Next Article in Journal
Glycosidase Isoforms in Honey and the Honey Bee (Apis mellifera L.): Differentiating Bee- and Yeast-Derived Enzymes and Implications for Honey Authentication
Previous Article in Journal
Invasion Dynamics and Migration Patterns of Fall Armyworm (Spodoptera frugiperda) in Shaanxi, China
Previous Article in Special Issue
Risk Assessment of RNAi-Based Potential Pesticide dsNlAtg3 and Its Homologues for Nilaparvata lugens and Non-Target Organisms
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Insects
Volume 16
Issue 6
10.3390/insects16060621
insects-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Activation of BmToll9-1 in Silkworm (Bombyx mori) Larval Midgut by Escherichia coli and Regulation of Growth

by
Jisheng Liu
1,*,†,
Weijian Chen
1,†,
Minchun Lai
1,
Jiahua Chen
1 and
Luc Swevers
2
1
School of Life Sciences, Guangzhou University, Guangzhou 510006, China
2
Institute of Biosciences and Applications, National Centre for Scientific Research Demokritos, 15431 Athens, Greece
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Insects 2025, 16(6), 621; https://doi.org/10.3390/insects16060621
Submission received: 6 May 2025 / Revised: 8 June 2025 / Accepted: 10 June 2025 / Published: 11 June 2025
(This article belongs to the Special Issue RNAi in Insect Physiology)
Browse Figures
Versions Notes

Simple Summary

Toll receptors play a crucial role in insect development and innate immunity. BmToll9-1 has been proven to positively regulate both development and immune responses in silkworms. BmToll9-2 appears to exhibit similar functions. This article further explores the impact of bacterial infection on silkworm larvae following RNA interference of BmToll9-1. Interestingly, bacterial infection seems to reactivate the silenced BmToll9-1 and nullify the phenotypic changes it caused, while also activating downstream immune pathways, with a particularly pronounced response against Gram-negative bacteria (specifically Escherichia coli, when compared to Gram-positive Staphylococcus aureus). These functional characteristics show a remarkable similarity to those of BmToll9-2, which were previously reported. However, a comprehensive cross-validation confirms that they are genetically distinct genes despite their functional parallels.

Abstract

Insects rely on their innate immune system to defend against pathogens, and the Toll signaling pathway plays an important role in immune regulation. Our previous studies have shown that BmToll9-1 functions as a positive regulator in the Toll pathway. This study seeks to elucidate the role of BmToll9-1, as a sensor to bacterial challenge, in modulating larval development and downstream Toll signaling pathways. Silkworm larvae were subjected to infection with either Gram-negative Escherichia coli or Gram-positive Staphylococcus aureus bacteria following silencing of BmToll9-1 by RNA interference (RNAi). This bacterial challenge triggered a compensatory re-induction of BmToll9-1 expression, which resulted in the recovery of larval weight and size to levels observed in untreated controls. Furthermore, upon bacterial infection of BmToll9-1-silenced larvae, there was an up-regulation in the expression of both signaling genes in the Toll pathway and downstream effector genes, with a marked preference for Gram-negative bacteria. These results highlight the involvement of BmToll9-1 in the Toll signaling pathway as a positive regulator, influencing silkworm development. Additionally, BmToll9-1 and BmToll9-2 were cross-validated to be genetically distinct genes, even though they were confirmed to be functionally analogous in the silkworm.

1. Introduction

Insects have flourished on Earth for more than 480 million years and this can be explained, at least partially, by their powerful immunity. Insects primarily defend against the invasion of exogenous pathogens through their innate immune system [1], which synthesizes and secretes antimicrobial peptides (AMPs) mediated by Toll and immune deficiency (IMD) signaling pathways [2]. Additionally, insects can also defend against exogenous pathogens through cellular immunity mediated by hemocytes (e.g., phagocytosis, nodulation, and encapsulation).
The Toll/TLR receptors belong to an ancient family of immune defense-related receptors, with genes encoding the signaling cascade components conserved across all vertebrates, spanning from lower to higher taxa [3]. Insect Toll is a type I transmembrane protein that can be divided into three parts: extracellular, transmembrane, and intracellular regions. The transmembrane region is flanked by an extracellular leucine-rich repeat (LRR) domain for ligand recognition and the cytoplasmic Toll/interleukin-1 receptor (TIR) domain that interacts with downstream molecules such as myeloid differentiation factor 88 (MyD88) [4,5,6].
The earliest discovery of Toll receptors was in studies of embryonic development in Drosophila melanogaster [7]. Subsequently, a total of nine Toll receptors were identified in Drosophila and they differed in structure and function [8,9,10]. Several studies revealed that the overexpression of DmToll and DmToll9 led to a significant activation of antimicrobial peptide (AMP) genes, whereas Dm18W and DmToll5 were induced to be expressed when the organism was infested with exogenous pathogens [11,12,13,14,15]. Also, Dm18W was associated with the development of Drosophila follicular cells and salivary glands [16,17,18], while DmToll8 was associated with the regulation of neuron-specific glycosylation and the development of wing discs in the Drosophila embryo [19,20]. In addition to Drosophila, Toll receptors have been found in other insects. For example, there are 5 Toll receptors in Apis mellifera [21], 11 receptors in Anopheles gambiae [22], 9 in Tribolium castaneum [23], and 14 in Bombyx mori [24].
The domesticated silkworm, B. mori, which originated in China, has been cultivated for more than 5000 years ago. The silkworm not only holds significant economic importance in China but also serves as a model organism in Lepidoptera. It was the first lepidopteran insect to have its entire genome sequenced [25,26,27]. Moreover, the silkworm’s susceptibility to pathogen infections during cultivation makes it an excellent model for studying the mechanisms of innate immunity [28,29].
Although there are 14 Toll-related genes in silkworms, current studies are focused on the Toll9 genes that encode two closely related receptors, BmToll9-1 and BmToll9-2. Similarly to DmToll9, BmToll9-1 and BmToll9-2 are associated with the innate immunity of B. mori, as proven in previous research [6,30,31,32,33,34,35]. In previous studies, we found that BmToll9-1 transcripts were reduced after an injection of lipopolysaccharide (LPS) or double-stranded RNA (dsRNA) into silkworm larvae [31] and that LPS also repressed AMP genes and other immune pathway-related genes in silkworm-derived Bm5 cells overexpressing the BmToll9-1 receptor [32]. BmToll9-1 expression was induced after infection with Escherichia coli and the fungus Beauveria bassiana [30,36], while BmToll9-2 was induced by E. coli and its main cell wall component LPS, as well as Staphylococcus aureus and its main cell wall component peptidoglycan (PGN) [34]. In our recent studies, we found that the larvae and cocoons were smaller and lighter after the knockdown of BmToll9-1, and that BmToll9-1 played a role as a positive regulator in the immune response of the Toll signaling pathway to enhance antimicrobial activity against E. coli [6]. Similarly to BmToll9-1, BmToll9-2 showed the same effect, i.e., it stimulates the humoral immune response and antibacterial activity [35]. Remarkably, a bacterial challenge following RNAi up-regulated the expression of BmToll9-2 and significantly mitigated the silkworm weight differences [34].
Although we have already demonstrated that BmToll9-1 plays a vital role in innate immunity, we have yet to pinpoint the pathways involved and the mechanisms that regulate its function. Previously, we confirmed the role of BmToll9-1 via double-stranded RNA (dsRNA)-mediated gene silencing [6]. In this follow-up study, a bacterial challenge and RNAi were combined to complement previous research and further elucidate the mechanisms by which BmToll9-1 functions in the innate immunity of the silkworm.

2. Materials and Methods

2.1. Insect Rearing and Bacterial Culture

The larvae of B. mori “P50” strain were provided by the Guangdong Academy of Agricultural Sciences, Guangzhou, China and reared on fresh mulberry leaves at 25 ± 1 °C, 75 ± 5% relative humidity, and a photoperiod of 12 L:12 D. Silkworm larvae at the 5th instar were selected for sampling. All samples were immediately transferred to RNase-free tubes and stored at −80 °C. The bacteria E. coli and S. aureus, maintained in our laboratory, were grown overnight in Luria–Bertani (LB) liquid medium at 37 °C and 200 rpm.

2.2. RNA Protocol and Bacterial Challenge to Larvae

RNAi was performed as described in our previous report [6]. In brief, the T7 RNA polymerase promoter sequence was added to the primers before PCR amplification to produce the template DNA. A T7 RiboMAX Express RNAi kit (Promega, Madison, WI, USA) was used to synthesize dsRNA. Double-stranded BmToll9-1 (dsBmToll9-1) was injected on Day 1 of the 5th instar larvae, while double-stranded green fluorescent protein (dsGFP) was used as a negative control (N = 50 per treatment for each treatment).
Subsequently, dsBmToll9-1- and dsGFP-treated larvae were provided with mulberry leaf disks of identical size, coated with 10 µL of E. coli or S. aureus bacterial solution [34,35]. Midgut samples were collected at 6, 12, and 24 h after feeding.

2.3. RNA Extraction and cDNA Synthesis

Total RNA was isolated from frozen tissue samples using an RNAiso Plus kit (TaKaRa, Kusatsu, Japan) following the manufacturer’s protocol. Genomic DNA was eliminated through DNase treatment, and first-strand complementary DNA (cDNA) was synthesized utilizing a PrimeScript RT Reagent Kit (Perfect Real Time) (TaKaRa).

2.4. Quantitative Real-Time PCR (qRT-PCR)

GoTaq qPCR Master Mix (Promega, Madison, WI, USA) was employed for qRT-PCR amplification, with midgut cDNA from 5th instar larvae as the template. The thermal cycling protocol was executed on a CFX Connect Real-Time System (Bio-Rad, Hercules, CA, USA) as follows: 95 °C for two min, 40 cycles of 95 °C for 15 s, and 57 °C for 30 s. After the thermal cycles, a dissociation step ranging from 65 °C to 95 °C was incorporated. Primer sequences for detecting BmToll9-1, BmToll9-2, signaling genes, and effector genes are detailed in Table 1. Translation initiation factor 4A (BmTIF4A) and translation initiation factor 3 subunit 4 (BmTIF3s4) were used as the reference genes [37]. Gene expression normalization was achieved through geometric averaging of the reference genes, and relative expression levels of target genes were calculated using the 2(−∆∆CT) method [38]. All qRT-PCR reactions were conducted with three biological replicates (N = 10 larvae), each accompanied by three technical replicates.

2.5. Data Analysis

Statistical analyses were conducted using a two-way ANOVA followed by Student’s t-test using SPSS version 26.0. Data visualization and plotting were performed in GraphPad Prism v10.0, with results presented as mean ± standard deviation based on three biological replicates. The mean values of knockdown or inhibition rates were compared to the control groups and converted to a percentage.

3. Results

3.1. Activation of BmToll9-1 by Bacterial Challenges Following RNAi of BmToll9-1

In the previous study, BmToll9-1 could be induced by feeding on E. coli and B. bassiana, and we confirmed that it was effectively silenced in the midgut via dsRNA [6,30,36]. In this study, to further demonstrate the role of bacterial infections as a trigger for BmToll9-1 expression, heat-inactivated E. coli and S. aureus were fed to the silkworm larvae after dsBmToll9-1 was injected into the larvae. The results showed that the relative expression of BmToll9-1 in the RNAi group (injected with dsBmToll9-1) remained significantly silenced, showing a 43% and 65% reduction after 6 h and 12 h, respectively. However, by 24 h following feeding on food that contained E. coli, its expression level had returned to that of the control group (injected with dsGFP) (Figure 1A). In contrast, when feeding on food that contained S. aureus, the relative expression of BmToll9-1 in the RNAi group had normalized to the same level as the control group within 12 h (Figure 1B). Therefore, while dsRNA effectively reduced the expression of BmToll9-1 in B. mori, this silencing effect could be mitigated by bacterial infection.

3.2. Bacterial Challenges Following Injection of dsBmToll9-1 Mitigated the Diminished Growth Phenotype

After the BmToll9-1 gene was silenced, both the larvae and cocoons exhibited a smaller and lighter phenotype [6]. However, bacterial treatment annulled the effects of dsBmToll9-1 injection over time, which manifested as reduced growth, affecting both the body weight and dimensions (Figure 2). Upon feeding on E. coli, the body weight of BmToll9-1-silenced larvae gradually recovered to match that of the control, reaching a maximum of 1.87 g (on the 4th day after the dsBmToll9-1 injection) (Figure 2A,C). Both BmToll9-1-silenced larvae and the control larvae pupated into the cocoon stage around the same time (the 4th day after the dsBmToll9-1 injection). After pupation, their body mass decreased to 0.87 g and 0.90 g, respectively, on the 11th day. Similarly, after feeding on S. aureus, BmToll9-1-silenced larvae showed comparable changes to those treated with E. coli, with their body weight gradually returning to the same weight as the control group, peaking on the 4th day post RNAi (dsBmToll9-1 injection) (Figure 2B,D). On the 11th day after the dsBmToll9-1 injection, these larvae then entered the cocoon stage, with their body weight reducing to 0.89 g and 0.91 g, respectively.

3.3. Bacterial Challenges Following RNAi of BmToll9-1 Induced Signaling Genes in Toll Pathway

Our previous study confirmed that RNAi of the BmToll9-1 gene reduced the expression of signaling genes in the Toll pathway and downstream effector genes [6]. To further investigate the role of bacteria, bacterial treatment through the food was administered following the injection of dsBmToll9-1 to assess the activation of signaling genes. Since both bacterial treatments after RNAi of BmToll9-1 led to the activation of BmToll9-1 expression at 24 h, this specific time point was chosen for subsequent validation. Compared to the control group, most of the signaling genes in the Toll pathway were significantly up-regulated in the RNAi group after the bacterial challenges. After feeding on E. coli, the expression levels of BmMyD88, BmPelle, BmCactus, BmRel, BmTollip-v, BmPellino, BmTRAF2, and BmECSIT were induced by 2.26-, 2.08-, 2.55-, 2.03-, 3.64-, 1.92-, 2.25-, and 2.38-fold, respectively (Figure 3A). After feeding on S. aureus, the immune genes BmMyD88, BmPelle, BmCactus, BmRel, BmTollip-v, BmTRAF2, and BmECSIT were induced by 2.55-, 2.77-, 1.81-, 2.09-, 1.74-, 1.93-, and 2.32-fold, respectively (Figure 3B).

3.4. Bacterial Challenges Following RNAi of BmToll9-1 Induced Downstream Effector Genes

Similarly, bacterial treatment was administered following the RNAi of BmToll9-1 to evaluate the activation of effector genes (Figure 4). Compared to the control group, most AMP genes were significantly up-regulated in the RNAi dsBmToll9-1 treated group of larvae after the bacterial challenges. After feeding on E. coli, BmAtt1, BmCecA, BmDef, BmGlv1, BmMor, BmEnb, BmLys, BmLLP3, BmPPO1, and BmNOS1 were significantly induced by 9.06-, 13.23-, 4.36-, 11.31-, 9.21-, 6.15-, 33.29-, 4.02-, 4.36-, and 2.30-fold, respectively, while BmPOI was also up-regulated, but not at a statistically significant level (Figure 4A). Following feeding on S. aureus, BmAtt1, BmCecA, BmDef, BmGlv1, BmLeb3, BmEnb, BmLys, BmLLP3, and BmPPO1 were significantly induced by 8.41-, 2.84-, 4.47-, 16.77-, 5.19-, 2.80-, 6.22-, 2.41-, and 3.77-fold, respectively, while BmMor, BmPOI, and BmNOS1 were not induced (Figure 4B).

3.5. Silencing BmToll9-1 Did Not Affect the Expression of BmToll9-2

It is worth noting that BmToll9-2 appeared to share similar functions with BmToll9-1. To clarify whether these two genes affect each other’s expression, a cross-validation strategy was employed. In the BmToll9-2-silenced larvae, the expression of BmToll9-1 remained unchanged compared to the control group (Figure 5A). Likewise, silencing BmToll9-1 had no discernible impact on the expression of BmToll9-2 (Figure 5B). This analysis underscores that BmToll9-1 and BmToll9-2, while functionally similar, are distinct genes with independent regulatory mechanisms.

4. Discussion

Previous studies have revealed that BmToll9-1 plays a crucial role in the innate immune pathway, exhibiting distinct responses to various microbial infections and functioning as a pattern recognition receptor (PRR) for LPS [31,33,39]. Additionally, BmToll9-1 has been confirmed to positively mediate the innate immune pathway by regulating the expression of Toll pathway signaling genes and most AMP genes [6]. In this study, we further investigated the role of BmToll9-1 as a sensor for bacteria in modulating larval development and downstream Toll signaling pathways.

4.1. BmToll9-1 Might Be Involved in Immune Response to Regulate Development of the Silkworm

Previously, we had shown that BmToll9-1 is a positive regulator in the Toll pathway and the production of AMPs [6]. In this study, most Toll signaling genes were significantly up-regulated in BmToll9-1-silenced B. mori 5th instar larvae after feeding on heat-inactivated E. coli and S. aureus (Figure 3), while most AMP genes were also significantly up-regulated (Figure 4). These results suggest that BmToll9-1 is involved in the immune response of the silkworm. At the same time, a recovery in the growth of the silkworm was observed. Following the injection of dsBmToll9-1, the larvae of the silkworm exhibited a reduction in both size and weight of 38% [6]. Interestingly, when BmToll9-1-silenced larvae were subjected to bacteria in their food, the larvae of the silkworm gradually returned to a normal weight and size (Figure 2). Combined with the above results, it was inferred that BmToll9-1 might be involved in immune responses to regulate the development of the silkworm.
BmToll9-1 is mainly expressed in the midgut [6]. As an important immune organ in the insect immune system, the epithelial tissue of the midgut is in close contact with the microorganisms in the midgut, and plays an important role in regulating microbial community homeostasis. In this manner, it participates in the immune processes of the organism [6,40].
Silencing of the BmToll9-1 gene may disrupt the balance of midgut microbial homeostasis, which in turn impacts food intake and digestion, ultimately affecting the growth and development of larvae. A similar observation was documented in our previous study concerning the BmToll9-2 gene [34]. It has been demonstrated that the gut microbiota plays a role in the development of insects [41,42]. The relationship between immune activation and growth in silkworms likely involves complex interactions. Metabolic resources and nutrient allocation might also affect the growth of the silkworms. Future experiments should incorporate mechanistic assays, such as nutrient absorption profiling, metabolic pathway analyses, and gut physiology assessments, to directly link immune up-regulation to growth outcomes.
Bacterial treatment induced the expression of BmToll9-1, and the body weight and size of the silkworm larvae returned to those of the control. This suggests that the reduced growth caused by the knockdown of BmToll9-1 is reversible. Reduced larval growth due to genetic disturbances has frequently been found in past studies, e.g., involving the BmToll9-2 and BmPGRP-L4 genes [34,40]. It is noteworthy that these genes are associated with the regulation of the immune pathways [43].

4.2. BmToll9-1 Is Preferentially Triggered by Gram-Negative Bacteria

Our recent study demonstrated that silencing BmToll9-1 resulted in a more pronounced reduction in antibacterial activity against E. coli compared to S. aureus [6]. Specifically, the induction of AMP genes by E. coli following BmToll9-1 silencing was significantly higher than that induced by S. aureus (Figure 4). These findings suggest that the BmToll9-1 gene is preferentially activated by Gram-negative bacteria, such as the tested E. coli. Although the expression difference of BmToll9-1 was rapidly diminished in a shorter period in response to S. aureus (Figure 1), this appears to reflect a suppression of the overall expression profile rather than activation. Collectively, BmToll9-1 exhibits a preferential response to E. coli.
Previous research has shown that E. coli induces the expression of BmToll9-1 [30]. A similar response to E. coli was observed in our recent functional characterization of BmToll9-2, a gene phylogenetically very closest to BmToll9-1. In that study, E. coli strongly induced the expression of BmToll9-2 in silkworm larvae [34]. RNAi-mediated silencing of BmToll9-2 led to a greater reduction in the expression of AMP genes by E. coli compared to S. aureus, together with a more significant reduction in antibacterial activity against E. coli [35]. Given the functional and phylogenetic similarity between BmToll9-1 and BmToll9-2, it is understandable that BmToll9-1 is also specifically activated by Gram-negative bacteria.

4.3. BmToll9-1 and BmToll9-2 Have Separate Functions in the Silkworm Gut

Previously, we reported that the BmToll9-1 and BmToll9-2 genes in silkworms likely function as positive regulators of humoral immunity [6,35]. RNAi targeting of either BmToll9-1 or BmToll9-2 significantly reduced the expression of Toll pathway signaling genes and downstream AMP genes. Additionally, the activation of these genes exhibited a preferential response to Gram-negative bacteria [6,35]. Phylogenetic analyses further revealed that BmToll9-1 and BmToll9-2 are highly homologous in terms of their evolutionary relationships, suggesting they may be involved in immune regulation through functional redundancy [34].
The results of the cross-validation experiments indicated that silencing the BmToll9-1 gene had no effect on the expression of BmToll9-2, and conversely, silencing the BmToll9-2 gene did not affect the expression of BmToll9-1 (Figure 5). This finding suggests that, regardless of the functional and phylogenetic similarities between BmToll9-1 and BmToll9-2, their regulatory pathways do not affect each other’s expression, i.e., they are independent. Combined with the structural differences observed in these genes [34], our current research supports the idea that BmToll9-1 and BmToll9-2 represent two different and independent inputs to regulate immunity and development. Double knockdown studies need to be performed to establish whether both genes can have synergic effects.

5. Conclusions

This study delved into the role of the BmToll9-1 gene as a bacterial sensor in regulating larval development and Toll signaling pathways. Silencing of BmToll9-1 reduced the expression of signaling genes in the Toll pathway and downstream effector genes. However, bacterial challenge following the injection of dsBmToll9-1 reinduced the expression of BmToll9-1, which restored the weight and size of the silkworms. Furthermore, it was observed that E. coli induced a higher fold change in the expression of Toll signaling and AMP genes compared to S. aureus. These findings suggest that BmToll9-1 positively regulates the Toll signaling pathway, and that it is preferentially activated by the Gram-negative bacteria E. coli. This study also provided preliminary evidence that BmToll9-1 (as well as BmToll9-2, as previously reported) activates the Toll pathway and a nearly identical set of effector genes. These two genes do not influence each other’s expression, paving the way for further investigation of their potential synergistic functions.

Author Contributions

Conceptualization, J.L.; data curation, J.L., W.C., M.L., J.C. and L.S.; funding acquisition, J.L.; investigation, J.L., W.C., M.L. and J.C.; methodology, J.L., W.C., M.L. and J.C.; project administration, J.L.; supervision, J.L.; validation, J.L., W.C., M.L. and J.C.; visualization, J.L.; writing—original draft preparation, J.L., W.C. and L.S.; writing—review and editing, J.L. and L.S. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (31501898), Science and Technology Program of Guangzhou (202102010465), Featured Innovation Project of Universities in Guangdong Province (2019KTSCX133), Natural Science Foundation of Guangdong Province (2017A030313152), Pearl River S&T Nova Program of Guangzhou (201710010094), Guangzhou University’s Exploration Experiment Construction Project (SJ202412), and Guangzhou University 2024 Education and Teaching Reform Project (JY202442).

Data Availability Statement

The raw data supporting the conclusions of this article will be made available from the corresponding author upon reasonable request.

Acknowledgments

We thank Qingrong Li for providing the silkworm culture.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Merkling, S.H.; van Rij, R.P. Beyond RNAi: Antiviral defense strategies in Drosophila and mosquito. J. Insect Physiol. 2013, 59, 159–170. [Google Scholar] [CrossRef] [PubMed]
  2. Chintapalli, R.T.V.; Hillyer, J.F. Hemolymph circulation in insect flight appendages: Physiology of the wing heart and circulatory flow in the wings of the mosquito, Anopheles gambiae. J. Exp. Biol. 2016, 219, 3945–3951. [Google Scholar] [CrossRef] [PubMed]
  3. Cheng, T.C.; Zhang, Y.L.; Liu, C.; Xu, P.Z.; Gao, Z.H.; Xia, Q.Y.; Xiang, Z.H. Identification and analysis of Toll-related genes in the domesticated silkworm, Bombyx mori. Dev. Comp. Immunol. 2008, 32, 464–475. [Google Scholar] [CrossRef] [PubMed]
  4. Nüsslein-Volhard, C.; Lohs-Schardin, M.; Sander, K.; Cremer, C. A dorso-ventral shift of embryonic primordia in a new maternal-effect mutant of Drosophila. Nature 1980, 283, 474–476. [Google Scholar] [CrossRef]
  5. Gay, N.J.; Keith, F.J. Drosophila Toll and IL-1 receptor. Nature 1991, 351, 355–356. [Google Scholar] [CrossRef]
  6. Liu, J.; Chen, W.; Situ, J.; Li, J.; Chen, J.; Lai, M.; Huang, F.; Li, B. BmToll9-1 is a positive regulator of the immune response in the silkworm Bombyx mori. Insects 2024, 15, 643. [Google Scholar] [CrossRef]
  7. Hashimoto, C.; Hudson, K.L.; Anderson, K.V. The Toll gene of Drosophila, required for dorsal-ventral embryonic polarity, appears to encode a transmembrane protein. Cell 1988, 52, 269–279. [Google Scholar] [CrossRef]
  8. Valanne, S.; Wang, J.; Rämet, M. The Drosophila Toll Signaling Pathway. J. Immunol. 2011, 186, 649–656. [Google Scholar] [CrossRef]
  9. Nonaka, S.; Kawamura, K.; Hori, A.; Salim, E.; Fukushima, K.; Nakanishi, Y.; Kuraishi, T. Characterization of Spz5 as a novel ligand for Drosophila Toll-1 receptor. Biochem. Biophys. Res. Commun. 2018, 506, 510–515. [Google Scholar] [CrossRef]
  10. Chowdhury, M.; Li, C.F.; He, Z.; Lu, Y.; Liu, X.S.; Wang, Y.F.; Ip, Y.T.; Strand, M.R.; Yu, X.Q. Toll family members bind multiple Spatzle proteins and activate antimicrobial peptide gene expression in Drosophila. J. Biol. Chem. 2019, 294, 10172–10181. [Google Scholar] [CrossRef]
  11. Eldon, E.; Kooyer, S.; D’Evelyn, D.; Duman, M.; Lawinger, P.; Botas, J.; Bellen, H. The Drosophila 18 wheeler is required for morphogenesis and has striking similarities to Toll. Development 1994, 120, 885–899. [Google Scholar] [CrossRef] [PubMed]
  12. Tauszig, S.; Jouanguy, E.; Hoffmann, J.A.; Imler, J.-L. Toll-related receptors and the control of antimicrobial peptide expression in Drosophila. Proc. Natl. Acad. Sci. USA 2000, 97, 10520–10525. [Google Scholar] [CrossRef]
  13. Ooi, J.Y.; Yagi, Y.; Hu, X.; Ip, Y.T. The Drosophila Toll-9 activates a constitutive antimicrobial defense. EMBO Rep. 2002, 3, 82–87. [Google Scholar] [CrossRef]
  14. Bettencourt, R.; Tanji, T.; Yagi, Y.; Ip, Y.T. Toll and Toll-9 in Drosophila innate immune response. J. Endotoxin Res. 2004, 10, 261–268. [Google Scholar] [CrossRef]
  15. Solbakken, M.H.; Tørresen, O.K.; Nederbragt, A.J.; Seppola, M.; Gregers, T.F.; Jakobsen, K.S.; Jentoft, S. Evolutionary redesign of the Atlantic cod (Gadus morhua L.) Toll-like receptor repertoire by gene losses and expansions. Sci. Rep. 2016, 6, 25211. [Google Scholar] [CrossRef]
  16. Williams, M.J. The 18-wheeler mutation reveals complex antibacterial gene regulation in Drosophila host defense. EMBO J. 1997, 16, 6120–6130. [Google Scholar] [CrossRef] [PubMed]
  17. Kambris, Z.; Hoffmann, J.A.; Imler, J.-L.; Capovilla, M. Tissue and stage-specific expression of the Tolls in Drosophila embryos. Gene Expr. Patterns 2002, 2, 311–317. [Google Scholar] [CrossRef] [PubMed]
  18. Kolesnikov, T.; Beckendorf, S.K. 18 Wheeler regulates apical constriction of salivary gland cells via the Rho-GTPase-signaling pathway. Dev. Biol. 2007, 307, 53–61. [Google Scholar] [CrossRef]
  19. Seppo, A.; Matani, P.; Sharrow, M.; Tiemeyer, M. Induction of neuron-specific glycosylation by Tollo/Toll-8, a Drosophila Toll-like receptor expressed in non-neural cells. Development 2003, 130, 1439–1448. [Google Scholar] [CrossRef]
  20. Kim, S.; Chung, S.; Yoon, J.; Choi, K.W.; Yim, J. Ectopic expression of Tollo/Toll-8 antagonizes Dpp signaling and induces cell sorting in the Drosophila wing. Genesis 2006, 44, 541–549. [Google Scholar] [CrossRef]
  21. Aronstein, K.A.; Saldivar, E. Characterization of a honey bee Toll related receptor gene Am18w and its potential involvement in antimicrobial immune defense. Apidologie 2005, 36, 3–14. [Google Scholar] [CrossRef]
  22. Christophides, G.K.; Zdobnov, E.; Barillas-Mury, C.; Birney, E.; Blandin, S.; Blass, C.; Brey, P.T.; Collins, F.H.; Danielli, A.; Dimopoulos, G.; et al. Immunity-Related Genes and Gene Families in Anopheles gambiae. Science 2002, 298, 159–165. [Google Scholar] [CrossRef] [PubMed]
  23. Zou, Z.; Evans, J.D.; Lu, Z.; Zhao, P.; Williams, M.; Sumathipala, N.; Hetru, C.; Hultmark, D.; Jiang, H. Comparative genomic analysis of the Tribolium immune system. Genome Biol. 2007, 8, R177. [Google Scholar] [CrossRef]
  24. Tanaka, H.; Ishibashi, J.; Fujita, K.; Nakajima, Y.; Sagisaka, A.; Tomimoto, K.; Suzuki, N.; Yoshiyama, M.; Kaneko, Y.; Iwasaki, T.; et al. A genome-wide analysis of genes and gene families involved in innate immunity of Bombyx mori. Insect Biochem. Mol. Biol. 2008, 38, 1087–1110. [Google Scholar] [CrossRef]
  25. Xia, Q.; Zhou, Z.; Lu, C.; Cheng, D.; Dai, F.; Li, B.; Zhao, P.; Zha, X.; Cheng, T.; Chai, C.; et al. A draft sequence for the genome of the domesticated silkworm (Bombyx mori). Science 2004, 306, 1937–1940. [Google Scholar] [PubMed]
  26. Mita, K.; Kasahara, M.; Sasaki, S.; Nagayasu, Y.; Yamada, T.; Kanamori, H.; Namiki, N.; Kitagawa, M.; Yamashita, H.; Yasukochi, Y.; et al. The genome sequence of silkworm, Bombyx mori. DNA Res. 2004, 11, 27–35. [Google Scholar] [CrossRef]
  27. Liu, J.; Yang, Q.; Yang, Y.; Lin, X. Larval RNA Interference in Silkworm Bombyx mori through Chitosan/dsRNA Nanoparticle Delivery. J. Vis. Exp. 2024, 212, e67360. [Google Scholar] [CrossRef]
  28. Yang, W.; Lin, Y.; He, Y.; Li, Q.; Chen, W.; Lin, Q.; Swevers, L.; Liu, J. BmPGPR-L4 is a negative regulator of the humoral immune response in the silkworm Bombyx mori. Arch. Insect Biochem. Physiol. 2024, 115, e22093. [Google Scholar] [CrossRef]
  29. Liu, J.; Yang, Y.; Yang, Q.; Lin, X.; Liu, Y.; Li, Z.; Swevers, L. Successful oral RNA interference efficiency in the silkworm Bombyx mori through nanoparticle-shielded dsRNA delivery. J. Vis. Exp. JoVE 2025, 161, 104749. [Google Scholar] [CrossRef]
  30. Wu, S.; Zhang, X.; Chen, X.; Cao, P.; Beerntsen, B.T.; Ling, E. BmToll9, an Arthropod conservative Toll, is likely involved in the local gut immune response in the silkworm, Bombyx mori. Dev. Comp. Immunol. 2010, 34, 93–96. [Google Scholar] [CrossRef]
  31. Liu, J.; Smagghe, G.; Swevers, L. Transcriptional response of BmToll9-1 and RNAi machinery genes to exogenous dsRNA in the midgut of Bombyx mori. J. Insect Physiol. 2013, 59, 646–654. [Google Scholar] [CrossRef] [PubMed]
  32. Liu, J.; Kolliopoulou, A.; Smagghe, G.; Swevers, L. Modulation of the transcriptional response of innate immune and RNAi genes upon exposure to dsRNA and LPS in silkmoth-derived Bm5 cells overexpressing BmToll9-1 receptor. J. Insect Physiol. 2014, 66, 10–19. [Google Scholar] [CrossRef]
  33. Zhang, R.; Li, X.; Zhang, J.; Li, Y.; Wang, Y.; Song, Y.; Ren, F.; Yi, H.; Deng, X.; Zhong, Y.; et al. Toll9 from Bombyx mori functions as a pattern recognition receptor that shares features with Toll-like receptor 4 from mammals. Proc. Natl. Acad. Sci. USA 2021, 118, e2103021118. [Google Scholar] [CrossRef]
  34. Liu, J.; Yang, W.; Liao, W.; Huang, Y.; Chen, W.; Bu, X.; Huang, S.; Jiang, W.; Swevers, L. Immunological function of Bombyx Toll9-2 in the silkworm (Bombyx mori) larval midgut: Activation by Escherichia coli/lipopolysaccharide and regulation of growth. Arch. Insect Biochem. Physiol. 2024, 116, e22130. [Google Scholar] [CrossRef] [PubMed]
  35. Liu, J.; Chen, W.; Chen, S.; Li, S.; Swevers, L. Similarly to BmToll9-1, BmToll9-2 Is a Positive Regulator of the Humoral Immune Response in the Silkworm, Bombyx mori. Insects 2024, 15, 1005. [Google Scholar] [CrossRef]
  36. Geng, T.; Huang, Y.; Hou, C.; Qin, G.; Lv, D.; Guo, X. Inductive expression patterns of genes related to Toll signaling pathway in silkworm ( Bombyx mori ) upon Beauveria bassiana infection. J. Asia-Pac. Entomol. 2016, 19, 861–868. [Google Scholar] [CrossRef]
  37. Wang, G.H.; Xia, Q.Y.; Cheng, D.J.; Duan, J.; Zhao, P.; Chen, J.; Zhu, L. Reference genes identified in the silkworm Bombyx mori during metamorphism based on oligonucleotide microarray and confirmed by qRT-PCR. Insect Sci. 2008, 15, 405–413. [Google Scholar] [CrossRef]
  38. Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  39. Wu, S.; Zhang, X.; He, Y.; Shuai, J.; Chen, X.; Ling, E. Expression of antimicrobial peptide genes in Bombyx mori gut modulated by oral bacterial infection and development. Dev. Comp. Immunol. 2010, 34, 1191–1198. [Google Scholar] [CrossRef]
  40. Liang, Y.; Wang, T.; Yang, W.; Chen, Z.; Li, Q.; Swevers, L.; Liu, J. Silencing of the immune gene BmPGRP-L4 in the midgut affects the growth of silkworm (Bombyx mori) larvae. Insect Mol. Biol. 2023, 32, 340–351. [Google Scholar] [CrossRef]
  41. Qiao, H.; Keesey, I.W.; Hansson, B.S.; Knaden, M. Gut microbiota affects development and olfactory behavior in Drosophila melanogaster. J. Exp. Biol. 2019, 222, jeb.192500. [Google Scholar] [CrossRef] [PubMed]
  42. Guo, B.; Tang, J.; Ding, G.; Mashilingi, S.K.; Huang, J.; An, J. Gut microbiota is a potential factor in shaping phenotypic variation in larvae and adults of female bumble bees. Front. Microbiol. 2023, 14, 1117077. [Google Scholar] [CrossRef] [PubMed]
  43. Bai, S.; Yao, Z.; Raza, M.F.; Cai, Z.; Zhang, H. Regulatory mechanisms of microbial homeostasis in insect gut. Insect Sci. 2021, 28, 286–301. [Google Scholar] [CrossRef] [PubMed]
Insects 16 00621 g001
Figure 1. The relative expression of BmToll9-1 in the midgut of 5th instar larvae injected with dsBmToll9-1 and fed a diet containing heat-inactivated (A) E. coli or (B) S. aureus, compared to the negative control, i.e., larvae treated with dsGFP. The data were presented as means ± standard deviations of three biological replicates. The asterisks indicate significant differences from the dsGFP injection groups: *** p < 0.001, and **** p < 0.0001.
Figure 1. The relative expression of BmToll9-1 in the midgut of 5th instar larvae injected with dsBmToll9-1 and fed a diet containing heat-inactivated (A) E. coli or (B) S. aureus, compared to the negative control, i.e., larvae treated with dsGFP. The data were presented as means ± standard deviations of three biological replicates. The asterisks indicate significant differences from the dsGFP injection groups: *** p < 0.001, and **** p < 0.0001.
Insects 16 00621 g001
Insects 16 00621 g002
Figure 2. Weight and phenotype changes in B. mori 5th instar larvae, following heat-inactivated bacteria feeding treatment after injection with dsBmToll9-1, compared to control larvae injected with dsGFP. Average weight of silkworm larvae on different days after feeding on (A) E. coli or (C) S. aureus, following BmToll9-1 silencing. Growth phenotype of silkworm larvae on 4th day after feeding on heat-inactivated (B) E. coli or (D) S. aureus, following BmToll9-1 silencing.
Figure 2. Weight and phenotype changes in B. mori 5th instar larvae, following heat-inactivated bacteria feeding treatment after injection with dsBmToll9-1, compared to control larvae injected with dsGFP. Average weight of silkworm larvae on different days after feeding on (A) E. coli or (C) S. aureus, following BmToll9-1 silencing. Growth phenotype of silkworm larvae on 4th day after feeding on heat-inactivated (B) E. coli or (D) S. aureus, following BmToll9-1 silencing.
Insects 16 00621 g002
Insects 16 00621 g003
Figure 3. The relative expression of the signaling genes in the Toll pathway in B. mori 5th instar larvae, following a heat-inactivated (A) E. coli or (B) S. aureus feeding treatment after injection with dsBmToll9-1, compared to control larvae injected with dsGFP. Data were presented as means ± standard deviations of three biological replicates. Asterisks indicate significant differences towards the dsGFP injection groups: * p < 0.05, ** p < 0.01, and *** p < 0.001.
Figure 3. The relative expression of the signaling genes in the Toll pathway in B. mori 5th instar larvae, following a heat-inactivated (A) E. coli or (B) S. aureus feeding treatment after injection with dsBmToll9-1, compared to control larvae injected with dsGFP. Data were presented as means ± standard deviations of three biological replicates. Asterisks indicate significant differences towards the dsGFP injection groups: * p < 0.05, ** p < 0.01, and *** p < 0.001.
Insects 16 00621 g003
Insects 16 00621 g004
Figure 4. The relative expression of the immune effector genes in B. mori 5th instar larvae, following a heat-inactivated (A) E. coli or (B) S. aureus feeding treatment after an injection with dsBmToll9-1, compared to control larvae injected with dsGFP. The data were presented as means ± standard deviations of three biological replicates. The asterisks indicate significant differences towards the dsGFP injection groups: * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001.
Figure 4. The relative expression of the immune effector genes in B. mori 5th instar larvae, following a heat-inactivated (A) E. coli or (B) S. aureus feeding treatment after an injection with dsBmToll9-1, compared to control larvae injected with dsGFP. The data were presented as means ± standard deviations of three biological replicates. The asterisks indicate significant differences towards the dsGFP injection groups: * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001.
Insects 16 00621 g004
Insects 16 00621 g005
Figure 5. Relative expression of BmToll9-1 and BmToll9-2 genes silenced by each other in B. mori 5th instar larvae. (A) Relative expression of BmToll9-1 in dsBmToll9-2-injected larvae. (B) Relative expression of BmToll9-2 in dsBmToll9-1-injected larvae. Data were presented as means ± standard deviations of three biological replicates. ns—not significant.
Figure 5. Relative expression of BmToll9-1 and BmToll9-2 genes silenced by each other in B. mori 5th instar larvae. (A) Relative expression of BmToll9-1 in dsBmToll9-2-injected larvae. (B) Relative expression of BmToll9-2 in dsBmToll9-1-injected larvae. Data were presented as means ± standard deviations of three biological replicates. ns—not significant.
Insects 16 00621 g005
Table 1. List of primers used in this study.
Table 1. List of primers used in this study.
GeneAccession NumberPrimer Sequence (5′-3′)Amplicon Size (bp)
Primers for qRT-PCR
BmToll9-1PP496203F: CGCAGACCGTTGAGTACATG149
R: CCAGACTGTCGTACCTTGGT
BmToll9-2PP716770F: GGTTACAAGCGAACGGTAGC80
R: CCAAATATCCGGACTGCTGC
BmTIF4ADQ443290F: TTCGTACTGGCTCTTCTCGT174
R: CAAAGTTGATAGCAATTCCCT
BmTIF3s4DQ443238F: ACTTCAAGTTCAGGGCAGAT110
R: TTAATTGTTTTGTGGAGGCT
Signaling
BmMyD88XM_028186400F: AACGGTCACGACTCGAACTC105
R: TCTGCCCAGATTCTTCATCC
BmTubeXM_028173146F: GGCAGAAAGTTATGGCTTGG82
R: ATCCTCAAATGCTCGCTGTT
BmPelleXM_028182154F: ACATCAAGCCGGCTAACATC117
R: ACCGTGAGACCTTCAGATGC
BmCactusXM_028180230F: ACAGTCGTGCGTACATTTGG97
R: CAGCCTCTCCCTATCGTCAA
BmTollip-dXM_021351983F: GACGAGTCAGTCCCTCTTGC92
R: GTGGCTGGTGGAATTCGTAG
BmTollip-vXM_028186930F: TGCTACTTCTGACGGTGTGG91
R: AGGGCCACTTTGTGGTACTG
BmPellinoXM_028184930F: AGAGTCGCTCAGCACAACAA95
R: CAATGTGGCTCCACACAGAT
BmTRAF2XM_028172769F: TCGCTCCTATGGGCATAACT118
R: CCGCATGTTGTGATTACTGG
BmECSITXM_028171307F: ATGCCGCCTTAGCTAGAATG86
R: GCCTTTGGGCAGTACGTCTA
Effectors
BmAttacin1NM_001043541F: CAGTGAACTCGGATGGAACC97
(BmAtt1) R: GGCGCTGAGTACGTTCTTGT
BmCecropinANM_001043997F: CCGTCATAGGGCAAGCGAAA230
(BmCecA) R: AGCAATGACTGTGGTATGTCAA
BmDefensinAB_367525F: GTTAAGTGCGGCGTTGACTG104
(BmDef) R: TGACAGGGAAAGTGGAAGGG
BmGloverin1AB_289654F: GCTGGGATAGAAGCATCAGC107
(BmGlv1) R: ACATCAGGCCTTCTGTGACC
BmMoricinAB_006915F: TGTGGCAATGTCTCTGGTGT117
(BmMor) R: CTGGCGATATTGATGGCTCT
BmLebocin3NM_001126260F: CTCGATCCAAACCGAAGGTA105
(BmLeb3) R: CGGCTGGTCAAGTCCAGTAT
BmEnbocinFJ373019F: ACCTCGCACAACTAGTTCGG116
(BmEnb) R: CCAACAGAACAAACCCACTCG
BmLysozymeNM_001043983F: TAACGGCTCGAAGGACTACG103
(BmLys) R: GAGGTCGGAGCACTTAACGT
Lysozyme-like proteinXM_012696687F: GTTTAATCGAGCAGGGCAGC120
(BmLLP3) R: CACCCTTGCGACCTTCTTTG
Phenoloxidase inhibitorXR_001139981F: GGATACGTGACTGGAAATGCA102
(BmPOI) R: GTCATAATCCACGGGTTTGTCC
Prophenoloxidase 1AF_178462F: AGTGGGAAGCCATTCTCCTT81
(BmPPO1) R: GCCAGGTTTCACTCCTTGAG
Nitric oxide synthase 1XM_012689821F: TCATCACCACTAGCGCATCC102
(BmNOS1) R: CCTTGTCCGTTCTGTGTCCT
Primers for dsRNA synthesis
T7-BmToll9-1 F: TAATACGACTCACTATAGG531
ACTATAGGCACAGGTCGGGT
R: TAATACGACTCACTATAGG
TCGTTGTCCCATTCGCTGAT
T7-BmToll9-2 F: TAATACGACTCACTATAGG581
TAGTATTCTCCCGGCTCTC
R: TAATACGACTCACTATAGG
GAAGGGTGCCTTGTGTAATC
T7-GFP F: TAATACGACTCACTATAGG495
TACGGCGTGCAGTGCT
R: TAATACGACTCACTATAGG
TGATCGCGCTTCTCG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Liu, J.; Chen, W.; Lai, M.; Chen, J.; Swevers, L. Activation of BmToll9-1 in Silkworm (Bombyx mori) Larval Midgut by Escherichia coli and Regulation of Growth. Insects 2025, 16, 621. https://doi.org/10.3390/insects16060621

AMA Style

Liu J, Chen W, Lai M, Chen J, Swevers L. Activation of BmToll9-1 in Silkworm (Bombyx mori) Larval Midgut by Escherichia coli and Regulation of Growth. Insects. 2025; 16(6):621. https://doi.org/10.3390/insects16060621

Chicago/Turabian Style

Liu, Jisheng, Weijian Chen, Minchun Lai, Jiahua Chen, and Luc Swevers. 2025. "Activation of BmToll9-1 in Silkworm (Bombyx mori) Larval Midgut by Escherichia coli and Regulation of Growth" Insects 16, no. 6: 621. https://doi.org/10.3390/insects16060621

APA Style

Liu, J., Chen, W., Lai, M., Chen, J., & Swevers, L. (2025). Activation of BmToll9-1 in Silkworm (Bombyx mori) Larval Midgut by Escherichia coli and Regulation of Growth. Insects, 16(6), 621. https://doi.org/10.3390/insects16060621

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop