Molecular Detection of Tick-Borne Pathogens in Stray Dogs and Rhipicephalus sanguineus sensu lato Ticks from Bangkok, Thailand
Abstract
1. Introduction
2. Results
2.1. CTBPs Infection in Blood Samples
2.2. CTBPs Infection in Tick Samples
2.3. Risk Factors Associated with CTBPs Infection
2.4. Sequence Analysis
3. Discussion
4. Materials and Methods
4.1. Data on Sample Collection
4.2. PCR Detection and Sequence Analysis
4.3. Phylogenetic Analysis
4.4. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Day, M.J. Arthropod-Borne Infectious Diseases of the Dog and Cat, 2nd ed.; CRC Press: Bristol, UK, 2016; pp. 1–14. [Google Scholar]
 - Chandra, S.; Ma, G.C.; Burleigh, A.; Brown, G.; Norris, J.M.; Ward, M.P.; Emery, D.; Šlapeta, J. The brown dog tick Rhipicephalus sanguineus sensu Roberts, 1965 across Australia: Morphological and molecular identification of R. sanguineus sl tropical lineage. Ticks Tick Borne Dis. 2020, 11, 101305. [Google Scholar] [CrossRef] [PubMed]
 - Galay, R.L.; Manalo, A.A.L.; Dolores, S.L.D.; Aguilar, I.P.M.; Sandalo, K.A.C.; Cruz, K.B.; Divina, B.P.; Andoh, M.; Masatani, T.; Tanaka, T. Molecular detection of tick-borne pathogens in canine population and Rhipicephalus sanguineus (sensu lato) ticks from southern Metro Manila and Laguna, Philippines. Parasites Vectors 2018, 11, 643. [Google Scholar] [CrossRef] [PubMed]
 - Bremer, W.G.; Schaefer, J.J.; Wagner, E.R.; Ewing, S.; Rikihisa, Y.; Needham, G.R.; Jittapalapong, S.; Moore, D.L.; Stich, R.W. Transstadial and intrastadial experimental transmission of Ehrlichia canis by male Rhipicephalus sanguineus. Vet. Parasitol. 2005, 131, 95–105. [Google Scholar] [CrossRef] [PubMed]
 - Cardoso, L.; Oliveira, A.C.; Granada, S.; Nachum-Biala, Y.; Gilad, M.; Lopes, A.P.; Sousa, S.R.; Vilhena, H.; Baneth, G. Molecular investigation of tick-borne pathogens in dogs from Luanda, Angola. Parasites Vectors 2016, 9, 252. [Google Scholar] [CrossRef]
 - Foglia, V.M.; Cappiello, S.; Oliva, G. Tick-transmitted diseases in dogs: Clinicopathological findings. Parassitologia 2006, 48, 135–136. [Google Scholar]
 - Inpankaew, T.; Hii, S.F.; Chimnoi, W.; Traub, R.J. Canine vector-borne pathogens in semi-domesticated dogs residing in northern Cambodia. Parasites Vectors 2016, 9, 253. [Google Scholar] [CrossRef]
 - Kaewmongkol, G.; Lukkana, N.; Yangtara, S.; Kaewmongkol, S.; Thengchaisri, N.; Sirinarumitr, T.; Jittapalapong, S.; Fenwick, S.G. Association of Ehrlichia canis, Hemotropic Mycoplasma spp. and Anaplasma platys and severe anemia in dogs in Thailand. Vet. Microbiol. 2017, 201, 195–200. [Google Scholar] [CrossRef]
 - Ogbu, K.I.; Olaolu, O.S.; Ochai, S.O.; Tion, M.T. A review of some tick-borne pathogens of dogs. JASVM 2018, 3, 140–153. [Google Scholar] [CrossRef]
 - Little, S.E. Ehrlichiosis and anaplasmosis in dogs and cats. Vet. Clin. Small Anim. Pract. 2010, 40, 1121–1140. [Google Scholar] [CrossRef]
 - Huggins, L.G.; Koehler, A.V.; Ng-Nguyen, D.; Wilcox, S.; Schunack, B.; Inpankaew, T.; Traub, R.J. Assessment of a metabarcoding approach for the characterisation of vector-borne bacteria in canines from Bangkok, Thailand. Parasites Vectors 2019, 12, 394. [Google Scholar] [CrossRef] [PubMed]
 - Mascarelli, P.E.; Tartara, G.P.; Pereyra, N.B.; Maggi, R.G. Detection of Mycoplasma haemocanis, Mycoplasma haematoparvum, Mycoplasma suis and other vector-borne pathogens in dogs from Córdoba and Santa Fé, Argentina. Parasites Vectors 2016, 9, 642. [Google Scholar] [CrossRef] [PubMed][Green Version]
 - Sykes, J.E.; Ball, L.M.; Bailiff, N.L.; Fry, M.M. ‘Candidatus Mycoplasma haematoparvum’, a novel small haemotropic mycoplasma from a dog. Int. J. Syst. Evol. Microbiol. 2005, 55, 27–30. [Google Scholar] [CrossRef] [PubMed]
 - Matijatko, V.; Torti, M.; Schetters, T.P. Canine babesiosis in Europe: How many diseases? Trends Parasitol. 2012, 28, 99–105. [Google Scholar] [CrossRef] [PubMed]
 - Baneth, G.; Samish, M.; Alekseev, E.; Aroch, I.; Shkap, V. Transmission of Hepatozoon canis to dogs by naturally-fed or percutaneously-injected Rhipicephalus sanguineus ticks. J. Parasitol. 2001, 87, 606–611. [Google Scholar] [CrossRef]
 - Irwin, P.J.; Jefferies, R. Arthropod-transmitted diseases of companion animals in Southeast Asia. Trends Parasitol. 2004, 20, 27–34. [Google Scholar] [CrossRef]
 - Buddhachat, K.; Meerod, T.; Pradit, W.; Siengdee, P.; Chomdej, S.; Nganvongpanit, K. Simultaneous differential detection of canine blood parasites: Multiplex high-resolution melting analysis (mHRM). Ticks Tick Borne Dis. 2020, 11, 101370. [Google Scholar] [CrossRef]
 - Liu, M.; Ruttayaporn, N.; Saechan, V.; Jirapattharasate, C.; Vudriko, P.; Moumouni, P.F.; Cao, S.; Inpankaew, T.; Ybanez, A.P.; Suzuki, H.; et al. Molecular survey of canine vector-borne diseases in stray dogs in Thailand. Parasitol. Int. 2016, 65, 357–361. [Google Scholar] [CrossRef]
 - Piratae, S.; Pimpjong, K.; Vaisusuk, K.; Chatan, W. Molecular detection of Ehrlichia canis, Hepatozoon canis and Babesia canis vogeli in stray dogs in Mahasarakham province, Thailand. Ann. Parasitol. 2015, 61, 183–187. [Google Scholar]
 - Piratae, S.; Senawong, P.; Chalermchat, P.; Harnarsa, W.; Sae-Chue, B. Molecular evidence of Ehrlichia canis and Anaplasma platys and the association of infections with hematological responses in naturally infected dogs in Kalasin, Thailand. Vet. World 2019, 12, 131–135. [Google Scholar] [CrossRef]
 - Rucksaken, R.; Maneeruttanarungroj, C.; Maswanna, T.; Sussadee, M.; Kanbutra, P. Comparison of conventional polymerase chain reaction and routine blood smear for the detection of Babesia canis, Hepatozoon canis, Ehrlichia canis, and Anaplasma platys in Buriram Province, Thailand. Vet. World 2019, 12, 700–705. [Google Scholar] [CrossRef]
 - Colella, V.; Nguyen, V.L.; Tan, D.Y.; Lu, N.; Fang, F.; Zhijuan, Y.; Wang, J.; Liu, X.; Chen, X.; Dong, J.; et al. Zoonotic Vectorborne Pathogens and Ectoparasites of Dogs and Cats in Eastern and Southeast Asia. Emerg. Infect. Dis. 2020, 26, 1221–1233. [Google Scholar] [CrossRef]
 - Ismail, N.; Bloch, K.C.; McBride, J.W. Human ehrlichiosis and anaplasmosis. Clin. Lab. Med. 2010, 30, 261–292. [Google Scholar] [CrossRef]
 - Perez, M.; Bodor, M.; Zhang, C.; Xiong, Q.; Rikihisa, Y. Human infection with Ehrlichia canis accompanied by clinical signs in Venezuela. Ann. N. Y. Acad. Sci. 2006, 1078, 110–117. [Google Scholar] [CrossRef]
 - Maeda, K.; Markowitz, N.; Hawley, R.C.; Ristic, M.; Cox, D.; McDade, J.E. Human infection with Ehrlichia canis, a leukocytic rickettsia. N. Engl. J. Med. 1987, 316, 853–856. [Google Scholar] [CrossRef]
 - Willi, B.; Novacco, M.; Meli, M.L.; Wolf-Jäckel, G.A.; Boretti, F.S.; Wengi, N.; Lutz, H.; Hofmann-Lehmann, R. Haemotropic mycoplasmas of cats and dogs: Transmission, diagnosis, prevalence and importance in Europe. Schweiz. Arch. Tierheilkd. 2010, 152, 237. [Google Scholar]
 - Sykes, J.E. Canine and Feline Infectious Diseases; Elsevier Health Sciences: Amsterdam, The Netherlands, 2013; pp. 382–398. [Google Scholar]
 - Senevtratna, P.; Weerasinghe, N.; Ariyadasa, S. Transmission of Haemobartonella canis by the dog tick, Rhipiccphalus sanguineus. Res. Vet. Sci. 1973, 14, 112–114. [Google Scholar] [CrossRef]
 - Patra, G.; Sahara, A.; Ghosh, S.; Behera, P.; Borthakur, S.K.; Biswas, P.; Debbarma, A.; Sahanawaz Alam, S. Prevalence of tick-borne pathogens in domestic dogs in North-Eastern region of India. Biol. Rhythm. Res. 2018, 51, 184–193. [Google Scholar] [CrossRef]
 - Nguyen, V.L.; Colella, V.; Greco, G.; Fang, F.; Nurcahyo, W.; Hadi, U.K.; Venturina, V.; Tong, K.B.; Tsai, Y.L.; Taweethavonsawat, P.; et al. Molecular detection of pathogens in ticks and fleas collected from companion dogs and cats in East and Southeast Asia. Parasites Vectors 2020, 13, 1. [Google Scholar] [CrossRef]
 - Chimnoi, W.; Nongnuch, P.; Chanya, K.; Tawin, I.; Phatcharatorn, S.; Sinsamut, S.; Sarawut, Y.; Duangkhamol, S.; Sathaporn, J. Prevalence of external parasites of stray cats and dogs residing in monasteries of Bangkok Metropolitan Areas, Thailand. In Proceedings of the 55 Kasetsart University Annual Conference, Bangkok, Thailand, 1 February 2017. [Google Scholar]
 - Jefferies, R.; Ryan, U.; Jardine, J.; Broughton, D.; Robertson, I.; Irwin, P. Blood, bull terriers and babesiosis: Further evidence for direct transmission of Babesia gibsoni in dogs. Aust. Vet. J. 2007, 85, 459–463. [Google Scholar] [CrossRef]
 - Little, S.E. Changing paradigms in understanding transmission of canine tick-borne diseases: The role of interrupted feeding and intrastadial transmission. In Proceedings of the 2nd Canine Vector-Borne Disease (CVBD) Symposium, Mezara del Vallo, Sicily, Italy, 25–28 April 2007; pp. 30–34. [Google Scholar]
 - Sipin, Q.; Kamal, F.M.; Watanabe, M.; Rani, P.A.M.A.; Low, V.L.; Aziz, N.A.A. Molecular detection of tick-borne haemopathogens in shelter dogs and Rhipicephalus sanguineus (sensu lato) ticks from Peninsular Malaysia. Comp. Immunol. Microbiol. Infect. Dis. 2020, 73, 101563. [Google Scholar] [CrossRef]
 - Low, V.L.; Prakash, B.K.; Lim, Y.A.L.; Tan, T.K.; Vinnie-Siow, W.Y.; Sofian-Azirun, M.; AbuBakar, S. Detection of Anaplasmataceae agents and co-infection with other tick-borne protozoa in dogs and Rhipicephalus sanguineus sensu lato ticks. Exp. Appl. Acarol. 2018, 75, 429–435. [Google Scholar] [CrossRef]
 - Kordick, S.K.; Breitschwerdt, E.; Hegarty, B.; Southwick, K.; Colitz, C.; Hancock, S.; Bradley, J.; Rumbough, R.; Mcpherson, J.; MacCormack, J. Coinfection with multiple tick-borne pathogens in a Walker Hound kennel in North Carolina. J. Clin. Microbiol. 1999, 37, 2631–2638. [Google Scholar] [CrossRef]
 - Otranto, D.; Dantas-Torres, F. Canine and feline vector-borne diseases in Italy: Current situation and perspectives. Parasites Vectors 2010, 3, 2. [Google Scholar] [CrossRef]
 - Gray, J.; Dantas-Torres, F.; Estrada-Peña, A.; Levin, M. Systematics and ecology of the brown dog tick, Rhipicephalus sanguineus. Ticks Tick Borne Dis. 2013, 4, 171–180. [Google Scholar] [CrossRef]
 - Dantas-Torres, F. The brown dog tick, Rhipicephalus sanguineus (Latreille, 1806)(Acari: Ixodidae): From taxonomy to control. Vet. Parasitol. 2008, 152, 173–185. [Google Scholar] [CrossRef]
 - Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R.; et al. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 2947–2948. [Google Scholar] [CrossRef]
 - R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2020; Available online: https://www.R-project.org/ (accessed on 9 October 2020).
 - Inokuma, H.; Fujii, K.; Okuda, M.; Onishi, T.; Beaufils, J.P.; Raoult, D.; Brouqui, P. Determination of the nucleotide sequences of heat shock operon groESL and the citrate synthase gene (gltA) of Anaplasma (Ehrlichia) platys for phylogenetic and diagnostic studies. Clin. Diagn. Lab. Immunol. 2002, 9, 1132–1136. [Google Scholar] [CrossRef]
 - Inokuma, H.; Brouqui, P.; Drancourt, M.; Raoult, D. Citrate Synthase Gene Sequence: A New Tool for Phylogenetic Analysis and Identification of Ehrlichia. J. Clin. Microbiol. 2001, 39, 3031–3039. [Google Scholar] [CrossRef]
 - Hilpertshauser, H.; Deplazes, P.; Schnyder, M.; Gern, L.; Mathis, A. Babesia spp. identified by PCR in ticks collected from domestic and wild ruminants in southern Switzerland. Appl. Environ. Microbiol. 2006, 72, 6503–6507. [Google Scholar] [CrossRef]
 - Inokuma, H.; Okuda, M.; Ohno, K.; Shimoda, K.; Onishi, T. Analysis of the 18S rRNA gene sequence of a Hepatozoon detected in two Japanese dogs. Vet. Parasitol. 2002, 106, 265–271. [Google Scholar] [CrossRef]
 - Criado-Fornelio, A.; Martinez-Marcos, A.; Buling-Sarana, A.; Barba-Carretero, J.C. Presence of Mycoplasma haemofelis, Mycoplasma haemominutum and piroplasmids in cats from southern Europe: A molecular study. Vet. Microbiol. 2003, 93, 307–317. [Google Scholar] [CrossRef]
 


| Pathogen | Dogs Infected n = 360 (%)  | Ticks Infected n = 85 (%)  | 
|---|---|---|
| CTBP total | 275 (76.4) | 33 (38.8) | 
| A. platys | 50 (13.9) | 19 (22.4) | 
| E. canis | 138 (38.3) | 2 (2.4) | 
| B. vogeli | 65 (18.1) | 8 (9.4) | 
| M. haemocanis | 123 (34.2) | 16 (18.8) | 
| H. canis | 71 (19.7) | 5 (5.9) | 
| 1 CTBP species | 145 (40.3) | 22 (25.9) | 
| A. platys | 13 (3.6) | 7 (8.2) | 
| E. canis | 50 (13.9) | 0 | 
| B. vogeli | 20 (5.6) | 5 (5.9) | 
| M. haemocanis | 46 (12.8) | 9 (10.6) | 
| H. canis | 16 (4.4) | 1 (1.2) | 
| 2 CTBP species | 95 (26.4) | 8 (9.4) | 
| A. platys + E. canis | 10 (2.78) | 2 (2.4) | 
| A. platys + B. vogeli | 3 (0.9) | 0 | 
| A. platys + M. haemocanis | 10 (2.8) | 3 (3.5) | 
| A. platys + H. canis | 1 (0.3) | 1 (1.2) | 
| E. canis + B. vogeli | 9 (2.5) | 0 | 
| E. canis + M. haemocanis | 28 (7.8) | 0 | 
| E. canis + H. canis | 13 (3.6) | 0 | 
| B. vogeli + M. haemocanis | 7 (1.9) | 2 (2.4) | 
| B. vogeli + H. canis | 4 (1.1) | 0 | 
| M. haemocanis. + H. canis | 10 (2.9) | 0 | 
| 3 CTBP species | 28 (7.8) | 3 (3.5) | 
| A. platys + E. canis + B. vogeli | 1 (0.3) | 0 | 
| A. platys + E. canis + M. haemocanis | 1 (0.3) | 0 | 
| A. platys + E. canis + H. canis | 2 (0.6) | 0 | 
| A. platys + B. vogeli + M. haemocanis | 1 (0.3) | 0 | 
| A. platys + B. vogeli + H. canis | 2 (0.6) | 1 (1.2) | 
| A. platys + M. haemocanis + H. canis | 3 (0.8) | 2 (2.4) | 
| E. canis + B. vogeli + M. haemocanis | 5 (1.4) | 0 | 
| E. canis + B. vogeli + H. canis | 7 (1.9) | 0 | 
| E. canis + M. haemocanis + H. canis | 5 (1.4) | 0 | 
| B. vogeli + M. haemocanis + H. canis | 1 (0.3) | 0 | 
| 4 CTBP species | 7 (1.9) | 0 | 
| A. platys + E. canis + B. vogeli + M. haemocanis | 0 | 0 | 
| A. platys + E. canis + B. vogeli + H. canis | 1 (0.3) | 0 | 
| A. platys + E. canis + M. haemocanis + H. canis | 1 (0.3) | 0 | 
| A. platys + B. vogeli + M. haemocanis + H. canis | 1 (0.3) | 0 | 
| E. canis + B. vogeli + M. haemocanis + H. canis | 4 (1.1) | 0 | 
| Mixed CTBP | 130 (6.1) | 11 (12.9) | 
| Attribute | Total Number n = 360  | Number of Positive Dogs | |||||
|---|---|---|---|---|---|---|---|
| Any of the Pathogens | Anaplasma platys | Ehrlichia canis | Babesia vogeli | Mycoplasma haemocanis | Hepatozoon canis | ||
| Age category (year) | |||||||
| <1 | 91 (25.3) | 74 (81.3) | 19 (20.9) | 41 (45.1) | 25 (27.5) ** | 27 (29.7) | 25 (27.5) ** | 
| 1–3 | 110 (30.6) | 85 (77.3) | 13 (11.8) | 41 (37.3) | 18 (16.4) | 41 (37.3) | 24 (21.8) | 
| >3 | 159 (44.2) | 116 (72.9) | 18 (11.3) | 56 (35.2) | 22 (13.8) | 55 (34.6) | 22 (13.8) | 
| Sex | |||||||
| Male | 161 (44.7) | 122 (75.8) | 23 (14.3) | 57 (35.4) | 26 (16.1) | 55 (34.2) | 32 (19.9) | 
| Female | 199 (55.3) | 153 (76.9) | 27 (13.6) | 81 (40.7) | 39 (19.6) | 68 (34.2) | 39 (19.6) | 
| Ticks | |||||||
| Presence | 85 (23.6) | 75 (88.2) ** | 11 (12.9) | 51 (60) ** | 23 (27.1) ** | 31 (36.5) | 22 (25.9) | 
| Absence | 275 (76.4) | 200 (72.7) | 39 (14.2) | 87 (31.6) | 42 (15.3) | 92 (33.5) | 49 (17.8) | 
| Total | 360 | 275 (76.4) | 50 (13.9) | 138 (38.3) | 65 (18.1) | 123 (34.2) | 71 (19.7) | 
| Pathogen | Oligonucleotide Sequences (5′–3′) | Product Size (bp) | PCR Protocol | Reference | 
|---|---|---|---|---|
| Anaplasma platys (groESL) | F: AAGGCGAAAGAAGCAGTCTTA R: CATAGTCTGAAGTGGAGGAC  | 724 | 95 °C for 5 min initial denaturation, followed by 35 cycles of 95 °C for 15 s, 50 °C for 30 s, 72 °C for 30 s, then 72 °C for 2 min for the final elongation | [42] | 
| Ehrlichia canis (gltA) | F: TTATCTGTTTATGTTATATAAGC R: CAGTACCTATGCATATCAATCC  | 1251 | 94 °C for 2 min initial denaturation, followed by 44 cycles of 94 °C for 30 s, 53 °C for 60 s, 68 °C for 60 s, then 68 °C for 3 min for the final elongation | [43] | 
| Babesia spp. (18S rRNA)  | F: GTTTCTGMCCCATCAGCTTGAC R: CAAGACAAAAGTCTGCTTGAAAC  | 422–440 | 94 °C for 3 min initial denaturation, followed by 35 cycles of 94 °C for 30 s, 50 °C for 30 s, 72 °C for 1 min, then 72 °C for 5 min for the final elongation | [44] | 
| Hepatozoon spp. (18S rRNA)  | F: ATACATGAGCAAAATCTCAAC R: CTTATTATTCCATGCTGCAG  | 666 | 94 °C for 3 min initial denaturation, followed by 34 cycles of 95 °C for 30 s, 50 °C for 30 s, 72 °C for 1 min, then 72 °C for 5 min for the final elongation | [45] | 
| Mycoplasma spp. (16S rRNA)  | F: ATACGGCCCATATTCCTACG R: TGCTCCACCACTTGTTCA  | 595 | 94 °C for 5 min initial denaturation, followed by 40 cycles of 95 °C for 30 s, 60 °C for 30 s, 72 °C for 30 s, then 72 °C for 10 min for the final elongation | [46] | 
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.  | 
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Do, T.; Phoosangwalthong, P.; Kamyingkird, K.; Kengradomkij, C.; Chimnoi, W.; Inpankaew, T. Molecular Detection of Tick-Borne Pathogens in Stray Dogs and Rhipicephalus sanguineus sensu lato Ticks from Bangkok, Thailand. Pathogens 2021, 10, 561. https://doi.org/10.3390/pathogens10050561
Do T, Phoosangwalthong P, Kamyingkird K, Kengradomkij C, Chimnoi W, Inpankaew T. Molecular Detection of Tick-Borne Pathogens in Stray Dogs and Rhipicephalus sanguineus sensu lato Ticks from Bangkok, Thailand. Pathogens. 2021; 10(5):561. https://doi.org/10.3390/pathogens10050561
Chicago/Turabian StyleDo, Thom, Pornkamol Phoosangwalthong, Ketsarin Kamyingkird, Chanya Kengradomkij, Wissanuwat Chimnoi, and Tawin Inpankaew. 2021. "Molecular Detection of Tick-Borne Pathogens in Stray Dogs and Rhipicephalus sanguineus sensu lato Ticks from Bangkok, Thailand" Pathogens 10, no. 5: 561. https://doi.org/10.3390/pathogens10050561
APA StyleDo, T., Phoosangwalthong, P., Kamyingkird, K., Kengradomkij, C., Chimnoi, W., & Inpankaew, T. (2021). Molecular Detection of Tick-Borne Pathogens in Stray Dogs and Rhipicephalus sanguineus sensu lato Ticks from Bangkok, Thailand. Pathogens, 10(5), 561. https://doi.org/10.3390/pathogens10050561
        
                                                
