAG | 8458 | 56 | ||
OYDV-F | GAAGCACAYATGCAATGAAGG | 10,168 | NC005029 [14] | 59 | 293 |
OYDV-R | GCCACAACTAGTGGTACACACCAC | 10,451 | 64 | ||
Allexivirus-F | CYGCTAAGCTATATGCTGAARGG | 8623 | MN059428 [64] | 62 | 200 |
Allexivirus-R | TGTTRCAARGTAAGTTTAGYAATATCAACA | 8813 | 60 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Benke, A.P.; Krishna, R.; Khandagale, K.; Gawande, S.; Shelke, P.; Dukare, S.; Dhumal, S.; Singh, M.; Mahajan, V. Efficient Elimination of Viruses from Garlic Using a Combination of Shoot Meristem Culture, Thermotherapy, and Chemical Treatment. Pathogens 2023, 12, 129. https://doi.org/10.3390/pathogens12010129
Benke AP, Krishna R, Khandagale K, Gawande S, Shelke P, Dukare S, Dhumal S, Singh M, Mahajan V. Efficient Elimination of Viruses from Garlic Using a Combination of Shoot Meristem Culture, Thermotherapy, and Chemical Treatment. Pathogens. 2023; 12(1):129. https://doi.org/10.3390/pathogens12010129
Chicago/Turabian StyleBenke, Ashwini Prashant, Ram Krishna, Kiran Khandagale, Suresh Gawande, Poonam Shelke, Somnath Dukare, Sweta Dhumal, Major Singh, and Vijay Mahajan. 2023. "Efficient Elimination of Viruses from Garlic Using a Combination of Shoot Meristem Culture, Thermotherapy, and Chemical Treatment" Pathogens 12, no. 1: 129. https://doi.org/10.3390/pathogens12010129
APA StyleBenke, A. P., Krishna, R., Khandagale, K., Gawande, S., Shelke, P., Dukare, S., Dhumal, S., Singh, M., & Mahajan, V. (2023). Efficient Elimination of Viruses from Garlic Using a Combination of Shoot Meristem Culture, Thermotherapy, and Chemical Treatment. Pathogens, 12(1), 129. https://doi.org/10.3390/pathogens12010129