Effects of Elevated Temperature on the Susceptibility of Capsicum Plants to Capsicum Chlorosis Virus Infection
Abstract
:1. Introduction
2. Results
2.1. Effect of Elevated Temperature on CaCV Infection in Susceptible Capsicum Plants
2.2. Effect of Elevated Temperature on CaCV RNA and vsiRNA Accumulation in Capsicum Plants
2.3. Differential Expression of RNAi-Associated Genes in the Capsicum Response to CaCV Infection at High and Ambient Temperature
2.4. RdRp1 Is Involved in N. Benthamiana tolerance to CaCV Infection at High and Ambient Temperatures
2.5. Differential Expression of Resistance-Associated Genes in Capsicum Response to CaCV Infection at High and Ambient Temperatures
3. Discussion
4. Materials and Methods
4.1. Plant and Virus Materials, Growth Conditions, and High Temperature Treatment
4.2. Symptom Severity Rating of CaCV-Infected Capsicum Plants
4.3. RNA Extraction and cDNA Synthesis
4.4. Plasmid and Standard Curve Construction
4.5. RT-qPCR for the Absolute Quantification of Viral RNA
4.6. RT-qPCR for Gene Expression Analysis
4.7. Northern Blot Hybridization for Detecting Virus-Derived siRNAs
4.8. Statistics
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Mbow, C.; Rosenzweig, C.; Barioni, L.G.; Benton, T.G.; Herrero, M.; Krishnapillai, M.; Liwenga, E.; Pradhan, P.; Rivera-Ferre, M.G.; Sapkota, T.; et al. Food security. In Climate Change and Land: An IPCC Special Report on Climate Change, Desertification, Land Degradation, Sustainable Land Management, Food Security, and Greenhouse Gas Fluxes in Terrestrial Ecosystems; Shukla, P.R., Skea, J., Calvo Buendia, E., Masson-Delmotte, V., Pörtner, H.-O., Roberts, D.C., Zhai, P., Slade, R., Connors, S., van Diemen, R., et al., Eds.; IPCC, 2019; Available online: https://www.ipcc.ch/site/assets/uploads/sites/4/2020/05/Chapter-5_FINAL-1.pdf (accessed on 5 March 2021).
- Wahid, A.; Gelani, S.; Ashraf, M.; Foolad, M.R. Heat tolerance in plants: An overview. Environ. Exp. Bot. 2007, 61, 199–223. [Google Scholar] [CrossRef]
- Mittler, R.; Finka, A.; Goloubinoff, P. How do plants feel the heat? Trends Biochem. Sci. 2012, 37, 118–125. [Google Scholar] [CrossRef]
- Hatfield, J.L.; Prueger, J.H. Temperature extremes: Effect on plant growth and development. Weather Clim. Extrem. 2015, 10, 4–10. [Google Scholar] [CrossRef] [Green Version]
- Ofir, M.; Gross, Y.; Bangerth, F.; Kigel, J. High temperature effects on pod and seed production as related to hormone levels and abscission of reproductive structures in common bean (Phaseolus vulgaris L.). Sci. Hortic. 1993, 55, 201–211. [Google Scholar] [CrossRef]
- Warrag, M.O.A.; Hall, A.E. Reproductive responses of cowpea (Vigna unguiculata (L.) Walp.) to heat stress. II. Responses to night air temperature. Field Crops Res. 1984, 8, 17–33. [Google Scholar] [CrossRef]
- Schoper, J.B.; Lambert, R.J.; Vasilas, B.L.; Westgate, M.E. Plant factors controlling seed set in maize: The influence of silk, pollen, and ear-leaf water status and tassel heat treatment at pollination. Plant Physiol. 1987, 83, 121–125. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sato, S.; Peet, M.M.; Thomas, J.F. Physiological factors limit fruit set of tomato (Lycopersicon esculentum Mill.) under chronic, mild heat stress. Plant Cell Environ. 2000, 23, 719–726. [Google Scholar] [CrossRef]
- Cochran, H.L. Some factors influencing fruit setting in the pepper (Capsicum frutescens L.). Mem. Cornell Agric. Exp. Stn. 1936, 190, 1–39. [Google Scholar]
- Rylski, I.; Spigelman, M. Effects of different diurnal temperature combinations on fruit set of sweet pepper. Sci. Hortic. 1982, 17, 101–106. [Google Scholar] [CrossRef]
- Erickson, A.N.; Markhart, A.H. Flower developmental stage and organ sensitivity of bell pepper (Capsicum annuum L.) to elevated temperature. Plant Cell Environ. 2002, 25, 123–130. [Google Scholar] [CrossRef]
- Grulke, N.E. The nexus of host and pathogen phenology: Understanding the disease triangle with climate change. New Phytol. 2011, 189, 8–11. [Google Scholar] [CrossRef] [PubMed]
- DeLucia, E.H.; Nabity, P.D.; Zavala, J.A.; Berenbaum, M.R. Climate change: Resetting plant-insect interactions. Plant Physiol. 2012, 160, 1677–1685. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sun, S.; Lian, S.; Feng, S.; Dong, X.; Wang, C.; Li, B.; Liang, W. Effects of temperature and moisture on sporulation and infection by Pseudoperonospora cubensis. Plant Dis. 2017, 101, 562–567. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jeger, M.J.; Madden, L.V.; van den Bosch, F. Plant virus epidemiology: Applications and prospects for mathematical modeling and analysis to improve understanding and disease control. Plant Dis. 2018, 102, 837–854. [Google Scholar] [CrossRef] [Green Version]
- Morales, G.; Moragrega, C.; Montesinos, E.; Llorente, I. Effects of leaf wetness duration and temperature on infection of Prunus by Xanthomonas arboricola pv. pruni. PLoS ONE 2018, 13, e0193813. [Google Scholar] [CrossRef]
- Jones, R.A.C.; Naidu, R.A. Global dimensions of plant virus diseases: Current status and future perspectives. Annu. Rev. Virol. 2019, 6, 387–409. [Google Scholar] [CrossRef]
- Jones, R.A.C. Future scenarios for plant virus pathogens as climate change progresses. Adv. Virus Res. 2016, 95, 87–147. [Google Scholar] [CrossRef]
- Jones, R.A.C. Plant virus ecology and epidemiology: Historical perspectives, recent progress and future prospects. Ann. Appl. Biol. 2014, 164, 320–347. [Google Scholar] [CrossRef]
- Jones, R.A.C. Plant virus emergence and evolution: Origins, new encounter scenarios, factors driving emergence, effects of changing world conditions, and prospects for control. Virus Res. 2009, 141, 113–130. [Google Scholar] [CrossRef]
- Persley, D.M.; Thomas, J.E.; Sharman, M. Tospoviruses—An Australian perspective. Australas. Plant Pathol. 2006, 35, 161–180. [Google Scholar] [CrossRef]
- Premachandra, W.T.S.D.; Borgemeister, C.; Maiss, E.; Knierim, D.; Poehling, H.M. Ceratothripoides claratris, a new vector of a capsicum chlorosis virus isolate infecting tomato in Thailand. Phytopathology 2005, 95, 659–663. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Widana Gamage, S.M.K.; McGrath, D.J.; Persley, D.M.; Dietzgen, R.G. Transcriptome analysis of Capsicum chlorosis virus-induced hypersensitive resistance response in bell capsicum. PLoS ONE 2016, 11, e0159085. [Google Scholar] [CrossRef]
- Oliver, J.E.; Whitfield, A.E. The genus tospovirus: Emerging bunyaviruses that threaten food security. Annu. Rev. Virol. 2016, 3, 101–124. [Google Scholar] [CrossRef] [PubMed]
- McMichael, L.A.; Persley, D.M.; Thomas, J.E. A new Tospovirus serogroup IV species infecting capsicum and tomato in Queensland, Australia. Australas. Plant Pathol. 2002, 31, 231–239. [Google Scholar] [CrossRef]
- Widana Gamage, S.; Persley, D.M.; Higgins, C.M.; Dietzgen, R.G. First complete genome sequence of a capsicum chlorosis Tospovirus isolate from Australia with an unusually large S RNA intergenic region. Arch. Virol. 2015, 160, 869–872. [Google Scholar] [CrossRef]
- Qu, F.; Ye, X.; Hou, G.; Sato, S.; Clemente, T.E.; Morris, T.J. RDR6 has a broad-spectrum but temperature-dependent antiviral defense role in Nicotiana benthamiana. J. Virol. 2005, 79, 15209–15217. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Szittya, G.; Silhavy, D.; Molnár, A.; Havelda, Z.; Lovas, A.; Lakatos, L.; Bánfalvi, Z.; Burgyán, J. Low temperature inhibits RNA silencing-mediated defence by the control of siRNA generation. EMBO J. 2003, 22, 633–640. [Google Scholar] [CrossRef] [Green Version]
- Zhang, X.; Zhang, X.; Singh, J.; Li, D.; Qu, F. Temperature-dependent survival of Turnip crinkle virus-infected arabidopsis plants relies on an RNA silencing-based defense that requires DCL2, AGO2, and HEN1. J. Virol. 2012, 86, 6847–6854. [Google Scholar] [CrossRef] [Green Version]
- Ghoshal, B.; Sanfacon, H. Temperature-dependent symptom recovery in Nicotiana benthamiana plants infected with tomato ringspot virus is associated with reduced translation of viral RNA2 and requires ARGONAUTE 1. Virology 2014, 456–457, 188–197. [Google Scholar] [CrossRef] [Green Version]
- Siddiqui, S.; Sarmiento, C.; Kiisma, M.; Koivumäki, S.; Lemmetty, A.; Truve, E.; Lehto, K. Effects of viral silencing suppressors on tobacco ringspot virus infection in two Nicotiana species. J. Gen. Virol. 2008, 89, 1502–1508. [Google Scholar] [CrossRef]
- Zhao, F.; Li, Y.; Chen, L.; Zhu, L.; Ren, H.; Lin, H.; Xi, D. Temperature dependent defence of Nicotiana tabacum against cucumber mosaic virus and recovery occurs with the formation of dark green islands. J. Plant Biol. 2016, 59, 293–301. [Google Scholar] [CrossRef]
- Velázquez, K.; Renovell, A.; Comellas, M.; Serra, P.; García, M.L.; Pina, J.A.; Navarro, L.; Moreno, P.; Guerri, J. Effect of temperature on RNA silencing of a negative-stranded RNA plant virus: Citrus psorosis virus. Plant Pathol. 2010, 59, 982–990. [Google Scholar] [CrossRef] [Green Version]
- Chellappan, P.; Vanitharani, R.; Ogbe, F.; Fauquet, C.M. Effect of temperature on geminivirus-induced RNA silencing in plants. Plant Physiol. 2005, 138, 1828–1841. [Google Scholar] [CrossRef] [Green Version]
- Makarova, S.; Makhotenko, A.; Spechenkova, N.; Love, A.J.; Kalinina, N.O.; Taliansky, M. Interactive responses of potato (Solanum tuberosum L.) plants to heat stress and infection with potato virus Y. Front. Microbiol. 2018, 9, 2582. [Google Scholar] [CrossRef] [Green Version]
- Anfoka, G.; Moshe, A.; Fridman, L.; Amrani, L.; Rotem, O.; Kolot, M.; Zeidan, M.; Czosnek, H.; Gorovits, R. Tomato yellow leaf curl virus infection mitigates the heat stress response of plants grown at high temperatures. Sci. Rep. 2016, 6, 19715. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Prasch, C.M.; Sonnewald, U. Simultaneous application of heat, drought, and virus to Arabidopsis plants reveals significant shifts in signaling networks. Plant Physiol. 2013, 162, 1849–1866. [Google Scholar] [CrossRef] [PubMed]
- Ghoshal, B.; Sanfacon, H. Symptom recovery in virus-infected plants: Revisiting the role of RNA silencing mechanisms. Virology 2015, 479–480, 167–179. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fulton, R.W. Pioneer Leaders in Plant Pathology: James Johnson. Annu. Rev. Phytopathol. 1984, 22, 27–34. [Google Scholar] [CrossRef]
- Johnson, J. The relation of air temperatures to certain plant diseases. Phytopathology 1921, 11, 446–458. [Google Scholar]
- Hildebrand, E.M. Masked virus infection in plants. Annu. Rev. Microbiol. 1958, 12, 441–468. [Google Scholar] [CrossRef]
- Vaucheret, H. Post-transcriptional small RNA pathways in plants: Mechanisms and regulations. Genes Dev. 2006, 20, 759–771. [Google Scholar] [CrossRef] [Green Version]
- Ding, S.W.; Voinnet, O. Antiviral immunity directed by small RNAs. Cell 2007, 130, 413–426. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Moon, J.Y.; Park, J.M. Cross-talk in viral defense signaling in plants. Front. Microbiol. 2016, 7, 2068. [Google Scholar] [CrossRef] [Green Version]
- Qin, C.; Li, B.; Fan, Y.; Zhang, X.; Yu, Z.; Ryabov, E.; Zhao, M.; Wang, H.; Shi, N.; Zhang, P.; et al. Roles of dicer-like proteins 2 and 4 in intra- and intercellular antiviral silencing. Plant Physiol. 2017, 174, 1067. [Google Scholar] [CrossRef] [PubMed]
- Mlotshwa, S.; Pruss, G.J.; Vance, V. Small RNAs in viral infection and host defense. Trends Plant Sci. 2008, 13, 375–382. [Google Scholar] [CrossRef] [PubMed]
- Mallory, A.; Vaucheret, H. Form, function, and regulation of ARGONAUTE proteins. Plant Cell 2010, 22, 3879–3889. [Google Scholar] [CrossRef]
- Muhammad, T.; Zhang, F.; Zhang, Y.; Liang, Y. RNA Interference: A natural immune system of plants to counteract biotic stressors. Cells 2019, 8, 38. [Google Scholar] [CrossRef] [Green Version]
- Obrepalska-Steplowska, A.; Renaut, J.; Planchon, S.; Przybylska, A.; Wieczorek, P.; Barylski, J.; Palukaitis, P. Effect of temperature on the pathogenesis, accumulation of viral and satellite RNAs and on plant proteome in peanut stunt virus and satellite RNA-infected plants. Front. Plant Sci. 2015, 6, 903. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Love, A.J.; Yun, B.W.; Laval, V.; Loake, G.J.; Milner, J.J. Cauliflower mosaic virus, a compatible pathogen of arabidopsis, engages three distinct defense-signaling pathways and activates rapid systemic generation of reactive oxygen species. Plant Physiol. 2005, 139, 935–948. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vlot, A.C.; Dempsey, D.A.; Klessig, D.F. Salicylic acid, a multifaceted hormone to combat disease. Annu. Rev. Phytopathol. 2009, 47, 177–206. [Google Scholar] [CrossRef] [Green Version]
- Alamillo, J.M.; Saénz, P.; García, J.A. Salicylic acid-mediated and RNA-silencing defense mechanisms cooperate in the restriction of systemic spread of plum pox virus in tobacco. Plant J. 2006, 48, 217–227. [Google Scholar] [CrossRef]
- Qi, G.; Chen, J.; Chang, M.; Chen, H.; Hall, K.; Korin, J.; Liu, F.; Wang, D.; Fu, Z.Q. Pandemonium breaks out: Disruption of salicylic acid-mediated defense by plant pathogens. Mol. Plant 2018, 11, 1427–1439. [Google Scholar] [CrossRef] [Green Version]
- Llamas-Llamas, M.E.; Zavaleta-Mejia, E.; Gonzalez-Hernandez, V.A.; Cervantes-Diaz, L.; Santizo-Rincon, J.A.; Ochoa-Martinez, D.L. Effect of temperature on symptom expression and accumulation of tomato spotted wilt virus in different host species. Plant Pathol. 1998, 47, 341–347. [Google Scholar] [CrossRef]
- Goodman, N.R.; Kirali, Z.; Wood, K.R. The Biochemistry and Physiology of Plant Disease; University of Missouri Press: Columbia, MO, USA, 1986. [Google Scholar]
- Singh, A.; Permar, V.; Basavaraj, A.; Bhoopal, S.T.; Praveen, S. Effect of temperature on symptoms expression and viral RNA accumulation in groundnut bud necrosis virus infected Vigna unguiculata. Iran. J. Biotechnol. 2018, 16, 227–234. [Google Scholar] [CrossRef]
- Roggero, P.; Dellavalle, G.; Ciuffo, M.; Pennazio, S. Effects of temperature on infection in Capsicum sp. and Nicotiana benthamiana by Impatiens necrotic spot tospovirus. Eur. J. Plant Pathol. 1999, 105, 509–512. [Google Scholar] [CrossRef]
- Qin, L.; Mo, N.; Zhang, Y.; Muhammad, T.; Zhao, G.; Zhang, Y.; Liang, Y. CaRDR1, an RNA-dependent RNA polymerase plays a positive role in pepper resistance against TMV. Front. Plant Sci. 2017, 8, 1068. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bally, J.; Nakasugi, K.; Jia, F.; Jung, H.; Ho, S.Y.W.; Wong, M.; Paul, C.M.; Naim, F.; Wood, C.C.; Crowhurst, R.N.; et al. The extremophile Nicotiana benthamiana has traded viral defence for early vigour. Nat. Plants 2015, 1, 15165. [Google Scholar] [CrossRef]
- Gangappa, S.N.; Kumar, S.V. DET1 and COP1 modulate the coordination of growth and immunity in response to key seasonal signals in Arabidopsis. Cell Rep. 2018, 25, 29–37.e23. [Google Scholar] [CrossRef] [Green Version]
- Gangappa, S.N.; Berriri, S.; Kumar, S.V. PIF4 coordinates thermosensory growth and immunity in Arabidopsis. Curr. Biol. 2017, 27, 243–249. [Google Scholar] [CrossRef] [Green Version]
- Lavina, A.; Battle, A. First report of tomato spotted wilt virus infection of ficus species in Spain. Plant Dis. 1993, 77, 536. [Google Scholar] [CrossRef]
- Karran, R.; Sanfaçon, H. Tomato ringspot virus coat protein binds to ARGONAUTE 1 and suppresses the translation repression of a reporter gene. Mol. Plant Microbe Interact. 2014, 27, 933–943. [Google Scholar] [CrossRef] [Green Version]
- Qin, L.; Mo, N.; Muhammad, T.; Liang, Y. Genome-wide analysis of DCL, AGO, and RDR gene families in pepper (Capsicum Annuum L.). Int. J. Mol. Sci. 2018, 19, 1038. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Garcia-Ruiz, H.; Takeda, A.; Chapman, E.J.; Sullivan, C.M.; Fahlgren, N.; Brempelis, K.J.; Carrington, J.C. Arabidopsis RNA-dependent RNA polymerases and dicer-like proteins in antiviral defense and small interfering RNA biogenesis during Turnip Mosaic Virus infection. Plant Cell 2010, 22, 481–496. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Donaire, L.; Barajas, D.; Martínez-García, B.; Martínez-Priego, L.; Pagán, I.; Llave, C. Structural and genetic requirements for the biogenesis of tobacco rattle virus-derived small interfering RNAs. J. Virol. 2008, 82, 5167–5177. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, C.; Wu, Z.; Li, Y.; Wu, J. Biogenesis, function, and applications of virus-derived small RNAs in plants. Front. Microbiol. 2015, 6, 1237. [Google Scholar] [CrossRef] [Green Version]
- Diaz-Pendon, J.A.; Li, F.; Li, W.X.; Ding, S.W. Suppression of antiviral silencing by cucumber mosaic virus 2b protein in Arabidopsis is associated with drastically reduced accumulation of three classes of viral small interfering RNAs. Plant Cell 2007, 19, 2053–2063. [Google Scholar] [CrossRef] [Green Version]
- Brosnan, C.A.; Mitter, N.; Christie, M.; Smith, N.A.; Waterhouse, P.M.; Carroll, B.J. Nuclear gene silencing directs reception of long-distance mRNA silencing in Arabidopsis. Proc. Natl. Acad. Sci. USA 2007, 104, 14741–14746. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Venkatesh, J.; Kang, B.C. Current views on temperature-modulated R gene-mediated plant defense responses and tradeoffs between plant growth and immunity. Curr. Opin. Plant Biol. 2019, 50, 9–17. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- An, Z.; Li, Y.; Xie, L.; Zhai, Q.; Huang, H. A rapid and economical method for low molecular weight RNA isolation from a wide variety of plant species. Biosci. Biotechnol. Biochem. 2013, 77, 1599–1601. [Google Scholar] [CrossRef] [PubMed]
- Bakdash, J.Z.; Marusich, L.R. Repeated measures correlation. Front. Psychol. 2017, 8, 456. [Google Scholar] [CrossRef] [PubMed] [Green Version]





| Scores | Visible Symptoms |
|---|---|
| 0 | No visible symptoms; inoculated plants show the same growth and development as mock-inoculated plants. |
| 1 | Very slight yellowing in up to 25% of the inoculated leaf area; the same development as mock-inoculated plants. |
| 2 | Some chlorotic spots in up to 50% of the inoculated leaf area; the same development as mock-inoculated plants. |
| 3 | Chlorotic spots and/or interveinal chlorosis in more than 50% of the inoculated leaf area; chlorotic spots are starting to show on systemic leaves. |
| 4 | Leaf curling and leaf rugosity on systemic leaves. |
| 5 | Strong curling and rugosity; mild stunting. |
| 6 | Very strong leaf curling and rugosity, with chlorotic spots in all systemic leaves; severe plant stunting. |
| Primer Name | Primer Sequence (5′ to 3′) |
|---|---|
| Ca_Rg2_qPF | AGGTAAAAGAATTATATCTCAA |
| Ca_Rg2_qPR | TGCAGAGGGTTTGTAGGCTT |
| Ca_SGT1_qPF | GATCCTCAATCAACTGTCAACCTG |
| Ca_SGT1_qPR | CCCTTGGCAAATATAGTCACAACC |
| Ca_PIF4_qPF | AAAGGAAAAGCAGAGATGGTGAAGA |
| Ca_PIF4_qPR | CCTTTCAGAGAGGTTATGCACTTC |
| Ca_DCL2_qPF | TGGTTATGGCCTCGAACTTGA |
| Ca_DCL2_qPR | TCCCCAAGTGTCTCAAGTGAT |
| Ca_DCL4_qPF | CCAATCTGTACATGGTAGCAGTC |
| Ca_DCL4_qPR | TGTGCTTGTTACAGGTTACAGG |
| Ca_RdRp6_qPF | CCTCTACTTTGTGACTTGGGATGA |
| Ca_RdRp6_qPR | TGTGCGTTGCAGATTTCTCCT |
| Ca_RdRp1_qPF | ATGCAGAGGCCATTGGTGTTGCTG |
| Ca_RdRp1_qPR | CCAAGCTGAAGCCTTTGGTAACAT |
| Ca_AGO1a_qPF | AAACTATTTGCCAATGGAGGTCTG |
| Ca_AGO1a_qPR | ACAGTCTGAAGAATATCACCCTCTC |
| Ca_AGO1b_qPF | AACAAGAGAGTTGACTTTTCCTGT |
| Ca_AGO1b_qPR | CAAGTAATTAGGTCGCTGCTGATT |
| Ca_AGO2_qPF | TCGTCTGATCCTGTTCAAGTTGAT |
| Ca_AGO2_qPR | CTGACTTAACAGCAATTTTTCCAGT |
| Ca_actin_qPF | CCCTAAGGCCAACAGAGAGAA |
| Ca_actin_qPR | CTCACACCATCACCAGAGTCC |
| CaCV IRF | CACTCATTGTTTGCATGCTGGAA |
| CaCV IRR | ACACTAAAGCTTTGAGAGAAGTTAG |
| CaCV IR_qPF | GCTTGTACATTTAGTTTATCAGGGTTAG |
| CaCV IR_qPR | CCAATTTGTTGAATGAGCTAACTTTGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tsai, W.-A.; Shafiei-Peters, J.R.; Mitter, N.; Dietzgen, R.G. Effects of Elevated Temperature on the Susceptibility of Capsicum Plants to Capsicum Chlorosis Virus Infection. Pathogens 2022, 11, 200. https://doi.org/10.3390/pathogens11020200
Tsai W-A, Shafiei-Peters JR, Mitter N, Dietzgen RG. Effects of Elevated Temperature on the Susceptibility of Capsicum Plants to Capsicum Chlorosis Virus Infection. Pathogens. 2022; 11(2):200. https://doi.org/10.3390/pathogens11020200
Chicago/Turabian StyleTsai, Wei-An, Jonathan R. Shafiei-Peters, Neena Mitter, and Ralf G. Dietzgen. 2022. "Effects of Elevated Temperature on the Susceptibility of Capsicum Plants to Capsicum Chlorosis Virus Infection" Pathogens 11, no. 2: 200. https://doi.org/10.3390/pathogens11020200
APA StyleTsai, W.-A., Shafiei-Peters, J. R., Mitter, N., & Dietzgen, R. G. (2022). Effects of Elevated Temperature on the Susceptibility of Capsicum Plants to Capsicum Chlorosis Virus Infection. Pathogens, 11(2), 200. https://doi.org/10.3390/pathogens11020200

