Next Article in Journal
Replication of Missense OTOG Gene Variants in a Brazilian Patient with Menière’s Disease
Previous Article in Journal
Assembly and Comparative Analysis of the Complete Mitochondrial Genome of Bromus inermis
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Sexing in Owls (Aves, Strigiformes) and the Unique Genetic Structure of the Chromodomain Helicase DNA-Binding Protein 1 (CHD1) Gene on Chromosome W

1
Joint Graduate School of Veterinary Science, Kagoshima University, Kagoshima 890-0065, Japan
2
Department of Pathogenetic and Preventive Veterinary Science, Joint Faculty of Veterinary Medicine, Kagoshima University, Kagoshima 890-0065, Japan
3
National Institute for Environmental Studies, Tsukuba 305-8506, Japan
4
Graduate School of Integrated Sciences for Global Society, Kyushu University, Fukuoka 819-0395, Japan
5
Forest Research Institute, Forest Department, Ministry of Natural Resources and Environmental Conservation, Yezin, Nay Pyi Taw P.O. Box 05282, Myanmar
6
Kagoshima Crane Conservancy, Izumi 899-0208, Japan
7
Transboundary Animal Diseases Research Center, Joint Faculty of Veterinary Medicine, Kagoshima University, Kagoshima 890-0065, Japan
8
Department of Zoology, National Museum of Nature and Science Tokyo, Tsukuba 305-0005, Japan
*
Author to whom correspondence should be addressed.
Current address: Okinawa Wildlife Federation, Uruma 904-2235, Japan.
Genes 2025, 16(6), 653; https://doi.org/10.3390/genes16060653
Submission received: 21 April 2025 / Revised: 16 May 2025 / Accepted: 27 May 2025 / Published: 28 May 2025
(This article belongs to the Section Animal Genetics and Genomics)

Abstract

Background: The accurate determination of bird sex is crucial in various biological fields, including ecology, behavioral research, and conservation. However, this task remains challenging in species in which males and females exhibit similar external morphologies, such as owls. Although polymerase chain reaction (PCR)-based molecular sexing techniques that target the chromodomain helicase DNA-binding protein 1 gene found on sex chromosomes Z (CHD1-Z gene) and W (CHD1-W gene) are widely used, we encountered atypical banding patterns when applying the previously reported primers 2550F and 2718R to four wild owls of unknown sex. This study aims to reveal the owl-specific genetic structure of the CHD1 gene. Methods: We developed a new primer set and determined the nucleotide sequences—including the binding sites for the primers 2550F and 2718R—within both the CHD1-Z and CHD1-W genes. Results: Sequencing analysis, conducted using a newly developed primer set that successfully amplified both Z- and W-derived CHD1 products across various owl species, revealed a unique genetic insertion of approximately 600 bp in intron 17 of the CHD1-W gene. This insertion reversed the usual length relationship between PCR products from the chromosomes Z and W. Additionally, mutations identified in the 2550F primer binding site of the CHD1-Z gene in certain owl species may explain the failure to amplify CHD1-Z-derived PCR products. Conclusion: These findings provide valuable insights for improving molecular sexing in owls.

1. Introduction

The precise determination of a bird’s sex is essential in various biological fields, including ecology, behavioral research, and conservation [1,2]. However, distinguishing between males and females based solely on external morphology can be challenging in monomorphic species [3,4,5].
Molecular sexing techniques using polymerase chain reaction (PCR) have been widely adopted owing to their accuracy and speed. Birds possess two sex chromosomes, Z and W. Males are homogametic (ZZ), and females are heterogametic (ZW) [6]. DNA-based sex identification in birds exploits the differences in nucleotide sequences between these chromosomes. Specifically, the chromodomain helicase DNA-binding protein 1 (CHD1) gene, found on both chromosomes, differs in intron length between the Z and W alleles [2,7,8]. By amplifying these regions with specific primers, females typically display the two distinct bands on agarose gels: a longer band from chromosome Z and a shorter band from chromosome W. In contrast, males show a single band corresponding to two copies of chromosome Z [9].
In this study, we initially applied the conventional molecular sexing method on four wild owls of unknown sex collected in Japan, including Asio otus (long-eared owl), Otus semitorques (Japanese scops owl), Strix uralensis hondoensis (Ural owl), and Ninox japonica (northern boobook), but observed atypical band lengths for the PCR products. To understand these unusual molecular sexing results, we aimed to reveal the owl-specific genetic structure of the CHD1 gene, including primer binding sites, by determining the nucleotide sequences of the PCR products from these four owls, as well as those from other owl species using a newly designed primer set.

2. Materials and Methods

2.1. Sample Collection

We analyzed DNA extracted from 23 samples, including muscle, liver, cultured cells, and swabs from various owl species and Grus monacha (hooded crane) (Table 1). Twelve and six owl samples were collected at the National Institute for Environmental Studies (NIES) and the National Museum of Nature and Science (NMNS), respectively. All owl samples, except those from Otus lettia (Collared scops owl), Tyto alba (barn owl), and Tyto longimembris (Eastern grass owl), were collected from individuals residing in Japan. Specimens of O. lettia, T. alba, and T. longimembris were collected in Myanmar. Samples from an Asio flammeus (short-eared owl) and two G. monacha were collected on the Izumi plain, Kagoshima prefecture, Japan, and processed at Kagoshima University. Additionally, one sample each from A. otus and O. semitorques was collected from individuals rescued and reared at Kagoshima University. The samples collected by the National Museum of Nature and Science were obtained between August 2022 and March 2023. Of the 23 birds analyzed in this study, 11 deceased birds were sexed by necropsy through dissection of their reproductive organs (Table 1). DNA was extracted from the samples using the innuPREP Virus DNA/RNA Kit (Analytik Jena AG, Jena, Germany), as described previously [10].

2.2. PCR Amplification of the CHD1 and COI Genes

Partial regions of the chromosomal CHD1 and mitochondrial COI genes were amplified from nucleic acids extracted from the samples using Tks Gflex DNA polymerase (TaKaRa Bio, Otsu, Japan) and the primers described in Figure 1 and Table 2. The previously reported primers 2550F and 2718R [11], which target conserved nucleotide sequences in exons 17 and 18, respectively, of the CHD1 gene on both chromosomes Z (CHD1-Z) and W (CHD1-W), are known for their utility in differentiating sexes in birds by amplifying the distinct lengths of intron 17 flanked by these exons. This primer set has been extensively used in various avian sexing studies [7,8,12,13,14,15,16,17,18].
Primers 2505F and 2742R (Table 2) were newly designed for this study based on conserved CHD1-Z and CHD1-W gene sequences from species including two Accipitridae: Aquila chrysaetos chrysaetos (Z: accession no. LR606180.1; W: accession no. HG999777.1), Accipiter gentilis (Z: OV839360.1, W: OV839371.1); one Columbidae: Streptopelia turtur (Z: LR594555.2, W: OU015480.1); one Caprimulgidae: Caprimulgus europaeus (Z: OU015527.1, W: OU015537.1); one Acrocephalidae: Acrocephalus scirpaceus scirpaceus (W: OU383795.1); one Muscicapidae: Erithacus rubecula (W: LR812130.2); and one Phasianidae: Gallus gallus (W: AC177807.2). These primers allow for the confirmation of the primer binding sites targeted by 2550F and 2718R.
Additionally, the mitochondrial cytochrome c oxidase I (COI) gene, which is crucial for species identification, was amplified using the well-documented primers Bird F1 and Bird R1 [19], in order to phylogenetically infer the origin of the amplified CHD1 gene. We amplified each gene using the Tks Gflex DNA Polymerase. PCR products were loaded onto a 2% agarose gel for electrophoresis and visualized using ethidium bromide under ultraviolet light.
Each 20 µL PCR reaction mixture consisted of 10 µL of 2× Gflex Buffer, 0.4 µL of Tks Gflex polymerase, 7.4 µL of nuclease-free water, 0.6 µL of each relevant primer (10 µM), and 1 µL of extracted nucleic acids. The PCR conditions included an incubation at 94 °C for 1 min followed by 40 cycles of denaturation at 98 °C for 10 s, annealing at 55 °C for 15 s, and extension at 68 °C for 1 min, with a final extension at 68 °C for 5 min. PCR products were loaded onto a 2% agarose gel for electrophoresis and visualized using ethidium bromide under ultraviolet light.

2.3. DNA Sequencing

The PCR products were purified using the Wizard SV Gel and PCR Clean-Up System (Promega Corporation, Madison, WI, USA). The DNA sequences of the purified PCR products were determined using Sanger sequencing at Azenta Life Sciences (Tokyo, Japan) to identify the origin of the amplified fragments. The DNA sequences were aligned using MEGA software version X [20], together with the corresponding sequences of the CHD1-Z and CHD1-W genes of 36 to 38 bird species (Supplementary Table S1) deposited in the NCBI GenBank database (https://www.ncbi.nlm.nih.gov/genbank/, accessed on 2 September 2024). Specifically, we determined the chromosomal DNA sequences corresponding to the partial exon 17 sequence, the full-length intron 17 sequence, and the partial exon 18 sequence of CHD1-Z and CHD1-W in 14 bird species. These sequences were deposited in the GenBank database under the accession numbers listed in Table 3.

2.4. Phylogenetic Analysis

The DNA sequences of the chromosomal CHD1 and mitochondrial COI genes determined in this study were phylogenetically analyzed alongside the corresponding sequences from representative bird species (Supplementary Table S1) retrieved from the GenBank database, in order to verify the chromosomal origin of the CHD1-derived PCR products obtained from owls in this study. Phylogenetic trees for each gene were constructed using MEGA software version 7 [21] with the maximum likelihood method, supported by 1000 bootstrap replicates to assess the robustness of the inferred nodes.

2.5. Ethics Statement

This study was conducted in compliance with the International Guiding Principles for Biomedical Research Involving Animals, the Japanese Law for Conservation of Endangered Species of Wild Fauna and Flora, and the regulations of the Kagoshima University Research Ethics Committee. No animal experiments were conducted as part of this study. Swab samples from long-eared and Japanese scops owls were collected by veterinary staff at Kagoshima University primarily for diagnostic purposes. All handling procedures were carried out with the aim of minimizing stress and ensuring the welfare of the subjects.

3. Results and Discussion

3.1. Molecular Sexing of Four Wild Owls of Unknown Sex

It is highly challenging to distinguish between the males and females of some bird species, including owls, based on external morphological characteristics. Commonly, PCR-based techniques have been widely employed for sex determination in bird species by targeting the CHD1 gene, which is found on the sex chromosomes Z and W [12,15,22,23]. First, we aimed to determine the sex of four individual wild owls of unknown sex using conventional molecular sexing methods with the previously reported primer set, 2550F/2718R [11]. The four owl species tested included the A. otus, O. semitorques, S. uralensis hondoensis (Ural owl), and N. japonica (northern boobook) (Table 1). Male and female G. monacha served as reference samples for typical avian molecular sexing patterns (Table 1).
The male G. monacha displayed a single band of approximately 600 bp, whereas female G. monacha showed two bands of approximately 400 and 600 bp, in line with our expectations (Supplementary Figure S1). The band patterns of the four owl species differed from those of the cranes. The A. otus and O. semitorques showed a single band of approximately 1 k bp. Additionally, the S. uralensis hondoensis and N. japonica exhibited two bands, one of approximately 1k bp and the other approximately 600 bp.
To ascertain the origin of these PCR products, we sequenced each band and conducted basic local alignment search tool (BLAST) searches against the NCBI GenBank database. The 600 bp PCR products from the S. uralensis hondoensis and the N. japonica matched (92.65–99.33% similarity) the CHD1-Z genes of other owl species, including the Strix nebulosa (great grey owl) (accession no. KF601354.1) and A. flammeus (accession no. KF601360.1). These results confirmed their derivation from chromosome Z. Conversely, the 1k bp PCR products from all four owl species showed high similarity (93.26–94.73%) to the CHD gene of the Megascops asio (eastern screech owl) (accession no. HQ593874.1), the chromosomal origin of which remained unclassified in the database. These findings suggested that the 1k bp PCR products likely originated from chromosome W, indicating a significant divergence in the CHD1-W gene structure in owls compared to other birds. All four wild owls were identified as females, each possessing chromosome W.

3.2. Application of a New Primer Set 2505F/2742R in Owls

The results described above also highlight the potential limitations of the previously reported primer set 2550F/2718R for amplifying CHD1-Z gene targets from A. otus and O. semitorques. To determine the nucleotide sequences—including the binding sites for the primers 2550F and 2718R—within both the CHD1-Z and CHD1-W genes, we developed a new primer set, 2505F/2742R. This new primer set was designed to bind outside the regions targeted by the previously reported primer set 2550F/2718R (Figure 1), based on analysis of eight CHD1 gene sequences from four bird species available in the GenBank database. Using the new primer set, we successfully amplified two distinct bands of approximately 600 and 1 k bp from both A. otus and O. semitorques.
To investigate whether the new primer set was applicable to molecular sexing across a broad range of owl species, 21 individuals from 13 owl species (Table 1) were tested. Owls (Strigiformes) are divided into two families: Tytonidae (barn owls), comprising 19 species, and Strigidae (typical owls), comprising 194 species [24,25]. Among the 13 owl species, two belong to the family Tytonidae and the remaining 11 to Strigidae. While 9 male owls produced a single band of approximately 600 bp, 12 female owls produced two bands, one of approximately 1k bp and the other of approximately 600 bp (Figure 2). The male and female cranes also showed single and double bands, respectively (Figure 2), mirroring the results obtained using the previously reported primer set 2550F/2718R (Supplementary Figure S1). Notably, when using the previously reported primer set 2550F/2718R, the shorter bands typically observed were absent in three owl species: female A. otus, female O. semitorques, and female A. flammeus (Supplementary Figure S2). These results highlight the limited reliability of the primer set 2550F/2718R for molecular sexing in these three owl species.

3.3. Confirmation of the Origin of the CHD1 Gene with Phylogenetic Analyses

To verify the chromosomal origin of the CHD1-derived PCR products obtained from owls in this study, phylogenetic analyses were conducted using the CHD1-Z and CHD1-W genes from various avian species available in the GenBank database. The analysis showed that the short PCR product of approximately 600 bp from owls clustered with the CHD1-Z genes of other bird species, whereas the long PCR product greater than 1k bp clustered with CHD1-W genes (Figure 3A). This suggests that in owls, the 1k bp PCR products are derived from CHD1-W, and unlike in other birds, the long-short relationship between CHD1-Z and CHD1-W is reversed.
Additionally, phylogenetic analysis indicated that the two owl species from Tytonidae tended to cluster separately from those of Strigidae, which was consistent with the results of the COI-based phylogenetic analysis (Figure 3B). This supports the notion of genetic divergence between Strigidae and Tytonidae, highlighting unique evolutionary paths within the owl lineage.

3.4. Alignment of CHD1 Genes in Owls

To determine the reason for the elongation of CHD1-W genes in owls compared to those in other bird species, we aligned CHD1 gene sequences from various owl species with those from other birds and analyzed their genetic composition. All PCR products consisted of exon 17, intron 17, and exon 18 of the CHD1 genes, with the exon-intron boundaries conforming to the GT-AG rule. In owls, we discovered a specific insertion of approximately 600 bp in intron 17 of CHD1-W (Figure 4). This insertion likely occurred during the phylogenetic evolution of owls, contributing to the elongation of CHD1-W.
Additionally, when examining the binding site for the primer set 2550F/2718R in various owl species, multiple base differences were identified at the 2550F binding site in the CHD1-Z gene in three owl species―A. otus, A. flammeus, and O. semitorques―that were not present in the other owl species (Figure 5). This discrepancy suggested that, in females of these three owl species, PCR products derived from CHD1-Z were not amplified, leading to the appearance of a single band on gel electrophoresis, as shown in Supplementary Figure S2. At the remaining binding sites for the primer set 2550F/2718R, only minor variations of fewer than two bases compared to the primer sequences were identified (Supplementary Figure S3A,B).

4. Discussion

In this study, we elucidated the owl-specific genetic structure of the CHD1 gene amplified using the primer set 2550F/2718R and clarified the reason for the inversion in PCR product lengths between the CHD1-Z and CHD1-W genes. Furthermore, using a newly designed primer set, 2505F/2742R, we demonstrated that sequence divergence in the flanking regions of the CHD1 gene, specifically at the primer binding sites, can prevent amplification of CHD1-Z in certain owl species. Although this new primer set enables detailed analysis of the primer binding regions and shows potential for improving the accuracy of molecular sex determination, further investigation is required to confirm its effectiveness.
Through sequencing and alignment of PCR products, we identified a specific insertion within intron 17 that accounts for the distinctly longer CHD1-W amplicons observed in owls. This insertion was confirmed in 12 owl species predominantly distributed in Japan. Notably, earlier studies using the 2550F/2718R primer set for molecular sexing of owls reported female-specific PCR products of approximately 1 kb in length [2,11,16,17,18,26,27], supporting the likelihood of a similar insertion in species such as Ketupa flavipes (Tawny Fish Owl), Aegolius funereus (Tengmalm’s Owl), Otus scops (Eurasian Scops Owl), O. elegans (Elegant Scops Owl), Strix leptogrammica (Brown Wood Owl), and Otus bakkamoena (Collared Scops Owl).
Given that molecular sexing typically relies on the interpretation of electrophoretic banding patterns, our findings on the inversion of CHD1 amplicon sizes in owls may help prevent potential misinterpretations. In three owl species examined in this study, A. otus, A. flammeus, and O. semitorques, the 2550F/2718R primer set failed to amplify CHD1-Z-derived PCR products. Sequence analysis suggested that this failure was due to specific nucleotide differences at the 2550F primer binding site of CHD1-Z. These differences may account for misidentifications in molecular sexing. Among the Otus species examined, such sequence divergence was found only in O. semitorques, suggesting that the mutation is species-specific.
Although only male samples of B. bubo (Eurasian Eagle-Owl) were analyzed in this study, previous reports have noted the absence of CHD1-W amplification in female individuals of this species [12,18,28], indicating the possible presence of base substitutions at the CHD1-W primer binding site in B. bubo. The new primer set, 2505F/2742R, successfully enabled sequencing of the primer-binding regions targeted by 2550F/2718R and achieved accurate sex determination in owls. Given its demonstrated utility in G. monacha (hooded crane), a member of the order Gruiformes, this primer set may be applicable across a broader range of bird species, although further validation is required.
In conclusion, our findings revealed a unique genetic structure in the CHD1 gene of owls characterized by a specific insertion of approximately 600 bp in intron 17 of CHD1-W. This owl-specific intronic insertion may represent an ancestral transposon event that occurred during the course of evolution; however, further studies are needed to confirm its origin.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/genes16060653/s1, Figure S1: Agarose gel electrophoretic patterns of the PCR products amplified using the primer set 2550F/2718R from four owl species; Figure S2: Agarose gel electrophoretic patterns of the PCR products amplified using the primer set 2550F/2718R from 13 owl species; Figure S3: Sequence alignment of the CHD1 sequence at the binding site for the primer set 2550F/2718R in various owl species; Table S1: Species used in the phylogenetic analysis.

Author Contributions

Conceptualization, M.E. and M.O. (Makoto Ozawa); investigation, M.E. and K.M.; resources, M.E., A.H., M.N., M.M.A., K.T., Y.H., I.N., and M.O. (Manabu Onuma); writing—original draft preparation, M.E. and M.O. (Makoto Ozawa); writing—review and editing, K.O. and M.O. (Makoto Ozawa); supervision, M.O. (Makoto Ozawa); project administration, M.O. (Makoto Ozawa); funding acquisition, M.N., I.N., and M.O (Makoto Ozawa). All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by a research project “Biological Inventory with special attention to Myanmar” of the National Museum of Nature and Science, Tokyo; by a Grant-in-Aid for Scientific Research(C) from the Japan Society for the Promotion of Science (JSPS) (JSPS KAKENHI Grant Number 22K06379); by JST SPRING, Grant Number JPMJSP2136; by Education and Research Center for Mathematical and Data Science, Kyushu University; and by the Takehiko Yamashina Grant Program (2023).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article or Supplementary Materials.

Acknowledgments

We thank Natsuko Nishi, Donna Koyamada, and Rara Saito for their technical assistance. We thank the Ministry of the Environment, Iriomote Wildlife Conservation Center, Ishigaki Wildlife Conservation Center, Graduate School of Science/Faculty of Science, Osaka City University, Okinawa Wildlife Federation, Kushiro Zoo, Asahiyama Zoo, the Prefecture of Hiroshima, Kyoto, Kagoshima, and the City of Izumi for their kind cooperation.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Ito, H.; Sudo-Yamaji, A.; Abe, M.; Murase, T.; Tsubota, T. Sex identification by alternative polymerase chain reaction methods in Falconiformes. Zool. Sci. 2003, 20, 339–344. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Lee, J.C.I.; Tsai, L.C.; Hwa, P.Y.; Chan, C.L.; Huang, A.; Chin, S.C.; Wang, L.-C.; Lin, J.-T.; Linacre, A.; Hsieh, H.-M. A novel strategy for avian species and gender identification using the CHD gene. Mol. Cell. Probes 2010, 24, 27–31. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Griffiths, R.; Double, M.C.; Orr, K.; Dawson, R.J.G. A DNA test to sex most birds. Mol. Ecol. 1998, 7, 1071–1075. [Google Scholar] [CrossRef] [Scilit]
  4. Dawson, D.A.; dos Remedios, N.; Horsburgh, G.J. A new marker based on the avian spindlin gene that is able to sex most birds, including species problematic to sex with CHD markers. Zoo Biol. 2016, 35, 533–545. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Griffiths, R. Sex identification in birds. Semin. Avian Exot. Pet Med. 2000, 9, 14–26. [Google Scholar] [CrossRef] [Scilit]
  6. Morinha, F.; Cabral, J.A.; Bastos, E. Molecular sexing of birds: A comparative review of polymerase chain reaction (PCR)-based methods. Theriogenology 2012, 78, 703–714. [Google Scholar] [CrossRef] [Scilit]
  7. Wang, L.C.; Chen, C.T.; Lee, H.Y.; Li, S.H.; Lir, J.T.; Chin, S.C.; Pu, C.-E.; Wang, C.-H. Sexing a wider range of avian species based on two CHD1 introns with a unified reaction condition. Zoo Biol. 2007, 26, 425–431. [Google Scholar] [CrossRef] [Scilit]
  8. Ong, A.H.K.; Vellayan, S. An evaluation of CHD-specific primer sets for sex typing of birds from feathers. Zoo Biol. 2008, 27, 62–69. [Google Scholar] [CrossRef] [Scilit]
  9. Ellegren, H.; Sheldon, B.C. New tools for sex identification and the study of sex allocation in birds. Trends Ecol. Evol. 1997, 12, 255–259. [Google Scholar] [CrossRef] [Scilit]
  10. Esaki, M.; Ito, G.; Tokorozaki, K.; Matsui, T.; Masatani, T.; Amano, K.; Ozawa, M. Prevalence and organ tropism of crane-associated adenovirus 1 in cranes overwintering on the Izumi plain, Japan. Transbound. Emerg. Dis. 2022, 69, e2800-7. [Google Scholar] [CrossRef] [Scilit]
  11. Fridolfsson, A.K.; Ellegren, H. A Simple and Universal Method for Molecular Sexing of Non-Ratite Birds. J. Avian Biol. 1999, 30, 116–121. [Google Scholar] [CrossRef] [Scilit]
  12. Vucicevic, M.; Stevanov-Pavlovic, M.; Stevanovic, J.; Bosnjak, J.; Gajic, B.; Aleksic, N.; Stanimirovic, Z. Sex Determination in 58 Bird Species and Evaluation of CHD Gene as a Universal Molecular Marker in Bird Sexing. Zoo Biol. 2013, 32, 269–276. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Yuda, P.; Saputra, A.W. Eggshell membrane for DNA sexing of the endangered Maleo (Macrocephalon maleo). F1000Research 2021, 9, 599. [Google Scholar] [CrossRef] [Scilit]
  14. Çakmak, E.; Akın Pekşen, Ç.; Bilgin, C.C. Comparison of three different primer sets for sexing birds. J. Vet. Diagn. Investig. 2017, 29, 59–63. [Google Scholar] [CrossRef] [Scilit]
  15. Hatakeyama, H.; Nakamura, Y.; Konaka, T.; Nishida, S.; Kriangwanich, W.; Uematsu, K.; Tsuchida, S. Molecular sexing in Japanese murrelet (Synthliboramphus wumizusume) and a tandem-repeat polymorphism on the W chromosome. Sci. Rep. 2020, 10, 1–7. [Google Scholar] [CrossRef] [Scilit]
  16. Brommer, J.E.; Karell, P.; Pihlaja, T.; Painter, J.N.; Primmer, C.R.; Pietiäinen, H. Ural owl sex allocation and parental investment under poor food conditions. Oecologia 2003, 137, 140–147. [Google Scholar] [CrossRef] [Scilit]
  17. Hörnfeldt, B.; Hipkiss, T.; Fridolfsson, A.K.; Eklund, U.; Ellegren, H. Sex ratio and fledging success of supplementary-fed Tengmalm’s owl broods. Mol. Ecol. 2000, 9, 187–192. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Wang, L.C.; Severinghaus, L.L.; Chen, C.T.; Liu, L.Y.; Pan, C.H.; Huang, D.; Lee, H.Y.; Lir, J.T.; Chin, S.C.; Pu, C.; et al. Sex identification of owls (family Strigidae) using oligonucleotide microarrays. J. Hered. 2008, 99, 187–192. [Google Scholar] [CrossRef] [Scilit]
  19. Hebert, P.D.N.; Stoeckle, M.Y.; Zemlak, T.S.; Francis, C.M. Identification of birds through DNA barcodes. PLoS Biol. 2004, 2, e312. [Google Scholar] [CrossRef] [Scilit]
  20. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [Scilit]
  21. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Abdul-Rahman, I.I.; Awumbila, B.; Jeffcoate, I.A.; Robinson, J.E.; Obese, F.Y. Sexing in Guinea fowls (Numida meleagris). Poult. Sci. 2015, 94, 311–318. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Kaewhom, P.; Srikijkasemwat, K. Efficacy of two primer sets used in the sex identification of rufous-winged buzzard (Butastur liventer). Open Vet. J. 2021, 11, 581–586. [Google Scholar] [CrossRef] [Scilit]
  24. Wink, M.; El-Sayed, A.; Sauer-Gürth, H.; Gonzalez, J. Molecular Phylogeny of Owls (Strigiformes) Inferred from DNA Sequences of the Mitochondrial Cytochrome b and the Nuclear RAG-1 gene. Ardea 2009, 97, 581–591. [Google Scholar] [CrossRef] [Scilit]
  25. Salter, J.; Oliveros, C.; Hosner, P.; Manthey, J.; Robbins, M.; Moyle, R.; Brumfield, R.; Faircloth, B. Extensive paraphyly in the typical owl family (Strigidae). The Auk 2020, 137, 1–15. [Google Scholar] [CrossRef] [Scilit]
  26. Stehlíková Sovadinová, S.; Mekadim, C.; Korpimäki, E.; Mrázek, J.; Kouba, M. Comparison three primer pairs for molecular sex determination in Eurasian pygmy owls (Glaucidium passerinum). Sci. Rep. 2024, 14, 16397. [Google Scholar] [CrossRef] [Scilit]
  27. Liu, C.W.; Hou, H.Y.; Hsieh, H.I.; Jang-Liaw, N.H. Sex identification of birds in Taipei Zoo. Zoo Biol. 2024, 43, 268–275. [Google Scholar] [CrossRef] [Scilit]
  28. Kulibaba, R.O.; Liashenko, Y.V. Analysis of CHD Gene Polymorphism as a Model Object for Molecular Sexing of Eurasian Eagle-Owl (Bubo bubo). Cytol. Genet. 2021, 55, 324–330. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Primers used for molecular sexing in this study. The previously reported primers 2550F and 2718R [13] target conserved nucleotide sequences in exons 17 and 18, respectively, of CHD1 in both the CHD1-Z and CHD1-W genes. New primers, 2505F and 2742R, were designed based on the chromosomal DNA sequences of the CHD1-Z and CHD1-W genes.
Figure 1. Primers used for molecular sexing in this study. The previously reported primers 2550F and 2718R [13] target conserved nucleotide sequences in exons 17 and 18, respectively, of CHD1 in both the CHD1-Z and CHD1-W genes. New primers, 2505F and 2742R, were designed based on the chromosomal DNA sequences of the CHD1-Z and CHD1-W genes.
Genes 16 00653 g001
Figure 2. Agarose gel electrophoretic image showing PCR products amplified using the primer set 2505F/2742R. The new primer set, 2505F/2742R, was used to analyze 21 samples, including 9 males (M) and 12 females (F) from 13 owl species. A G. monacha (hooded crane) sample was included as a reference sample (RS), and nuclease-free water was used as a negative control (NC). 1: A. otus (long-eared owl), 2: A. flammeus (short-eared owl), 3: S. uralensis hondoensis (Ural owl), 4: S. uralensis japonica (Yezo Ural owl), 5: Otus sunia (oriental scops owl), 6: O. elegans interpositus (Ryukyu scops owl), 7: O. semitorques (Japanese scops owl), 8: O. lettia (collared scops owl), 9: N. japonica (northern boobook), 10: A. brama (spotted owlet), 11: B. bubo (Eurasian eagle-owl), 12: T. alba (barn owl), 13: T. longimembris (eastern grass owl), ma: 100-bp DNA ladder used as a marker.
Figure 2. Agarose gel electrophoretic image showing PCR products amplified using the primer set 2505F/2742R. The new primer set, 2505F/2742R, was used to analyze 21 samples, including 9 males (M) and 12 females (F) from 13 owl species. A G. monacha (hooded crane) sample was included as a reference sample (RS), and nuclease-free water was used as a negative control (NC). 1: A. otus (long-eared owl), 2: A. flammeus (short-eared owl), 3: S. uralensis hondoensis (Ural owl), 4: S. uralensis japonica (Yezo Ural owl), 5: Otus sunia (oriental scops owl), 6: O. elegans interpositus (Ryukyu scops owl), 7: O. semitorques (Japanese scops owl), 8: O. lettia (collared scops owl), 9: N. japonica (northern boobook), 10: A. brama (spotted owlet), 11: B. bubo (Eurasian eagle-owl), 12: T. alba (barn owl), 13: T. longimembris (eastern grass owl), ma: 100-bp DNA ladder used as a marker.
Genes 16 00653 g002
Figure 3. Phylogenetic trees of the CHD1 and COI genes from representative bird species. Twenty-nine nucleotide sequences of CHD1 (A) and 14 nucleotide sequences of COI (B) determined in this study were phylogenetically aligned with corresponding sequences from representative bird species deposited in the GenBank database. Circles denote sequences from females, triangles denote sequences from males, and squares denote sequences from reference samples that were sequenced in this study. Phylogenetic trees were constructed using the maximum likelihood method with 1000 bootstrap replicates. The scale bar indicates the number of nucleotide substitutions per site.
Figure 3. Phylogenetic trees of the CHD1 and COI genes from representative bird species. Twenty-nine nucleotide sequences of CHD1 (A) and 14 nucleotide sequences of COI (B) determined in this study were phylogenetically aligned with corresponding sequences from representative bird species deposited in the GenBank database. Circles denote sequences from females, triangles denote sequences from males, and squares denote sequences from reference samples that were sequenced in this study. Phylogenetic trees were constructed using the maximum likelihood method with 1000 bootstrap replicates. The scale bar indicates the number of nucleotide substitutions per site.
Genes 16 00653 g003
Figure 4. Schematic representation of PCR products from the CHD1-Z and CHD1-W genes amplified using the primer set 2550F/2718R. In both CHD1-Z and CHD1-W, intron 17 (white bars) was flanked by exons 17 and 18 (gray bars). These intronic regions begin with GT and end with AG, following the GT-AG rule of introns. An owl-specific region of approximately 600 bp (striped bar) was inserted into intron 17 of CHD1-W.
Figure 4. Schematic representation of PCR products from the CHD1-Z and CHD1-W genes amplified using the primer set 2550F/2718R. In both CHD1-Z and CHD1-W, intron 17 (white bars) was flanked by exons 17 and 18 (gray bars). These intronic regions begin with GT and end with AG, following the GT-AG rule of introns. An owl-specific region of approximately 600 bp (striped bar) was inserted into intron 17 of CHD1-W.
Genes 16 00653 g004
Figure 5. Sequence alignment of the CHD1-Z sequence at the binding site for the primer 2550F in various owl species. A dot (.) indicates the same nucleotide as the primer sequence.
Figure 5. Sequence alignment of the CHD1-Z sequence at the binding site for the primer 2550F in various owl species. A dot (.) indicates the same nucleotide as the primer sequence.
Genes 16 00653 g005
Table 1. Samples used for sex identification in this study.
Table 1. Samples used for sex identification in this study.
SpeciesSample No.Sample IDSexConfirmation of Sex
Tyto alba (Barn owl)1NMNS-TA230314Female-*
Tyto longimembris (Eastern grass owl)1NMNS-TL230315Female-
Asio otus (Long-eared owl)2NIES-4452AMale-
KU-21-ToFemale-
Asio flammeus (Short-eared owl)1KU-21-IzmFemaleNecropsy
Strix uralensis hondoensis (Ural owl)2NIES-6358AMaleNecropsy
NIES-7003AFemaleNecropsy
Strix uralensis japonica (Yezo Ural owl)2NIES-6939AMaleNecropsy
NIES-7008AFemaleNecropsy
Otus sunia (Oriental scops owl)1NIES-5871AFemaleNecropsy
Otus elegans interpositus
(Ryukyu scops owl)
2NIES-3282AMaleNecropsy
NIES-7030AFemaleNecropsy
Otus semitorques (Japanese scops owl)2NIES-661AMale-
KU-21-KoFemale-
Otus lettia (Collared scops owl)2NMNS-OL220826Male-
NMNS-OL221126Female-
Ninox japonica (Northern boobook)2NIES-5917AMaleNecropsy
NIES-5916AFemale-
Athene brama (Spotted owlet)2NMNS-ABr230314-4Male-
NMNS-ABr230314-3Female-
Bubo bubo (Eurasian eagle-owl)1NIES-419AMale-
Grus monacha (Hooded crane)2KU-21-51MaleNecropsy
KU-21-21FemaleNecropsy
*-, not analyzed.
Table 2. Sequences of the primers used in this study.
Table 2. Sequences of the primers used in this study.
Primer NameNucleotide Sequence (5′ to 3′)Reference
2550FGTTACTGATTCGTCTACGAGAFridolfsson and Ellergen, 1999 [13]
2718RATTGAAATGATCCAGTGCTTG
2505FGTAGCATTTAATACGTAGCAGDesigned in this study
2742RATACCATACCTCTGATCCTTC
Table 3. CHD1 gene sequences determined in this study.
Table 3. CHD1 gene sequences determined in this study.
SpeciesGeneAccession No.Length (bp)
T. alba (Barn owl)CHD1-ZLC841896639
CHD1-WLC8419091073
T. longimembris (Eastern grass owl)CHD1-ZLC841897639
CHD1-WLC8419101073
A. otus (Long-eared owl)CHD1-ZLC841884646
CHD1-WLC8418981057
A. flammeus (Short-eared owl)CHD1-ZLC841885646
CHD1-WLC8418991052
S. uralensis hondoensis (Ural owl)CHD1-ZLC841886641
CHD1-WLC8419001051
S. uralensis japonica (Yezo Ural owl)CHD1-ZLC841887641
CHD1-WLC8419011052
O. sunia (Oriental scops owl)CHD1-ZLC841888643
CHD1-WLC8419021058
O. elegans interpositus (Ryukyu scops owl)CHD1-ZLC841889643
CHD1-WLC8419031056
O. semitorques (Japanese scops owl)CHD1-ZLC841890646
CHD1-WLC8419041065
O. lettia (Collared scops owl)CHD1-ZLC841891648
CHD1-WLC8419051055
N. japonica (Northern boobook)CHD1-ZLC841892649
CHD1-WLC8419061051
A. brama (Spotted owlet)CHD1-ZLC841893654
CHD1-WLC8419071033
B. bubo (Eurasian eagle-owl)CHD1-ZLC841895641
G. monacha (Hooded crane)CHD1-ZLC841834637
CHD1-WLC841835462
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Esaki, M.; Momohara, K.; Haga, A.; Narahashi, M.; Aung, M.M.; Tokorozaki, K.; Haraguchi, Y.; Okuya, K.; Nishiumi, I.; Onuma, M.; et al. Molecular Sexing in Owls (Aves, Strigiformes) and the Unique Genetic Structure of the Chromodomain Helicase DNA-Binding Protein 1 (CHD1) Gene on Chromosome W. Genes 2025, 16, 653. https://doi.org/10.3390/genes16060653

AMA Style

Esaki M, Momohara K, Haga A, Narahashi M, Aung MM, Tokorozaki K, Haraguchi Y, Okuya K, Nishiumi I, Onuma M, et al. Molecular Sexing in Owls (Aves, Strigiformes) and the Unique Genetic Structure of the Chromodomain Helicase DNA-Binding Protein 1 (CHD1) Gene on Chromosome W. Genes. 2025; 16(6):653. https://doi.org/10.3390/genes16060653

Chicago/Turabian Style

Esaki, Mana, Kenki Momohara, Atsushi Haga, Maria Narahashi, Mu Mu Aung, Kaori Tokorozaki, Yuko Haraguchi, Kosuke Okuya, Isao Nishiumi, Manabu Onuma, and et al. 2025. "Molecular Sexing in Owls (Aves, Strigiformes) and the Unique Genetic Structure of the Chromodomain Helicase DNA-Binding Protein 1 (CHD1) Gene on Chromosome W" Genes 16, no. 6: 653. https://doi.org/10.3390/genes16060653

APA Style

Esaki, M., Momohara, K., Haga, A., Narahashi, M., Aung, M. M., Tokorozaki, K., Haraguchi, Y., Okuya, K., Nishiumi, I., Onuma, M., & Ozawa, M. (2025). Molecular Sexing in Owls (Aves, Strigiformes) and the Unique Genetic Structure of the Chromodomain Helicase DNA-Binding Protein 1 (CHD1) Gene on Chromosome W. Genes, 16(6), 653. https://doi.org/10.3390/genes16060653

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop