Extraction-Free Colorimetric RT-LAMP Detection of SARS-CoV-2 in Saliva
Abstract
1. Introduction
2. Materials and Methods
2.1. Reference Method (RT-qPCR)
2.2. RT-LAMP
2.2.1. Saliva Samples
2.2.2. Saliva Samples Processing
2.2.3. RT-LAMP Mixes, Primer Sets and Measure Principles
2.2.4. In-House RT-LAMP Detection
2.2.5. Limit of Detection in Saliva and Validation of Different RT-LAMP Assays
3. Results and Discussion
3.1. Limit of Detection and Specificity of the Newly Designed RT-LAMP Primers
3.2. Sample Pretreatment Optimization
3.3. Limit of Detection with Clinical Samples
3.4. Clinical Validation of the Colorimetric RT-LAMP
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Mohammed, F.S.; Uysal, I.; Sevindik, M. A Review on Antiviral Plants Effective against Different Virus Types. Prospect. Pharm. Sci. 2023, 21, 1–21. [Google Scholar] [CrossRef]
- Coronavirus Disease (COVID-19) Pandemic. Available online: https://www.who.int/europe/emergencies/situations/covid-19 (accessed on 5 July 2022).
- World Health Organization. Laboratory Testing for Coronavirus Disease (COVID-19) in Suspected Human Cases: Interim Guidance; World Health Organization: Geneva, Switzerland, 2020; pp. 1–7. [Google Scholar]
- Zhang, H.; Xu, Y.; Fohlerova, Z.; Chang, H.; Iliescu, C.; Neuzil, P. LAMP-on-a-chip: Revising microfluidic platforms for loop-mediated DNA amplification. TrAC Trends Anal. Chem. 2019, 113, 44–53. [Google Scholar] [CrossRef] [PubMed]
- Song, Q.; Sun, X.; Dai, Z.; Gao, Y.; Gong, X.; Zhou, B.; Wu, J.; Wen, W. Point-of-care testing detection methods for COVID-19. Lab Chip 2021, 21, 1634–1660. [Google Scholar] [CrossRef] [PubMed]
- Azmi, I.; Faizan, M.I.; Kumar, R.; Raj Yadav, S.; Chaudhary, N.; Kumar Singh, D.; Butola, R.; Ganotra, A.; Datt Joshi, G.; Deep Jhingan, G.; et al. A Saliva-Based RNA Extraction-Free Workflow Integrated with Cas13a for SARS-CoV-2 Detection. Front. Cell. Infect. Microbiol. 2021, 11, 632646. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.K.; Chang, S.H. Clinical usefulness of extraction-free PCR assay to detect SARS-CoV-2. J. Virol. Methods 2021, 296, 114217. [Google Scholar] [CrossRef] [PubMed]
- Mahmoud, S.A.; Ganesan, S.; Ibrahim, E.; Thakre, B.; Teddy, J.G.; Raheja, P.; Abbas, W.Z. Evaluation of RNA Extraction-Free Method for Detection of SARS-CoV-2 in Salivary Samples for Mass Screening for COVID-19. BioMed Res. Int. 2021, 2021, 5568350. [Google Scholar] [CrossRef]
- Guidance for Antigen Testing for SARS-CoV-2 for Healthcare Providers Testing Individuals in the Community|CDC. Available online: https://www.cdc.gov/coronavirus/2019-ncov/lab/resources/antigen-tests-guidelines.html#print (accessed on 11 May 2023).
- Cubas-Atienzar, A.I.; Kontogianni, K.; Edwards, T.; Wooding, D.; Buist, K.; Thompson, C.R.; Williams, C.T.; Patterson, E.I.; Hughes, G.L.; Baldwin, L.; et al. Limit of detection in different matrices of 19 commercially available rapid antigen tests for the detection of SARS-CoV-2. Sci. Rep. 2021, 11, 18313. [Google Scholar] [CrossRef]
- Oliveira, B.B.; Veigas, B.; Baptista, P.V. Isothermal Amplification of Nucleic Acids: The Race for the Next “Gold Standard”. Front. Sens. 2021, 2, 752600. [Google Scholar] [CrossRef]
- Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-Mediated Isothermal Amplification of DNA. Nucleic Acids Res. 2000, 28, e63. [Google Scholar] [CrossRef]
- Zhou, Q.; Lu, J.; Su, X.; Jin, J.; Li, S.; Zhou, Y.; Wang, L.; Shao, X.; Wang, Y.; Yan, M.; et al. Simultaneous detection of multiple bacterial and viral aquatic pathogens using a fluorogenic loop-mediated isothermal amplification-based dual-sample microfluidic chip. J. Fish Dis. 2020, 44, 401–413. [Google Scholar] [CrossRef]
- Nawattanapaiboon, K.; Pasomsub, E.; Prombun, P.; Wongbunmak, A.; Jenjitwanich, A.; Mahasupachai, P.; Vetcho, P.; Chayrach, C.; Manatjaroenlap, N.; Samphaongern, C.; et al. Colorimetric reverse transcription loop-mediated isothermal amplification (RT-LAMP) as a visual diagnostic platform for the detection of the emerging coronavirus SARS-CoV-2. Analyst 2020, 146, 471–477. [Google Scholar] [CrossRef] [PubMed]
- Rivas-Macho, A.; Eletxigerra, U.; Diez-Ahedo, R.; Merino, S.; Sanjuan, A.; Bou-Ali, M.M.; Ruiz-Rubio, L.; del Campo, J.; Vilas-Vilela, J.L.; Goñi-De-Cerio, F.; et al. Design and 3D printing of an electrochemical sensor for Listeria monocytogenes detection based on loop mediated isothermal amplification. Heliyon 2023, 9, e12637. [Google Scholar] [CrossRef] [PubMed]
- Olabarria, G.; Eletxigerra, U.; Rodriguez, I.; Bilbao, A.; Berganza, J.; Merino, S. Highly sensitive and fast Legionella spp. in situ detection based on a loop mediated isothermal amplification technique combined to an electrochemical transduction system. Talanta 2020, 217, 121061. [Google Scholar] [CrossRef] [PubMed]
- Howson, E.L.; Kidd, S.P.; Armson, B.; Goring, A.; Sawyer, J.; Cassar, C.; Cross, D.; Lewis, T.; Hockey, J.; Rivers, S.; et al. Preliminary optimisation of a simplified sample preparation method to permit direct detection of SARS-CoV-2 within saliva samples using reverse-transcription loop-mediated isothermal amplification (RT-LAMP). J. Virol. Methods 2021, 289, 114048. [Google Scholar] [CrossRef]
- Lu, R.; Wu, X.; Wan, Z.; Li, Y.; Jin, X.; Zhang, C. A Novel Reverse Transcription Loop-Mediated Isothermal Amplification Method for Rapid Detection of SARS-CoV-2. Int. J. Mol. Sci. 2020, 21, 2826. [Google Scholar] [CrossRef]
- Baba, M.M.; Bitew, M.; Fokam, J.; Lelo, E.A.; Ahidjo, A.; Asmamaw, K.; Beloumou, G.A.; Bulimo, W.D.; Buratti, E.; Chenwi, C.; et al. Diagnostic performance of a colorimetric RT-LAMP for the identification of SARS-CoV-2: A multicenter prospective clinical evaluation in sub-Saharan Africa. eClinicalMedicine 2021, 40, 101101. [Google Scholar] [CrossRef]
- Anahtar, M.N.; McGrath, G.E.G.; Rabe, B.A.; Tanner, N.A.; White, B.A.; Lennerz, J.K.M.; Branda, J.A.; Cepko, C.L.; Rosenberg, E.S. Clinical Assessment and Validation of a Rapid and Sensitive SARS-CoV-2 Test Using Reverse Transcription Loop-Mediated Isothermal Amplification without the Need for RNA Extraction. Open Forum Infect. Dis. 2020, 8, ofaa631. [Google Scholar] [CrossRef]
- Raddatz, B.W.; Rabello, F.J.; Benedetti, R.; Steil, G.J.; Imamura, L.M.; Kim, E.Y.S.; Santiago, E.B.; Hartmann, L.F.; Predebon, J.V.; Delfino, B.M.; et al. Clinical Validation of a Colorimetric Loop-Mediated Isothermal Amplification Using a Portable Device for the Rapid Detection of SARS-CoV-2. Diagnostics 2023, 13, 1355. [Google Scholar] [CrossRef]
- Uribe-Alvarez, C.; Lam, Q.; Baldwin, D.A.; Chernoff, J. Low saliva pH can yield false positives results in simple RT-LAMP-based SARS-CoV-2 diagnostic tests. PLoS ONE 2021, 16, e0250202. [Google Scholar] [CrossRef]
- Wang, B.; Gan, Q.; Tong, Y.; Qiao, Y.; Han, M.; Zhang, R.; Han, Q.; Li, C.; Bai, S.; Xu, L.; et al. A visual diagnostic detection of Helicobacter pylori and the gastric carcinoma-related virulence genes (cagA and vacA) by a fluorescent loop-mediated isothermal amplification (LAMP). Talanta 2023, 256, 124260. [Google Scholar] [CrossRef]
- Corman, V.M.; Landt, O.; Kaiser, M.; Molenkamp, R.; Meijer, A.; Chu, D.K.W.; Bleicker, T.; Brünink, S.; Schneider, J.; Schmidt, M.L.; et al. Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR. EuroSurveillance 2020, 25, 2000045. [Google Scholar] [CrossRef] [PubMed]
- Tomita, N.; Mori, Y.; Kanda, H.; Notomi, T. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nat. Protoc. 2008, 3, 877–882. [Google Scholar] [CrossRef] [PubMed]
- Hanson, K.E.; Barker, A.P.; Hillyard, D.R.; Gilmore, N.; Barrett, J.W.; Orlandi, R.R.; Shakirb, S.M. Self-Collected Anterior Nasal and Saliva Specimens versus Health Care Worker-Collected Nasopharyngeal Swabs for the Molecular Detection of SARS-CoV-2. J. Clin. Microbiol. 2020, 58, 11. [Google Scholar] [CrossRef]
- Tan, S.H.; Allicock, O.; Armstrong-Hough, M.; Wyllie, A.L. Saliva as a gold-standard sample for SARS-CoV-2 detection. Lancet Respir. Med. 2021, 9, 562–564. [Google Scholar] [CrossRef]
- Vogels, C.B.; Watkins, A.E.; Harden, C.A.; Brackney, D.E.; Shafer, J.; Wang, J.; Caraballo, C.; Kalinich, C.C.; Ott, I.M.; Fauver, J.R.; et al. SalivaDirect: A simplified and flexible platform to enhance SARS-CoV-2 testing capacity. Med 2021, 2, 263–280. [Google Scholar] [CrossRef] [PubMed]
- Yoshikawa, R.; Abe, H.; Igasaki, Y.; Negishi, S.; Goto, H.; Yasuda, J. Development and evaluation of a rapid and simple diagnostic assay for COVID-19 based on loop-mediated isothermal amplification. PLoS Neglect. Trop. Dis. 2020, 14, e0008855. [Google Scholar] [CrossRef]
- Amaral, C.; Antunes, W.; Moe, E.; Duarte, A.G.; Lima, L.M.P.; Santos, C.; Gomes, I.L.; Afonso, G.S.; Vieira, R.; Teles, H.S.S.; et al. A molecular test based on RT-LAMP for rapid, sensitive and inexpensive colorimetric detection of SARS-CoV-2 in clinical samples. Sci. Rep. 2021, 11, 16430. [Google Scholar] [CrossRef]
- Lalli, M.A.; Langmade, J.S.; Chen, X.; Fronick, C.C.; Sawyer, C.S.; Burcea, L.C.; Wilkinson, M.N.; Fulton, R.S.; Heinz, M.; Buchser, W.J.; et al. Rapid and Extraction-Free Detection of SARS-CoV-2 from Saliva by Colorimetric Reverse-Transcription Loop-Mediated Isothermal Amplification. Clin. Chem. 2021, 67, 415–424. [Google Scholar] [CrossRef]
- Batéjat, C.; Grassin, Q.; Manuguerra, J.-C.; Leclercq, I. Heat inactivation of the severe acute respiratory syndrome coronavirus 2. J. Biosaf. Biosecur. 2021, 3, 1–3. [Google Scholar] [CrossRef]



| Acronym | RT-LAMP | Premix Type | Primers | Dye | Detection | Experiment (Section) |
|---|---|---|---|---|---|---|
| IH-F | In-House RT-LAMP | Manual * | ND3B | Evagreen (25 µM) | Fluorescent | ND3B LoD (Section 3.1) Extraction-free LoD (Section 3.3) |
| IH-C | In-House Calcein RT-LAMP | Manual | ND3B | Calcein (625 µM) | Colorimetric and Fluorescent | ND3B specificity assay (Section 3.1) |
| WS-C | WarmStart-Calcein | Commercial ** | ND3B | Calcein (625 µM) | Colorimetric and Fluorescent | Clinical validation (Section 3.4) Comparative assay (Section 3.4) |
| WS-F | WarmStart-F | Commercial | ND3B NEB | Fluorescence dye ** | Fluorescent | Pre-Treatment optimization (Section 3.2) Extraction-free clinical LoD (Section 3.3) Comparative assay (Section 3.4) |
| WS-PR | WarmStart-phenol red | Commercial | NEB | pH-indicator ** | Colorimetric | Comparative assay (Section 3.4) |
| Set Name | Primer | Conc. (µM) | Sequence (5′-3′) |
|---|---|---|---|
| ND3B | F3 | 0.2 | CCTTTTACAATTAATTGCCAGGA |
| B3 | 0.2 | CCACTGCGTTCTCCATTC | |
| FIP | 1.6 | ACACGAACGTCATGATACTCTAAAAACCTAAATTGGGTAGTCTTGT | |
| BIP | 1.6 | GGACCCCAAAATCAGCGAAATTGCCAGTTGAATCTGAGG | |
| LF | 0.8 | TTCATAGAACGAACAACGCACT | |
| LB | 0.8 | GCACCCCGCATTACGTTTG | |
| Gene E1 (NEB) * | F3 | 0.2 | TGAGTACGAACTTATGTACTCAT |
| B3 | 0.2 | TTCAGATTTTTAACACGAGAGT | |
| FIP | 1.6 | ACCACGAAAGCAAGAAAAAGAAGTTCGTTTCGGAAGAGACAG | |
| BIP | 1.6 | TTGCTAGTTACACTAGCCATCCTTAGGTTTTACAAGACTCACGT | |
| LF | 0.4 | CGCTATTAACTATTAACG | |
| LB | 0.4 | GCGCTTCGATTGTGTGCGT | |
| Gene N2 (NEB) | F3 | 0.2 | ACCAGGAACTAATCAGACAAG |
| B3 | 0.2 | GACTTGATCTTTGAAATTTGGATCT | |
| FIP | 1.6 | TTCCGAAGAACGCTGAAGCGGAACTGATTACAAACATTGGCC | |
| BIP | 1.6 | CGCATTGGCATGGAAGTCACAATTTGATGGCACCTGTGTA | |
| LF | 0.4 | GGGGGCAAATTGTGCAATTTG | |
| LB | 0.4 | CTTCGGGAACGTGGTTGACC |
| RNA Copies | TTD1 | TTD2 | TTD3 | TTD4 | TTD5 | TTD6 | TTD7 | TTD8 | TTD9 | TTD10 | X | % |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1000 | 12.5 | 13.6 | 13.0 | 12.3 | 14.2 | 12.5 | 12.9 | 13.4 | 12.7 | 12.3 | 12.92 | 100 |
| 500 | 14.7 | 14.8 | 14.3 | 15.1 | 15.9 | 13.5 | 12.2 | 14.9 | 13.6 | 13.0 | 14.19 | 100 |
| 250 | 14.0 | 15.6 | 16.3 | 14.6 | 15.4 | 14.4 | 14.4 | 15.4 | 18.0 | 13.2 | 15.12 | 100 |
| 125 | 30.5 | 16.7 | 13.5 | 15.9 | 16.1 | 30.1 | 20.8 | 14.2 | 27.5 | 17.5 | 20.26 | 100 |
| 62 | 19.6 | 17.0 | 17.9 | 17.2 | 16.9 | 18.3 | 15.2 | 20.0 | 14.6 | 16.7 | 17.33 | 100 |
| 41 | 33.2 | NEG | 18.3 | 22.5 | NEG | 20.8 | 16.4 | 16.5 | 18.4 | 16.3 | 20.30 | 80 |
| 31 | 23.0 | 16.9 | NEG | 18.6 | 18.2 | 15.6 | 36.3 | NEG | 21.1 | 19.0 | 21.07 | 80 |
| 16 | 20.2 | NEG | 34.0 | NEG | 18.3 | NEG | NEG | 19.6 | NEG | 35.3 | 25.48 | 50 |
| CN | NEG | NEG | NEG | NEG | NEG | NEG | NEG | NEG | NEG | NEG | - |
| Sample | QIAGEN Kit | 95 °C 10 min | 95 °C 10 min Dil. 1/2 | QuickExtract | RT-qPCR Ct |
|---|---|---|---|---|---|
| 1 | 13.53 | 16.11 | 14.88 | 19.44 | 21.42 |
| 4 | 14.39 | 17.3 | 15.96 | 16.66 | 23.35 |
| 11 | 16.36 | 19.05 | 17.39 | 18.37 | 25.87 |
| 2 | 16.14 | 28.34 | 21.69 | 18.01 | 27.51 |
| 9 | 16.51 | 19.35 | 18.28 | 19.31 | 27.76 |
| 6 | 18.06 | 21.95 | Not detected | 19.48 | 28.21 |
| 8 | 17.23 | 19.43 | 17.72 | 18.82 | 28.37 |
| 7 | 17.19 | 19.01 | 15.54 | 17.73 | 30.07 |
| 10 | 19.24 | 22.32 | 21.63 | 21.01 | 30.89 |
| 12 | 18.38 | 22.09 | Not detected | Not detected | 31.74 |
| 5 | Not detected | Not detected | Not detected | Not detected | 35.03 |
| 3 | Not detected | Not detected | Not detected | Not detected | 36.44 |
| True Positive | True Negative | False Negative | False Positive | Sensitivity | Specificity | |
|---|---|---|---|---|---|---|
| Calcein-C | 9 | 10 | 3 | - | 75% | 100% |
| Calcein-F | 9 | 10 | 3 | - | 75% | 100% |
| WS-PR | 11 | 4 | 1 | 6 | 91% | 40% |
| WS-F | 9 | 10 | 3 | - | 75% | 100% |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rivas-Macho, A.; Sorarrain, A.; Marimón, J.M.; Goñi-de-Cerio, F.; Olabarria, G. Extraction-Free Colorimetric RT-LAMP Detection of SARS-CoV-2 in Saliva. Diagnostics 2023, 13, 2344. https://doi.org/10.3390/diagnostics13142344
Rivas-Macho A, Sorarrain A, Marimón JM, Goñi-de-Cerio F, Olabarria G. Extraction-Free Colorimetric RT-LAMP Detection of SARS-CoV-2 in Saliva. Diagnostics. 2023; 13(14):2344. https://doi.org/10.3390/diagnostics13142344
Chicago/Turabian StyleRivas-Macho, Ane, Ane Sorarrain, José M. Marimón, Felipe Goñi-de-Cerio, and Garbiñe Olabarria. 2023. "Extraction-Free Colorimetric RT-LAMP Detection of SARS-CoV-2 in Saliva" Diagnostics 13, no. 14: 2344. https://doi.org/10.3390/diagnostics13142344
APA StyleRivas-Macho, A., Sorarrain, A., Marimón, J. M., Goñi-de-Cerio, F., & Olabarria, G. (2023). Extraction-Free Colorimetric RT-LAMP Detection of SARS-CoV-2 in Saliva. Diagnostics, 13(14), 2344. https://doi.org/10.3390/diagnostics13142344

