First Molecular Characterization of Cryptosporidium spp. in Patients Living with HIV in Honduras
Abstract
1. Introduction
2. Results
2.1. Clinical and Epidemiological Data
2.2. Coproparasitological Analysis
2.3. Clinical and Laboratory Data of Four Patients Infected by Cryptosporidium spp.
2.4. Molecular Analysis
3. Discussion
4. Materials and Methods
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- UNAIDS. Global HIV & AIDS Statistics—2020 Fact Sheet: UNAIDS. 2021. Available online: https://www.unaids.org/en/resources/fact-sheet (accessed on 24 January 2021).
- World Health Organization. Honduras: HIV Country Profile 2019: WHO. 2020. Available online: https://cfs.hivci.org/country-factsheet.html (accessed on 24 January 2021).
- Mohebali, M.; Yimam, Y.; Woreta, A. Cryptosporidium infection among people living with HIV/AIDS in Ethiopia: A systematic review and meta-analysis. Pathog. Glob. Health 2020, 114, 183–193. [Google Scholar] [CrossRef] [Scilit]
- Ajjampur, S.R.; Asirvatham, J.R.; Muthusamy, D.; Gladstone, B.P.; Abraham, O.C.; Mathai, D.; Ward, H.; Wanke, C.; Kang, G. Clinical features & risk factors associated with cryptosporidiosis in HIV infected adults in India. Indian J. Med. Res. 2007, 126, 553–557. [Google Scholar]
- Utami, W.S.; Murhandarwati, E.H.; Artama, W.T.; Kusnanto, H. Cryptosporidium Infection Increases the Risk for Chronic Diarrhea Among People Living With HIV in Southeast Asia: A Systematic Review and Meta-Analysis. Asia Pac. J. Public Health 2020, 32, 8–18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, R.J.; Li, J.Q.; Chen, Y.C.; Zhang, L.X.; Xiao, L.H. Widespread occurrence of Cryptosporidium infections in patients with HIV/AIDS: Epidemiology, clinical feature, diagnosis, and therapy. Acta Trop. 2018, 187, 257–263. [Google Scholar] [CrossRef] [Scilit]
- Darlan, D.M.; Rozi, M.F.; Andriyani, Y.; Yulfi, H.; Saragih, R.H.; Nerdy, N. Cryptosporidium Sp. Findings and Its Symptomatology among Immunocompromised Patients. Open Access Maced. J. Med. Sci. 2019, 7, 1567–1571. [Google Scholar] [CrossRef] [Scilit]
- Zahedi, A.; Ryan, U. Cryptosporidium—An update with an emphasis on foodborne and waterborne transmission. Res. Vet. Sci. 2020, 132, 500–512. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- King, P.; Tyler, K.M.; Hunter, P.R. Anthroponotic transmission of Cryptosporidium parvum predominates in countries with poorer sanitation: A systematic review and meta-analysis. Parasit Vectors 2019, 12, 16. [Google Scholar] [CrossRef] [Scilit]
- Al Mawly, J.; Grinberg, A.; Velathanthiri, N.; French, N. Cross sectional study of prevalence, genetic diversity and zoonotic potential of Cryptosporidium parvum cycling in New Zealand dairy farms. Parasit Vectors 2015, 8, 240. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xiao, L. Molecular epidemiology of cryptosporidiosis: An update. Exp. Parasitol. 2010, 124, 80–89. [Google Scholar] [CrossRef] [Scilit]
- Alves, M.; Xiao, L.; Sulaiman, I.; Lal, A.A.; Matos, O.; Antunes, F. Subgenotype analysis of Cryptosporidium isolates from humans, cattle, and zoo ruminants in Portugal. J. Clin. Microbiol. 2003, 41, 2744–2747. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sannella, A.R.; Suputtamongkol, Y.; Wongsawat, E.; Caccio, S.M. A retrospective molecular study of Cryptosporidium species and genotypes in HIV-infected patients from Thailand. Parasit Vectors 2019, 12, 91. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dey, A.; Ghoshal, U.; Agarwal, V.; Ghoshal, U.C. Genotyping of Cryptosporidium Species and Their Clinical Manifestations in Patients with Renal Transplantation and Human Immunodeficiency Virus Infection. J. Pathog. 2016, 2016, 2623602. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leary, J.K.O.; Blake, L.; Corcoran, G.D.; Sleator, R.D.; Lucey, B. Increased diversity and novel subtypes among clinical Cryptosporidium parvum and Cryptosporidium hominis isolates in Southern Ireland. Exp. Parasitol. 2020, 218, 107967. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lim, Y.A.; Iqbal, A.; Surin, J.; Sim, B.L.; Jex, A.R.; Nolan, M.J.; Smith, H.V.; Gasser, R.B. First genetic classification of Cryptosporidium and Giardia from HIV/AIDS patients in Malaysia. Infect. Genet. Evol. 2011, 11, 968–974. [Google Scholar] [CrossRef] [Scilit]
- Cama, V.A.; Bern, C.; Roberts, J.; Cabrera, L.; Sterling, C.R.; Ortega, Y.; Gilman, R.H.; Xiao, L. Cryptosporidium species and subtypes and clinical manifestations in children, Peru. Emerg. Infect. Dis. 2008, 14, 1567–1574. [Google Scholar] [CrossRef] [Scilit]
- Slapeta, J. Cryptosporidiosis and Cryptosporidium species in animals and humans: A thirty colour rainbow? Int. J. Parasitol. 2013, 43, 957–970. [Google Scholar] [CrossRef] [Scilit]
- Roelfsema, J.H.; Sprong, H.; Cacciò, S.M.; Takumi, K.; Kroes, M.; Van Pelt, W.; Kortbeek, L.M.; Van Der Giessen, J.W.B. Molecular characterization of human Cryptosporidium spp. isolates after an unusual increase in late summer 2012. Parasit Vectors 2016, 9, 138. [Google Scholar] [CrossRef] [Scilit]
- Essid, R.; Menotti, J.; Hanen, C.; Aoun, K.; Bouratbine, A. Genetic diversity of Cryptosporidium isolates from human populations in an urban area of Northern Tunisia. Infect. Genet. Evol. 2018, 58, 237–242. [Google Scholar] [CrossRef] [Scilit]
- Chalmers, R.M.; Robinson, G.; Elwin, K.; Elson, R. Analysis of the Cryptosporidium spp. and gp60 subtypes linked to human outbreaks of cryptosporidiosis in England and Wales, 2009 to 2017. Parasit Vectors 2019, 12, 95. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sulaiman, I.M.; Hira, P.R.; Zhou, L.; Al-Ali, F.M.; Al-Shelahi, F.A.; Shweiki, H.M.; Iqbal, J.; Khalid, N.; Xiao, L. Unique endemicity of cryptosporidiosis in children in Kuwait. J. Clin. Microbiol. 2005, 43, 2805–2809. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Strong, W.B.; Gut, J.; Nelson, R.G. Cloning and sequence analysis of a highly polymorphic Cryptosporidium parvum gene encoding a 60-kilodalton glycoprotein and characterization of its 15- and 45-kilodalton zoite surface antigen products. Infect. Immun. 2000, 68, 4117–4134. [Google Scholar] [CrossRef] [Scilit]
- Gharieb, R.M.A.; Merwad, A.M.A.; Saleh, A.A.; Abd El-Ghany, A.M. Molecular Screening and Genotyping of Cryptosporidium Species in Household Dogs and In-Contact Children in Egypt: Risk Factor Analysis and Zoonotic Importance. Vector Borne Zoonotic Dis. 2018, 18, 424–432. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khan, A.; Shaik, J.S.; Grigg, M.E. Genomics and molecular epidemiology of Cryptosporidium species. Acta Trop. 2018, 184, 1–14. [Google Scholar] [CrossRef] [Scilit]
- Udeh, E.O.; Obiezue, R.N.N.; Okafor, F.C.; Ikele, C.B.; Okoye, I.C.; Otuu, C.A. Gastrointestinal Parasitic Infections and Immunological Status of HIV/AIDS Coinfected Individuals in Nigeria. Ann. Glob. Health 2019, 85. [Google Scholar] [CrossRef] [Scilit]
- Dong, S.; Yang, Y.; Wang, Y.; Yang, D.; Yang, Y.; Shi, Y.; Li, C.; Li, L.; Chen, Y.; Jiang, Q.; et al. Prevalence of Cryptosporidium Infection in the Global Population: A Systematic Review and Meta-analysis. Acta Parasitol. 2020, 65, 882–889. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Selik, R.M.; Karon, J.M.; Ward, J.W. Effect of the human immunodeficiency virus epidemic on mortality from opportunistic infections in the United States in 1993. J. Infect. Dis. 1997, 176, 632–636. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aldeyarbi, H.M.; Abu El-Ezz, N.M.; Karanis, P. Cryptosporidium and cryptosporidiosis: The African perspective. Environ. Sci. Pollut. Res. Int. 2016, 23, 13811–13821. [Google Scholar] [CrossRef] [Scilit]
- Shimelis, T.; Tassachew, Y.; Lambiyo, T. Cryptosporidium and other intestinal parasitic infections among HIV patients in southern Ethiopia: Significance of improved HIV-related care. Parasit Vectors 2016, 9, 270. [Google Scholar] [CrossRef] [Scilit]
- Kaniyarakkal, V.; Mundangalam, N.; Moorkoth, A.P.; Mathew, S. Intestinal Parasite Profile in the Stool of HIV Positive Patients in relation to Immune Status and Comparison of Various Diagnostic Techniques with Special Reference to Cryptosporidium at a Tertiary Care Hospital in South India. Adv. Med. 2016, 2016, 3564359. [Google Scholar] [CrossRef] [Scilit]
- Shimelis, T.; Tadesse, E. Performance evaluation of point-of-care test for detection of Cryptosporidium stool antigen in children and HIV infected adults. Parasit Vectors 2014, 7, 227. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jayalakshmi, J.; Appalaraju, B.; Mahadevan, K. Evaluation of an enzyme-linked immunoassay for the detection of Cryptosporidium antigen in fecal specimens of HIV/AIDS patients. Indian J. Pathol. Microbiol. 2008, 51, 137–138. [Google Scholar] [CrossRef] [Scilit]
- Hung, C.-C.; Tsaihong, J.C.; Lee, Y.-T.; Deng, H.-Y.; Hsiao, W.-H.; Chang, S.-Y.; Chang, S.-C.; Su, K.-E. Prevalence of intestinal infection due to Cryptosporidium species among Taiwanese patients with human immunodeficiency virus infection. J. Formos. Med. Assoc. 2007, 106, 31–35. [Google Scholar] [CrossRef] [Scilit]
- Yulfi, H.; Fakhrur Rozi, M.; Andriyani, Y.; Masyithah Darlan, D. Prevalence of Cryptosporidium spp. and Blastocystis hominis in faecal samples among diarrheic HIV patients in Medan, Indonesia. Med Glas (Zenica) 2021, 18, 55–61. [Google Scholar] [CrossRef] [Scilit]
- Karshima, S.N.; Karshima, M.N. Epidemiology of Cryptosporidium Infections among People Living with HIV/AIDS in Nigeria: Results of Systematic Review and Meta-analysis. Acta Parasitol. 2020, 1–5. [Google Scholar] [CrossRef] [Scilit]
- Ajjampur, S.S.; Sankaran, P.; Kang, G. Cryptosporidium species in HIV-infected individuals in India: An overview. Natl. Med. J. India 2008, 21, 178–184. [Google Scholar] [PubMed]
- Kurniawan, A.; Karyadi, T.; Dwintasari, S.; Sari, I.; Yunihastuti, E.; Djauzi, S.; Smith, H. Intestinal parasitic infections in HIV/AIDS patients presenting with diarrhoea in Jakarta, Indonesia. Trans. R. Soc. Trop. Med. Hyg. 2009, 103, 892–898. [Google Scholar] [CrossRef] [Scilit]
- Izadi, S.; Mohaghegh, M.A.; Ghayour-Najafabadi, Z.; Azami, M.; Mirzaei, F.; Namdar, F.; Mohebali, M.; Wannigama, D.L.; Hejazi, S.H. Frequency and Molecular Identification of Cryptosporidium Species among Immunocompromised Patients Referred to Hospitals, Central Iran, 2015–2016. Iran J. Parasitol. 2020, 15, 31–39. [Google Scholar]
- Den Hartog, J.; Rosenbaum, L.; Wood, Z.; Burt, D.; Petri, W.A., Jr. Diagnosis of multiple enteric protozoan infections by enzyme-linked immunosorbent assay in the Guatemalan highlands. Am. J. Trop. Med. Hyg. 2013, 88, 167–171. [Google Scholar] [CrossRef] [Scilit]
- Shrivastava, A.K.; Panda, S.; Kumar, S.; Sahu, P.S. Two novel genomic DNA sequences as common diagnostic targets to detect Cryptosporidium hominis and Cryptosporidium parvum: Development of quantitative polymerase chain reaction assays, and clinical evaluation. Indian J. Med. Microbiol. 2020, 38, 430–439. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Manouana, G.P.; Lorenz, E.; Ngwese, M.M.; Moure, P.A.N.; Ascofaré, O.M.; Akenten, C.W.; Amuasi, J.; Rakotozandrindrainy, N.; Rakotozandrindrainy, R.; Mbwana, J.; et al. Performance of a rapid diagnostic test for the detection of Cryptosporidium spp. in African children admitted to hospital with diarrhea. PLoS Negl. Trop. Dis. 2020, 14, e0008448. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gutierrez-Cisneros, M.J.; Martinez-Ruiz, R.; Subirats, M.; Merino, F.J.; Millan, R.; Fuentes, I. Assessment of two commercially available immunochromatographic assays for a rapid diagnosis of Giardia duodenalis and Cryptosporidium spp. in human fecal specimens. Enferm. Infecc. Microbiol. Clin. 2011, 29, 201–203. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kaminsky, R.G.; Soto, R.J.; Campa, A.; Baum, M.K. Intestinal parasitic infections and eosinophilia in an human immunedeficiency virus positive population in Honduras. Mem. Inst. Oswaldo Cruz. 2004, 99, 773–778. [Google Scholar] [CrossRef] [Scilit]
- Lindo, J.F.; Ager, A.L.; Klaskala, W.I.; Palmer, C.J.; Baum, M.K.; De Gourville, E.M.; Dubon, J.M.; Solo-Gabriele, H. Intestinal parasitic infections in human immunodeficiency virus (HIV)-positive and HIV-negative individuals in San Pedro Sula, Honduras. Am. J. Trop. Med. Hyg. 1998, 58, 431–435. [Google Scholar] [CrossRef] [Scilit]
- Naceanceno, K.S.; Matamoros, G.; Gabrie, J.A.; Bottazzi, M.E.; Sanchez, A.; Mejia, R. Use of Multi-Parallel Real-Time Quantitative PCR to Determine Blastocystis Prevalence and Association with Other Gastrointestinal Parasite Infection in a Rural Honduran Location. Am. J. Trop. Med. Hyg. 2020, 102, 1373–1375. [Google Scholar] [CrossRef] [Scilit]
- Kaminsky, R.G. Parasitism and diarrhoea in children from two rural communities and marginal barrio in Honduras. Trans. R. Soc. Trop. Med. Hyg. 1991, 85, 70–73. [Google Scholar] [CrossRef] [Scilit]
- Matamoros, G.; Rueda, M.M.; Rodríguez, C.; Gabrie, J.A.; Canales, M.; Fontecha, G.; Sanchez, A. High Endemicity of Soil-Transmitted Helminths in a Population Frequently Exposed to Albendazole but No Evidence of Antiparasitic Resistance. Trop. Med. Infect. Dis. 2019, 4, 73. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sanchez, A.L.; Gabrie, J.A.; Usuanlele, M.T.; Rueda, M.M.; Canales, M.; Gyorkos, T.W. Soil-transmitted helminth infections and nutritional status in school-age children from rural communities in Honduras. PLoS Negl. Trop. Dis. 2013, 7, e2378. [Google Scholar] [CrossRef] [Scilit]
- Torres, R.E.M.; Garcia, D.N.F.; Sandoval, G.A.F.; Santana, A.H.; Singh, P.; Bucheli, S.T.M.; Saboya, M.; Paz, M.Y. Prevalence and intensity of soil-transmitted helminthiasis, prevalence of malaria and nutritional status of school going children in honduras. PLoS Negl. Trop. Dis. 2014, 8, e3248. [Google Scholar] [CrossRef] [Scilit]
- Pielok, Ł.; Nowak, S.; Kłudkowska, M.; Frąckowiak, K.; Kuszel, Ł.; Zmora, P.; Stefaniak, J. Massive Cryptosporidium infections and chronic diarrhea in HIV-negative patients. Parasitol. Res. 2019, 118, 1937–1942. [Google Scholar] [CrossRef] [Scilit]
- Houpt, E.R.; Bushen, O.Y.; Sam, N.E.; Kohli, A.; Asgharpour, A.; Ng, C.T.; Calfee, D.P.; Guerrant, R.L.; Maro, V.; Ole-Nguyaine, S.; et al. Short report: Asymptomatic Cryptosporidium hominis infection among human immunodeficiency virus-infected patients in Tanzania. Am. J. Trop. Med. Hyg. 2005, 73, 520–522. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- De Lucca, P.; De Gaspari, E.N.; Bozzoli, L.M.; Funada, M.R.; Silva, S.O.D.S.; Iuliano, W.; Soares, R.M. Molecular characterization of Cryptosporidium spp. from HIV infected patients from an urban area of Brazil. Rev. Inst. Med. Trop. Sao Paulo. 2009, 51, 341–343. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gatei, W.; Barrett, D.; Lindo, J.F.; Eldemire-Shearer, D.; Cama, V.; Xiao, L. Unique Cryptosporidium population in HIV-infected persons, Jamaica. Emerg. Infect. Dis. 2008, 14, 841–843. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ghafari, R.; Rafiei, A.; Tavalla, M.; Moradi Choghakabodi, P.; Nashibi, R.; Rafiei, R. Prevalence of Cryptosporidium species isolated from HIV/AIDS patients in southwest of Iran. Comp. Immunol. Microbiol. Infect. Dis. 2018, 56, 39–44. [Google Scholar] [CrossRef] [Scilit]
- Iqbal, A.; Lim, Y.A.; Surin, J.; Sim, B.L. High diversity of Cryptosporidium subgenotypes identified in Malaysian HIV/AIDS individuals targeting gp60 gene. PLoS ONE 2012, 7, e31139. [Google Scholar] [CrossRef] [Scilit]
- Del Chierico, F.; Onori, M.; Di Bella, S.; Bordi, E.; Petrosillo, N.; Menichella, D.; Cacciò, S.M.; Callea, F.; Putignani, L. Cases of cryptosporidiosis co-infections in AIDS patients: A correlation between clinical presentation and GP60 subgenotype lineages from aged formalin-fixed stool samples. Ann. Trop. Med. Parasitol. 2011, 105, 339–349. [Google Scholar] [CrossRef] [Scilit]
- Blanco, M.A.; Iborra, A.; Vargas, A.; Nsie, E.; Mba, L.; Fuentes, I. Molecular characterization of Cryptosporidium isolates from humans in Equatorial Guinea. Trans. R. Soc. Trop. Med. Hyg. 2009, 103, 1282–1284. [Google Scholar] [CrossRef] [Scilit]
- Squire, S.A.; Ryan, U. Cryptosporidium and Giardia in Africa: Current and future challenges. Parasit Vectors 2017, 10, 195. [Google Scholar] [CrossRef] [Scilit]
- Feng, Y.; Torres, E.; Li, N.; Wang, L.; Bowman, D.; Xiao, L. Population genetic characterisation of dominant Cryptosporidium parvum subtype IIaA15G2R1. Int. J. Parasitol. 2013, 43, 1141–1147. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leary, J.K.O.; Blake, L.; Corcoran, G.D.; Sleator, R.D.; Lucey, B. Development of novel methodology for the molecular differentiation of Cryptosporidium parvum gp60 subtypes via high resolution melting analysis. MethodsX 2020, 7, 101157. [Google Scholar] [CrossRef] [Scilit] [PubMed]





| Clinical and Laboratory Findings | Present n (%) | Absent n (%) | Unknown n (%) |
|---|---|---|---|
| Antiretroviral therapy | 88 (86.27) | 12 (11.76) | 2 (1.96) |
| Diarrhea of at least 3 days | 29 (28.43) | 73 (71.57) | 0 (0) |
| Fever | 26 (25.49) | 75 (73.52) | 1 (0.98) |
| Cough | 28 (27.45) | 73 (71.57) | 1 (0.98) |
| Nausea | 11 (10.78) | 90 (88.23) | 1 (0.98) |
| Abdominal pain | 17 (16.66) | 84 (82.35) | 1 (0.98) |
| Mucus in stool | 27 (26.47) | 75 (73.52) | 0 (0) |
| Macroscopic parasites | 0 (0) | 102 (100) | 0 (0) |
| White blood cells in stool | 2 (1.96) | 100 (98.04) | 0 (0) |
| Yeasts in stool | 71 (69.61) | 22 (21.57) | 9 (8.82) |
| Intestinal parasites 1 | 32 (31.37) | 70 (68.62) | 0 (0) |
| Patient | Sex | Age | Drinking Water | Diarrhea | CD4 Cell Count/mm3 | ARV |
|---|---|---|---|---|---|---|
| 1 | F | 46 | Bottled | >3 days | 38 | Yes |
| 2 | F | 32 | Tap water | No | 40 | Yes |
| 3 | F | 35 | Bottled | 3 days | 185 | Yes |
| 4 | M | 44 | Bottled | <3 days | 18 | No |
| Gene | Primers for the Nested PCR | Sequence (5′-3′) |
|---|---|---|
| gp60 gene | AL3531F | ATAGTCTCCGCTGTATTC |
| AL3535R | GGAAGGAACGATGTATCT | |
| AL3532F | TCCGCTGTATTCTCAGCC | |
| AL3534R | GCAGAGGAACCAGCATC | |
| 18S ribosomal gene | 18SRF1 | GTTAAACTGCGAATGGCTCA |
| 18SRR1 | CCATTTCCTTCGAAACAGGA | |
| 18SRF2 | CTCGACTTTATGGAAGGGTTG | |
| 18SRR2 | CCTCCAATCTCTAGTTGGCATA | |
| cowp gene | BCOWPF | ACCGCTTCTCAACAACCATCTTGTCCTC |
| BCOWPR | CGCACCTGTTCCCACTCAATGTAAACCC | |
| Cry-15 | GTAGATAATGGAAGAGATTGTG | |
| Cry-9 | GGACTGAAATACAGGCATTATCTTG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Betancourth, S.; Archaga, O.; Moncada, W.; Rodríguez, V.; Fontecha, G. First Molecular Characterization of Cryptosporidium spp. in Patients Living with HIV in Honduras. Pathogens 2021, 10, 336. https://doi.org/10.3390/pathogens10030336
Betancourth S, Archaga O, Moncada W, Rodríguez V, Fontecha G. First Molecular Characterization of Cryptosporidium spp. in Patients Living with HIV in Honduras. Pathogens. 2021; 10(3):336. https://doi.org/10.3390/pathogens10030336
Chicago/Turabian StyleBetancourth, Sergio, Osman Archaga, Wendy Moncada, Vilma Rodríguez, and Gustavo Fontecha. 2021. "First Molecular Characterization of Cryptosporidium spp. in Patients Living with HIV in Honduras" Pathogens 10, no. 3: 336. https://doi.org/10.3390/pathogens10030336
APA StyleBetancourth, S., Archaga, O., Moncada, W., Rodríguez, V., & Fontecha, G. (2021). First Molecular Characterization of Cryptosporidium spp. in Patients Living with HIV in Honduras. Pathogens, 10(3), 336. https://doi.org/10.3390/pathogens10030336

