Periostin-Induced Wnt10a Activation Promotes Dental Pulp Stem Cell Migration During Pulp Regeneration
Abstract
1. Introduction
2. Materials and Methods
2.1. Isolation of Human Dental Pulp Stem Cells
2.2. Preparation of Human Dental Pulp Stem Cell Conditioned Media
2.3. Analysis of Regenerated Tissue in a Mouse Ectopic Tooth Root Transplant Model
- (1)
- Ectopic Tooth Root Transplant Model
- (2)
- Observation of regenerated pulp-like tissue
- (3)
- Observation of Migrating Cells within the Regenerated Pulp-like Tissue
- (4)
- BrdU and Wnt10a Positive Cell Rates
- (5)
- Molecular Biological Analysis in Regenerated Tissue Genetic Analysis qPCR
2.4. Evaluation of Migrating Cells Induced by Periostin Stimulation
- (1)
- Identification of Cell Types with Migration Promoting Ability
- (2)
- Evaluation of Changes in Migrating Cell Numbers
- (3)
- Gene Expression Changes in Periostin Stimulated Cells
- (4)
- Protein Expression Analysis in Periostin Stimulated Cells
2.5. Statistical Analysis
3. Results
3.1. Evaluation of Migrated Dental Pulp Stem Cells
3.2. Evaluation of Migrating Cells Within Regenerated Dental Pulp Tissue
3.3. Evaluation of Migrating Cells Following Periostin Stimulation
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| DPSC | Dental pulp stem cell |
| SHED | Stem cells from human exfoliated deciduous teeth |
| WNT | Wingless-related integration site |
| LRP | Low-density lipoprotein receptor-related protein |
| DKK | Dickkopf related protein |
| CM | Conditioned medium |
| BrdU | Bromodeoxyuridine |
References
- Nakashima, M.; Iohara, K.; Murakami, M.; Nakamura, H.; Sato, Y.; Ariji, Y.; Matsushita, K. Pulp Regeneration by Transplantation of Dental Pulp Stem Cells in Pulpitis: A Pilot Clinical Study. Stem Cell Res. Ther. 2017, 8, 61. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sismanoglu, S.; Ercal, P. Dentin–Pulp Tissue Regeneration Approaches in Dentistry: An Overview and Current Trends. Adv. Exp. Med. Biol. 2020, 1298, 79–103. [Google Scholar] [PubMed]
- Hayashi, Y.; Murakami, M.; Kawamura, R.; Ishizaka, R.; Fukuta, O.; Nakashima, M. CXCL14 and MCP1 Are Potent Trophic Factors Associated with Cell Migration and Angiogenesis Leading to Higher Regenerative Potential of Dental Pulp Side Population Cells. Stem Cell Res. Ther. 2015, 6, 111. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nusse, R.; Clevers, H. Wnt/β-Catenin Signaling, Disease, and Emerging Therapeutic Modalities. Cell 2017, 169, 985–999. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Z.; Pan, X.; Chen, M.; Bai, M. Wnt Signalling in Oral and Maxillofacial Diseases. Cell Biol. Int. 2022, 46, 34–45. [Google Scholar] [CrossRef] [Scilit]
- Clevers, H.; Loh, K.M.; Nusse, R. An Integral Program for Tissue Renewal and Regeneration: Wnt Signaling and Stem Cell Control. Science 2014, 346, 1248012. [Google Scholar] [CrossRef] [Scilit]
- Conlon, T.M.; John-Schuster, G.; Heide, D.; Pfister, D.; Lehmann, M.; Hu, Y.; Ertüz, Z.; Lopez, M.A.; Ansari, M.; Strunz, M.; et al. Inhibition of LTβR Signaling Activates WNT-Induced Regeneration in Lung. Nature 2020, 588, 151–156. [Google Scholar] [CrossRef] [Scilit]
- Niu, Y.L.; Li, Y.K.; Gao, C.X.; Li, W.W.; Li, L.; Wang, H.; Shen, W.; Ge, W. Melatonin Promotes Hair Regeneration by Modulating the Wnt/β-Catenin Signaling Pathway. Cell Prolif. 2024, 57, e13656. [Google Scholar] [CrossRef] [Scilit]
- Amir, M.; Jeevithan, L.; Barkat, M.; Fatima, S.H.; Khan, M.; Israr, S.; Naseer, F.; Fayyaz, S.; Elango, J.; Wu, W.; et al. Advances in Regenerative Dentistry: A Systematic Review of Harnessing Wnt/β-Catenin in Dentin–Pulp Regeneration. Cells 2024, 13, 1153. [Google Scholar] [CrossRef] [Scilit]
- Doolan, B.J.; Onoufriadis, A.; Kantaputra, P.; McGrath, J.A. WNT10A, Dermatology and Dentistry. Br. J. Dermatol. 2021, 185, 1105–1111. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Wu, M.; Xing, X.; Li, X.; Shi, C. Effect of Wnt10a/β-Catenin Signaling Pathway on Promoting the Repair of Different Types of Dentin–Pulp Injury. In Vitro Cell. Dev. Biol. Anim. 2023, 59, 486–504. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kudo, A.; Kii, I. Periostin Function in Communication with Extracellular Matrices. J. Cell Commun. Signal. 2018, 12, 301–308. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yamamura, Y.; Furuichi, K.; Murakawa, Y.; Hirabayashi, S.; Yoshihara, M.; Sako, K.; Kitajima, S.; Toyama, T.; Iwata, Y.; Sakai, N.; et al. Identification of Candidate PAX2-Regulated Genes Implicated in Human Kidney Development. Sci. Rep. 2021, 11, 9123. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xia, Y.; Chen, L.; Lu, J.; Ma, J.; Zhang, Y. The Comprehensive Study on the Role of POSTN in Fetal Congenital Heart Disease and Clinical Applications. J. Transl. Med. 2023, 21, 901. [Google Scholar] [CrossRef] [Scilit]
- Kruzynska-Frejtag, A.; Wang, J.; Maeda, M.; Rogers, R.; Krug, E.; Hoffman, S.; Markwald, R.R.; Conway, S.J. Periostin Is Expressed within the Developing Teeth at the Sites of Epithelial–Mesenchymal Interaction. Dev. Dyn. 2004, 229, 857–868. [Google Scholar] [CrossRef] [Scilit]
- Menéndez-Diaz, I.; Muriel, J.D.; García-Suárez, O.; Obaya, A.; Cal, S.; Cobo, J.; Vega, J.A.; Cobo, T. Periostin, Dentin Matrix Protein 1 and P2rx7 Ion Channel in Human Teeth and Periodontal Ligament. Ann. Anat. 2018, 216, 103–111. [Google Scholar] [CrossRef] [Scilit]
- Yang, L.; Guo, T.; Chen, Y.; Bian, K. The Multiple Roles of Periostin in Non-Neoplastic Disease. Cells 2022, 12, 50. [Google Scholar] [CrossRef] [Scilit]
- Sakatoku, S.; Hayashi, Y.; Futenma, T.; Sugita, Y.; Ishizaka, R.; Nawa, H.; Iohara, K. Periostin Is a Candidate Regulator of the Host Microenvironment in Regeneration of Pulp and Dentin Complex and Periodontal Ligament in Transplantation with Stem Cell–Conditioned Medium. Stem Cells Int. 2024, 2024, 7685280. [Google Scholar] [CrossRef] [Scilit]
- Zhu, D.; Wang, Z.; Zhang, G.; Ma, C.; Qiu, X.; Wang, Y.; Liu, M.; Guo, X.; Chen, H.; Deng, Q.; et al. Periostin Promotes Nucleus Pulposus Cell Apoptosis by Activating the Wnt/β-Catenin Signaling Pathway. FASEB J. 2022, 36, e22369. [Google Scholar] [CrossRef] [Scilit]
- Zhang, F.; Luo, K.; Rong, Z.; Wang, Z.; Luo, F.; Zhang, Z.; Sun, D.; Dong, S.; Xu, J.; Dai, F. Periostin Upregulates Wnt/β-Catenin Signaling to Promote the Osteogenesis of CTLA4-Modified Human Bone Marrow–Mesenchymal Stem Cells. Sci. Rep. 2017, 7, 41634. [Google Scholar] [CrossRef] [Scilit]
- Snider, P.; Standley, K.N.; Wang, J.; Azhar, M.; Doetschman, T.; Conway, S.J. Origin of Cardiac Fibroblasts and the Role of Periostin. Circ. Res. 2009, 105, 934–947. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Z.; An, J.; Zhu, D.; Xu, F.; Li, J.; Liu, M.; Guo, X.; Chen, H.; Deng, Q. Periostin: An Emerging Activator of Multiple Signaling Pathways. J. Cell Commun. Signal. 2022, 16, 515–530. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Beheshtizadeh, N.; Gharibshahian, M.; Pazhouhnia, Z.; Hassani, S.N.; Houshmand, M.; Baharvand, H. Commercialization and Regulation of Regenerative Medicine Products: Promises, Advances and Challenges. Biomed. Pharmacother. 2022, 153, 113431. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yan, J.; Wang, Z.; Xian, L.; Wang, D.; Chen, Y.; Bai, J.; Liu, H.J. Periostin Promotes the Proliferation, Differentiation and Mineralization of Osteoblasts from Ovariectomized Rats. Horm. Metab. Res. 2024, 56, 526–535. [Google Scholar] [CrossRef] [Scilit]
- Schweizer, M.T.; Wang, H.; Bivalacqua, T.J.; Partin, A.W.; Lim, S.J.; Chapman, C.; Pavlovich, C.P.; Cho, S.Y.; Song, P.H.; Choi, S.Y.; et al. A Phase I Study to Assess the Safety and Cancer-Homing Ability of Allogeneic Bone Marrow–Derived Mesenchymal Stem Cells in Men with Localized Prostate Cancer. Stem Cells Transl. Med. 2019, 8, 441–449. [Google Scholar] [CrossRef] [Scilit]
- Ullah, M.; Liu, D.D.; Thakor, A.S. Mesenchymal Stromal Cell Homing: Mechanisms and Strategies for Improvement. iScience 2019, 15, 421–438. [Google Scholar] [CrossRef] [Scilit]
- Fu, X.; Liu, G.; Halim, A.; Ju, Y.; Luo, Q.; Song, G. Mesenchymal Stem Cell Migration and Tissue Repair. Cells 2019, 8, 784. [Google Scholar] [CrossRef] [Scilit]
- Doyle, A.D.; Carvajal, N.; Jin, A.; Matsumoto, K.; Yamada, K.M. Local 3D Matrix Microenvironment Regulates Cell Migration through Spatiotemporal Dynamics of Contractility-Dependent Adhesions. Nat. Commun. 2015, 6, 8720. [Google Scholar] [CrossRef] [Scilit]
- Qazi, T.H.; Mooney, D.J.; Duda, G.N.; Geissler, S. Biomaterials That Promote Cell–Cell Interactions Enhance the Paracrine Function of MSCs. Biomaterials 2017, 140, 103–114. [Google Scholar] [CrossRef] [Scilit]
- Martín, F.; Tristán-Manzano, M.; Maldonado-Pérez, N.; Cortijo-Gutiérrez, M.; Benabdellah, K.; Sánchez-Hernández, S.; Rodríguez-Rodríguez, D.; Sánchez-Ferrer, C.F.; Carmona-Sáez, P.; Benabdellah, K.; et al. Stable Genetic Modification of Mesenchymal Stromal Cells Using Lentiviral Vectors. Methods Mol. Biol. 2019, 1937, 267–280. [Google Scholar]
- Koka, P.; Chandramohan, Y.; Perumal, E.; Rajendran, S.; Senthilkumar, R.; Ramasamy, M.; Krishnan, A.; Sreenivasan, P.; Bhuvanesh, T.; Subramanian, S.; et al. Fabrication of ECM-Mimicking Bioactive Scaffold: A Regenerative Approach for MSC-Mediated Applications. Stem Cells Int. 2023, 2023, 6282987. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mankuzhy, P.; Dharmarajan, A.; Perumalsamy, L.R.; Rajendran, S.; Bhat, M.S.; Anish, T.S.; Kannan, R.; Joseph, C.; Varma, B.; Thomas, P.; et al. The Role of Wnt Signaling in Mesenchymal Stromal Cell–Driven Angiogenesis. Tissue Cell 2023, 85, 102240. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- He, J.; Zhang, N.; Zhang, J.; Ma, Z.; Li, Y.; Zhang, X.; Li, M.; Chen, J.; Zhang, L.; Wang, C. Migration Critically Mediates Osteoblastic Differentiation of Bone Mesenchymal Stem Cells through Activating the Canonical Wnt Signaling Pathway. Colloids Surf. B Biointerfaces 2018, 171, 205–213. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yao, P.; Yu, Q.; Zhu, L.; Wang, J.; Li, H.; Chen, C.; Lin, L.; Gao, W.; Xie, Y. Wnt/PCP Pathway Regulates the Migration and Neural Differentiation of Mesenchymal Stem Cells in Vitro. Folia Histochem. Cytobiol. 2022, 60, 44–54. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Liu, N.; Na, J.; Wu, X.; Yang, Y.; Zhang, J.; Yu, H.; Han, J.; Wang, Y.; Li, S. Wnt/β-Catenin Plays a Dual Function in Calcium Hydroxide–Induced Proliferation, Migration, Osteogenic Differentiation and Mineralization in Human Dental Pulp Stem Cells. Int. Endod. J. 2023, 56, 92–102. [Google Scholar] [CrossRef] [Scilit]
- Duncan, H.F. Present Status and Future Directions—Vital Pulp Treatment and Pulp Preservation Strategies. Int. Endod. J. 2022, 55 (Suppl. S3), 497–511. [Google Scholar] [CrossRef] [Scilit]
- Tong, H.J.; Seremidi, K.; Stratigaki, E.; Parashos, P.; Kahler, B. Deep Dentine Caries Management of Immature Permanent Posterior Teeth with Vital Pulp: A Systematic Review and Meta-Analysis. J. Dent. 2022, 124, 104214. [Google Scholar] [CrossRef] [Scilit]
- American Association of Endodontists. AAE Position Statement on Vital Pulp Therapy. J. Endod. 2021, 47, 1340–1344. [Google Scholar] [CrossRef] [Scilit]
- Zhang, L.; Lin, C.; Chen, Z.; Liu, Y.; Wang, C.; Zhou, X.; Yu, M.; Cao, Y.; Zhang, H.; Wang, Y.; et al. Expert Consensus on Pulpotomy in the Management of Mature Permanent Teeth with Pulpitis. Int. J. Oral Sci. 2025, 17, 4. [Google Scholar] [CrossRef] [Scilit]
- Kahler, B.; Taha, N.A.; Lu, J.; Parashos, P.; Mischkowski, R.A.; Linsuwanont, P.; Nekoofar, M.H.; Ricucci, D.; Duncan, H.F.; Bjørndal, L.; et al. Vital Pulp Therapy for Permanent Teeth with Diagnosis of Irreversible Pulpitis: Biological Basis and Outcome. Aust. Dent. J. 2023, 68 (Suppl. S1), S110–S122. [Google Scholar] [CrossRef] [Scilit]
- Kii, I. Periostin Functions as a Scaffold for Assembly of Extracellular Proteins. Adv. Exp. Med. Biol. 2019, 1132, 23–32. [Google Scholar]
- Luo, N.; Deng, Y.W.; Wen, J.; Xu, X.C.; Jiang, R.X.; Zhan, J.Y.; Zhang, Y.; Lu, B.Q.; Chen, F.; Chen, X. Wnt3a-Loaded Hydroxyapatite Nanowire@Mesoporous Silica Core–Shell Nanocomposite Promotes the Regeneration of Dentin–Pulp Complex via Angiogenesis, Oxidative Stress Resistance, and Odontogenic Induction of Stem Cells. Adv. Healthc. Mater. 2023, 12, e2300229. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.; Petho, A.; Ganapathy, A.; George, A. DPP, an Extracellular Matrix Molecule, Induces Wnt5a-Mediated Signaling to Promote the Differentiation of Adult Stem Cells into Odontogenic Lineage. Sci. Rep. 2024, 14, 26187. [Google Scholar] [CrossRef] [Scilit]





| Gene Name | 5′←DNA Sequence→3′ | Amplicon Size | Accession Number | |
|---|---|---|---|---|
| β-actin | Forward | CATTGCTGACAGGATGCAGAAGG | 138 | NM_007393 |
| Reverse | TGCTGGAAGGTGGACAGTGAGG | |||
| Wnt10a | Forward | GCTCCTGTTCTTCCTACTGCTG | 119 | NM_009518 |
| Reverse | ATGTCAGGCACACTGTGTTGGC | |||
| DKK1 | Forward | ATCTGTCTGGCTTGCCGAAAGC | 115 | NM_010051 |
| Reverse | GAGGAAAATGGCTGTGGTCAGAG | |||
| Periostin | Forward | AGACGACCTTTCATCATTTAGAGCA | 87 | MN_001198765 |
| Reverse | GCAAAGAGCGTGAAGTGACCAT | |||
| LRP5/6 | Forward | CCTCACCATTGATTATGCCGACC | 110 | NM_008513 |
| Reverse | GATCGTCAGCTATCACCATGCG |
| Gene Name | 5′←DNA Sequence→3′ | Amplicon Size | Accession Number | |
|---|---|---|---|---|
| β-actin | Forward | CACCATTGGCAATGAGCGGTTC | 135 | NM_001101 |
| Reverse | AGGTCTTTGCGGATGTCCACGT | |||
| Wnt10a | Forward | GTGCTCCTGTTCTTCCTACTGC | 128 | NM_025216 |
| Reverse | CCTGGCAATGTTAGGCACACTG | |||
| DKK1 | Forward | GGTATTCCAGAAGAACCACCTTG | 125 | NM_012242 |
| Reverse | CTTGGACCAGAAGTGTCTAGCAC | |||
| Periostin | Forward | CAAGGGAGAAACGGTGCGATT | 114 | NM_014208.3 |
| Reverse | AAGTAGGCTGAGGAAGGTGCTAA | |||
| LRP5/6 | Forward | GGACACCAACATGATCGAGTCG | 141 | NM_002335 |
| Reverse | CGCTCAATGCTGTGCAGATTCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nakamura, K.; Iida, N.; Hayashi, Y.; Futenma, T.; Sakatoku, S.; Sugita, Y.; Nawa, H. Periostin-Induced Wnt10a Activation Promotes Dental Pulp Stem Cell Migration During Pulp Regeneration. Life 2025, 15, 1732. https://doi.org/10.3390/life15111732
Nakamura K, Iida N, Hayashi Y, Futenma T, Sakatoku S, Sugita Y, Nawa H. Periostin-Induced Wnt10a Activation Promotes Dental Pulp Stem Cell Migration During Pulp Regeneration. Life. 2025; 15(11):1732. https://doi.org/10.3390/life15111732
Chicago/Turabian StyleNakamura, Keisuke, Natsuki Iida, Yuki Hayashi, Taku Futenma, Shintaro Sakatoku, Yoshihiko Sugita, and Hiroyuki Nawa. 2025. "Periostin-Induced Wnt10a Activation Promotes Dental Pulp Stem Cell Migration During Pulp Regeneration" Life 15, no. 11: 1732. https://doi.org/10.3390/life15111732
APA StyleNakamura, K., Iida, N., Hayashi, Y., Futenma, T., Sakatoku, S., Sugita, Y., & Nawa, H. (2025). Periostin-Induced Wnt10a Activation Promotes Dental Pulp Stem Cell Migration During Pulp Regeneration. Life, 15(11), 1732. https://doi.org/10.3390/life15111732

