Rescue of Aberrant Splicing Caused by a Novel Complex Deep-intronic ABCA4 Allele
Abstract
1. Introduction
2. Materials and Methods
2.1. Clinical Examinations
2.2. Genetic Testing
2.3. Variants Prioritisation
2.4. Minigene Assay
2.5. Antisense Oligonucleotide Treatment
2.6. Nanopore Sequencing and Data Analysis
2.7. Pseudoexon Detection in cDNA from Retinal Organoids
2.8. Pseudoexon Detection in Bulk RNA-seq Data from Retinal Organoids
3. Results
3.1. Clinical Presentation
3.2. Identification of a Candidate Pathogenic Complex Allele in ABCA4
3.3. Deep-Intronic Complex Allele Substantially Increases “WT” Pseudoexon Inclusion
3.4. Antisense Oligonucleotide Rescue of Aberrant Splicing
3.5. Pseudoexon Detection in Retinal Organoids
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Fujinami, K.; Lois, N.; Davidson, A.E.; Mackay, D.S.; Hogg, C.R.; Stone, E.M.; Tsunoda, K.; Tsubota, K.; Bunce, C.; Robson, A.G.; et al. A Longitudinal Study of Stargardt Disease: Clinical and Electrophysiologic Assessment, Progression, and Genotype Correlations. Am. J. Ophthalmol. 2013, 155, 1075–1088.e13. [Google Scholar] [CrossRef] [PubMed]
- Tanna, P.; Strauss, R.W.; Fujinami, K.; Michaelides, M. Stargardt Disease: Clinical Features, Molecular Genetics, Animal Models and Therapeutic Options. Br. J. Ophthalmol. 2017, 101, 25–30. [Google Scholar] [CrossRef] [PubMed]
- Strauss, R.W.; Ho, A.; Muñoz, B.; Cideciyan, A.V.; Sahel, J.A.; Sunness, J.S.; Birch, D.G.; Bernstein, P.S.; Michaelides, M.; Traboulsi, E.I.; et al. The Natural History of the Progression of Atrophy Secondary to Stargardt Disease (ProgStar) Studies: Design and Baseline Characteristics: Progstar Report No. 1. Ophthalmology 2016, 123, 817–828. [Google Scholar] [CrossRef] [PubMed]
- Michaelides, M.; Hunt, D.M.; Moore, A.T. The Genetics of Inherited Macular Dystrophies. J. Med. Genet. 2003, 40, 641–650. [Google Scholar] [CrossRef]
- Fujinami, K.; Zernant, J.; Chana, R.K.; Wright, G.A.; Tsunoda, K.; Ozawa, Y.; Tsubota, K.; Robson, A.G.; Holder, G.E.; Allikmets, R.; et al. Clinical and Molecular Characteristics of Childhood-Onset Stargardt Disease. Ophthalmology 2015, 122, 326–334. [Google Scholar] [CrossRef]
- Lambertus, S.; Van Huet, R.A.C.; Bax, N.M.; Hoefsloot, L.H.; Cremers, F.P.M.; Boon, C.J.F.; Klevering, B.J.; Hoyng, C.B. Early-Onset Stargardt Disease: Phenotypic and Genotypic Characteristics. Ophthalmology 2015, 122, 335–344. [Google Scholar] [CrossRef]
- Fishman, G.A. Fundus Flavimaculatus. A Clinical Classification. Arch. Ophthalmol. 1976, 94, 2061–2067. [Google Scholar] [CrossRef]
- Westeneng-Van Haaften, S.C.; Boon, C.J.F.; Cremers, F.P.M.; Hoefsloot, L.H.; Den Hollander, A.I.; Hoyng, C.B. Clinical and Genetic Characteristics of Late-Onset Stargardt’s Disease. Ophthalmology 2012, 119, 1199–1210. [Google Scholar] [CrossRef]
- Allikmets, R.; Singh, N.; Sun, H.; Shroyer, N.F.; Hutchinson, A.; Chidambaram, A.; Gerrard, B.; Baird, L.; Stauffer, D.; Peiffer, A.; et al. A Photoreceptor Cell-Specific ATP-Binding Transporter Gene (ABCR) Is Mutated in Recessive Stargardt Macular Dystrophy. Nat. Genet. 1997, 15, 236–246. [Google Scholar] [CrossRef]
- Molday, R.S.; Garces, F.A.; Scortecci, J.F.; Molday, L.L. Structure and Function of ABCA4 and Its Role in the Visual Cycle and Stargardt Macular Degeneration. Prog. Retin. Eye Res. 2022, 89, 101036. [Google Scholar] [CrossRef]
- Molday, L.L.; Rabin, A.R.; Molday, R.S. ABCR Expression in Foveal Cone Photoreceptors and Its Role in Stargardt Macular Dystrophy. Nat. Genet. 2000, 25, 257–258. [Google Scholar] [CrossRef] [PubMed]
- Lenis, T.L.; Hu, J.; Ng, S.Y.; Jiang, Z.; Sarfare, S.; Lloyd, M.B.; Esposito, N.J.; Samuel, W.; Jaworski, C.; Bok, D.; et al. Expression of ABCA4 in the Retinal Pigment Epithelium and Its Implications for Stargardt Macular Degeneration. Proc. Natl. Acad. Sci. USA 2018, 115, E11120–E11127. [Google Scholar] [CrossRef] [PubMed]
- Takenaka, S.; Itoh, T.; Fujiwara, R. Expression Pattern of Human ATP-Binding Cassette Transporters in Skin. Pharmacol. Res. Perspect. 2013, 1, e00005. [Google Scholar] [CrossRef] [PubMed]
- Ścieżyńska, A.; Soszyńska, M.; Komorowski, M.; Podgórska, A.; Krześniak, N.; Nogowska, A.; Smolińska, M.; Szulborski, K.; Szaflik, J.P.; Noszczyk, B.; et al. Molecular Analysis of the ABCA4 Gene Mutations in Patients with Stargardt Disease Using Human Hair Follicles. Int. J. Mol. Sci. 2020, 21, 3430. [Google Scholar] [CrossRef] [PubMed]
- Haslam, I.S.; El-Chami, C.; Faruqi, H.; Shahmalak, A.; O’Neill, C.A.; Paus, R. Differential Expression and Functionality of ATP-Binding Cassette Transporters in the Human Hair Follicle. Br. J. Dermatol. 2015, 172, 1562–1572. [Google Scholar] [CrossRef]
- Quazi, F.; Lenevich, S.; Molday, R.S. ABCA4 Is an N-Retinylidene-Phosphatidylethanolamine and Phosphatidylethanolamine Importer. Nat. Commun. 2012, 3, 925. [Google Scholar] [CrossRef]
- Al-Khuzaei, S.; Broadgate, S.; Foster, C.R.; Shah, M.; Yu, J.; Downes, S.M.; Halford, S. An Overview of the Genetics of ABCA4 Retinopathies, an Evolving Story. Genes 2021, 12, 1241. [Google Scholar] [CrossRef]
- Cremers, F.P.M.; Lee, W.; Collin, R.W.J.; Allikmets, R. Clinical Spectrum, Genetic Complexity and Therapeutic Approaches for Retinal Disease Caused by ABCA4 Mutations. Prog. Retin. Eye Res. 2020, 79, 100861. [Google Scholar] [CrossRef]
- Stenson, P.D.; Ball, E.V.; Mort, M.; Phillips, A.D.; Shiel, J.A.; Thomas, N.S.T.; Abeysinghe, S.; Krawczak, M.; Cooper, D.N. Human Gene Mutation Database (HGMD): 2003 Update. Hum. Mutat. 2003, 21, 577–581. [Google Scholar] [CrossRef]
- Cornelis, S.S.; Bauwens, M.; Haer-Wigman, L.; De Bruyne, M.; Pantrangi, M.; De Baere, E.; Hufnagel, R.B.; Dhaenens, C.M.; Cremers, F.P.M. Compendium of Clinical Variant Classification for 2,246 Unique ABCA4 Variants to Clarify Variant Pathogenicity in Stargardt Disease Using a Modified ACMG/AMP Framework. Hum. Mutat. 2023, 2023, 1–12. [Google Scholar] [CrossRef]
- Fokkema, I.F.A.C.; Kroon, M.; López Hernández, J.A.; Asscheman, D.; Lugtenburg, I.; Hoogenboom, J.; den Dunnen, J.T. The LOVD3 Platform: Efficient Genome-Wide Sharing of Genetic Variants. Eur. J. Hum. Genet. 2021, 29, 1796–1803. [Google Scholar] [CrossRef] [PubMed]
- Richards, S.; Aziz, N.; Bale, S.; Bick, D.; Das, S.; Gastier-Foster, J.; Grody, W.W.; Hegde, M.; Lyon, E.; Spector, E.; et al. Standards and Guidelines for the Interpretation of Sequence Variants: A Joint Consensus Recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet. Med. 2015, 17, 405–424. [Google Scholar] [CrossRef] [PubMed]
- Perea-Romero, I.; Gordo, G.; Iancu, I.F.; Del Pozo-Valero, M.; Almoguera, B.; Blanco-Kelly, F.; Carreño, E.; Jimenez-Rolando, B.; Lopez-Rodriguez, R.; Lorda-Sanchez, I.; et al. Genetic Landscape of 6089 Inherited Retinal Dystrophies Affected Cases in Spain and Their Therapeutic and Extended Epidemiological Implications. Sci. Rep. 2021, 11, 1526. [Google Scholar] [CrossRef]
- Weisschuh, N.; Mazzola, P.; Zuleger, T.; Schaeferhoff, K.; Kühlewein, L.; Kortüm, F.; Witt, D.; Liebmann, A.; Falb, R.; Pohl, L.; et al. Diagnostic Genome Sequencing Improves Diagnostic Yield: A Prospective Single-Centre Study in 1000 Patients with Inherited Eye Diseases. J. Med. Genet. 2023, 61, 186–195. [Google Scholar] [CrossRef]
- Weisschuh, N.; Obermaier, C.D.; Battke, F.; Bernd, A.; Kuehlewein, L.; Nasser, F.; Zobor, D.; Zrenner, E.; Weber, E.; Wissinger, B.; et al. Genetic Architecture of Inherited Retinal Degeneration in Germany: A Large Cohort Study from a Single Diagnostic Center over a 9-Year Period. Hum. Mutat. 2020, 41, 1514–1527. [Google Scholar] [CrossRef]
- Zernant, J.; Lee, W.; Collison, F.T.; Fishman, G.A.; Sergeev, Y.V.; Schuerch, K.; Sparrow, J.R.; Tsang, S.H.; Allikmets, R. Frequent Hypomorphic Alleles Account for a Significant Fraction of ABCA4 Disease and Distinguish It from Age-Related Macular Degeneration. J. Med. Genet. 2017, 54, 404–412. [Google Scholar] [CrossRef]
- Zernant, J.; Lee, W.; Nagasaki, T.; Collison, F.T.; Fishman, G.A.; Bertelsen, M.; Rosenberg, T.; Gouras, P.; Tsang, S.H.; Allikmets, R. Extremely Hypomorphic and Severe Deep Intronic Variants in the ABCA4 Locus Result in Varying Stargardt Disease Phenotypes. Cold Spring Harb. Mol. Case Stud. 2018, 4, a002733. [Google Scholar] [CrossRef]
- Bauwens, M.; Garanto, A.; Sangermano, R.; Naessens, S.; Weisschuh, N.; De Zaeytijd, J.; Khan, M.; Sadler, F.; Balikova, I.; Van Cauwenbergh, C.; et al. ABCA4-Associated Disease as a Model for Missing Heritability in Autosomal Recessive Disorders: Novel Noncoding Splice, Cis-Regulatory, Structural, and Recurrent Hypomorphic Variants. Genet. Med. 2019, 21, 1761–1771. [Google Scholar] [CrossRef]
- Sangermano, R.; Garanto, A.; Khan, M.; Runhart, E.H.; Bauwens, M.; Bax, N.M.; van den Born, L.I.; Khan, M.I.; Cornelis, S.S.; Verheij, J.B.G.M.; et al. Deep-Intronic ABCA4 Variants Explain Missing Heritability in Stargardt Disease and Allow Correction of Splice Defects by Antisense Oligonucleotides. Genet. Med. 2019, 21, 1751–1760. [Google Scholar] [CrossRef]
- Lee, W.; Zernant, J.; Nagasaki, T.; Molday, L.L.; Su, P.Y.; Fishman, G.A.; Tsang, S.H.; Molday, R.S.; Allikmets, R. Cis-Acting Modifiers in the ABCA4 Locus Contribute to the Penetrance of the Major Disease-Causing Variant in Stargardt Disease. Hum. Mol. Genet. 2021, 30, 1293–1304. [Google Scholar] [CrossRef]
- Zhang, N.; Tsybovsky, Y.; Kolesnikov, A.V.; Rozanowska, M.; Swider, M.; Schwartz, S.B.; Stone, E.M.; Palczewska, G.; Maeda, A.; Kefalov, V.J.; et al. Protein Misfolding and the Pathogenesis of ABCA4-Associated Retinal Degenerations. Hum. Mol. Genet. 2015, 24, 3220–3237. [Google Scholar] [CrossRef] [PubMed]
- Fujinami, K.; Waheed, N.; Laich, Y.; Yang, P.; Fujinami-Yokokawa, Y.; Higgins, J.J.; Lu, J.T.; Curtiss, D.; Clary, C.; Michaelides, M. Stargardt Macular Dystrophy and Therapeutic Approaches. Br. J. Ophthalmol. 2024, 108, 495–505. [Google Scholar] [CrossRef] [PubMed]
- Dockery, A.; Whelan, L.; Humphries, P.; Jane Farrar, G. Next-Generation Sequencing Applications for Inherited Retinal Diseases. Int. J. Mol. Sci. 2021, 22, 5684. [Google Scholar] [CrossRef] [PubMed]
- Farrar, G.J.; Carrigan, M.; Dockery, A.; Millington-Ward, S.; Palfi, A.; Chadderton, N.; Humphries, M.; Kiang, A.S.; Kenna, P.F.; Humphries, P. Toward an Elucidation of the Molecular Genetics of Inherited Retinal Degenerations. Hum. Mol. Genet. 2017, 26, R2. [Google Scholar] [CrossRef]
- Braun, T.A.; Mullins, R.F.; Wagner, A.H.; Andorf, J.L.; Johnston, R.M.; Bakall, B.B.; Deluca, A.P.; Fishman, G.A.; Lam, B.L.; Weleber, R.G.; et al. Non-Exomic and Synonymous Variants in ABCA4 Are an Important Cause of Stargardt Disease. Hum. Mol. Genet. 2013, 22, 5136–5145. [Google Scholar] [CrossRef]
- Zernant, J.; Xie, Y.A.; Ayuso, C.; Riveiro-Alvarez, R.; Lopez-Martinez, M.A.; Simonelli, F.; Testa, F.; Gorin, M.B.; Strom, S.P.; Bertelsen, M.; et al. Analysis of the ABCA4 Genomic Locus in Stargardt Disease. Hum. Mol. Genet. 2014, 23, 6797–6806. [Google Scholar] [CrossRef]
- Khan, M.; Cornelis, S.S.; Pozo-Valero, M.D.; Whelan, L.; Runhart, E.H.; Mishra, K.; Bults, F.; AlSwaiti, Y.; AlTabishi, A.; De Baere, E.; et al. Resolving the Dark Matter of ABCA4 for 1,054 Stargardt Disease Probands through Integrated Genomics and Transcriptomics. Genet. Med. 2020, 22, 1235–1246. [Google Scholar] [CrossRef]
- Sangermano, R.; Khan, M.; Cornelis, S.S.; Richelle, V.; Albert, S.; Garanto, A.; Elmelik, D.; Qamar, R.; Lugtenberg, D.; van den Born, L.I.; et al. ABCA4 Midigenes Reveal the Full Splice Spectrum of All Reported Noncanonical Splice Site Variants in Stargardt Disease. Genome Res. 2018, 28, 100–110. [Google Scholar] [CrossRef]
- Tomkiewicz, T.Z.; Suárez-Herrera, N.; Cremers, F.P.M.; Collin, R.W.J.; Garanto, A. Antisense Oligonucleotide-Based Rescue of Aberrant Splicing Defects Caused by 15 Pathogenic Variants in Abca4. Int. J. Mol. Sci. 2021, 22, 4621. [Google Scholar] [CrossRef]
- McCulloch, D.L.; Marmor, M.F.; Brigell, M.G.; Hamilton, R.; Holder, G.E.; Tzekov, R.; Bach, M. ISCEV Standard for Full-Field Clinical Electroretinography (2015 Update). Doc. Ophthalmol. 2015, 130, 1–12. [Google Scholar] [CrossRef]
- Hood, D.C.; Bach, M.; Brigell, M.; Keating, D.; Kondo, M.; Lyons, J.S.; Marmor, M.F.; McCulloch, D.L.; Palmowski-Wolfe, A.M. ISCEV Standard for Clinical Multifocal Electroretinography (MfERG) (2011 Edition). Doc. Ophthalmol. 2012, 124, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Haug, P.; Koller, S.; Maggi, J.; Lang, E.; Feil, S.; Bähr, L.; Steindl, K.; Rohrbach, M.; Gerth-kahlert, C.; Berger, W. Whole Exome Sequencing in Coloboma/Microphthalmia: Identification of Novel and Recurrent Variants in Seven Genes. Genes 2021, 12, 65. [Google Scholar] [CrossRef] [PubMed]
- Maggi, J.; Koller, S.; Bähr, L.; Feil, S.; Pfiffner, F.K.; Hanson, J.V.M.; Maspoli, A.; Gerth-Kahlert, C.; Berger, W. Long-Range PCR-Based NGS Applications to Diagnose Mendelian Retinal Diseases. Int. J. Mol. Sci. 2021, 22, 1508. [Google Scholar] [CrossRef]
- Maggi, J.; Koller, S.; Feil, S.; Bachmann-Gagescu, R.; Gerth-Kahlert, C.; Berger, W. Limited Added Diagnostic Value of Whole Genome Sequencing in Genetic Testing of Inherited Retinal Diseases in a Swiss Patient Cohort. Int. J. Mol. Sci. 2024, 25, 6540. [Google Scholar] [CrossRef]
- Depristo, M.A.; Banks, E.; Poplin, R.; Garimella, K.V.; Maguire, J.R.; Hartl, C.; Philippakis, A.A.; Del Angel, G.; Rivas, M.A.; Hanna, M.; et al. A Framework for Variation Discovery and Genotyping Using Next-Generation DNA Sequencing Data. Nat. Genet. 2011, 43, 491–501. [Google Scholar] [CrossRef]
- Li, H.; Durbin, R. Fast and Accurate Short Read Alignment with Burrows-Wheeler Transform. Bioinformatics 2009, 25, 1754–1760. [Google Scholar] [CrossRef]
- Poplin, R.; Chang, P.-C.; Alexander, D.; Schwartz, S.; Colthurst, T.; Ku, A.; Newburger, D.; Dijamco, J.; Nguyen, N.; Afshar, P.T.; et al. A Universal SNP and Small-Indel Variant Caller Using Deep Neural Networks. Nat. Biotechnol. 2018, 36, 983–987. [Google Scholar] [CrossRef]
- Karczewski, K.J.; Francioli, L.C.; Tiao, G.; Cummings, B.B.; Alföldi, J.; Wang, Q.; Collins, R.L.; Laricchia, K.M.; Ganna, A.; Birnbaum, D.P.; et al. The Mutational Constraint Spectrum Quantified from Variation in 141,456 Humans. Nature 2020, 581, 434–443. [Google Scholar] [CrossRef]
- Landrum, M.J.; Lee, J.M.; Benson, M.; Brown, G.R.; Chao, C.; Chitipiralla, S.; Gu, B.; Hart, J.; Hoffman, D.; Jang, W.; et al. ClinVar: Improving Access to Variant Interpretations and Supporting Evidence. Nucleic Acids Res. 2018, 46, D1062–D1067. [Google Scholar] [CrossRef]
- Pollard, K.S.; Hubisz, M.J.; Rosenbloom, K.R.; Siepel, A. Detection of Nonneutral Substitution Rates on Mammalian Phylogenies. Genome Res. 2010, 20, 110. [Google Scholar] [CrossRef]
- Rentzsch, P.; Schubach, M.; Shendure, J.; Kircher, M. CADD-Splice—Improving Genome-Wide Variant Effect Prediction Using Deep Learning-Derived Splice Scores. Genome Med. 2021, 13, 31. [Google Scholar] [CrossRef] [PubMed]
- Jaganathan, K.; Kyriazopoulou Panagiotopoulou, S.; McRae, J.F.; Darbandi, S.F.; Knowles, D.; Li, Y.I.; Kosmicki, J.A.; Arbelaez, J.; Cui, W.; Schwartz, G.B.; et al. Predicting Splicing from Primary Sequence with Deep Learning. Cell 2019, 176, 535–548.e24. [Google Scholar] [CrossRef] [PubMed]
- Sundaram, L.; Gao, H.; Padigepati, S.R.; McRae, J.F.; Li, Y.; Kosmicki, J.A.; Fritzilas, N.; Hakenberg, J.; Dutta, A.; Shon, J.; et al. Predicting the Clinical Impact of Human Mutation with Deep Neural. Nat. Genet. 2018, 50, 1161. [Google Scholar] [CrossRef] [PubMed]
- Ioannidis, N.M.; Rothstein, J.H.; Pejaver, V.; Middha, S.; McDonnell, S.K.; Baheti, S.; Musolf, A.; Li, Q.; Holzinger, E.; Karyadi, D.; et al. REVEL: An Ensemble Method for Predicting the Pathogenicity of Rare Missense Variants. Am. J. Hum. Genet. 2016, 99, 877. [Google Scholar] [CrossRef] [PubMed]
- Sim, N.L.; Kumar, P.; Hu, J.; Henikoff, S.; Schneider, G.; Ng, P.C. SIFT Web Server: Predicting Effects of Amino Acid Substitutions on Proteins. Nucleic Acids Res. 2012, 40, W452. [Google Scholar] [CrossRef]
- Adzhubei, I.; Jordan, D.M.; Sunyaev, S.R. Predicting Functional Effect of Human Missense Mutations Using PolyPhen-2. Curr. Protoc. Hum. Genet. 2013, 7, Unit7.20. [Google Scholar] [CrossRef]
- Koller, S.; Beltraminelli, T.; Maggi, J.; Wlodarczyk, A.; Feil, S.; Baehr, L.; Gerth-Kahlert, C.; Menghini, M.; Berger, W. Functional Analysis of a Novel, Non-Canonical RPGR Splice Variant Causing X-Linked Retinitis Pigmentosa. Genes 2023, 14, 934. [Google Scholar] [CrossRef]
- Rechsteiner, D.; Issler, L.; Koller, S.; Lang, E.; Bähr, L.; Feil, S.; Rüegger, C.M.; Kottke, R.; Toelle, S.P.; Zweifel, N.; et al. Genetic Analysis in a Swiss Cohort of Bilateral Congenital Cataract. JAMA Ophthalmol. 2021, 139, 691–700. [Google Scholar] [CrossRef]
- Garanto, A.; Collin, R.W.J. Design and in Vitro Use of Antisense Oligonucleotides to Correct Pre-MRNA Splicing Defects in Inherited Retinal Dystrophies. Methods Mol. Biol. 2018, 1715, 61–78. [Google Scholar] [CrossRef]
- Maggi, J.; Feil, S.; Gloggnitzer, J.; Maggi, K.; Bachmann-Gagescu, R.; Gerth-Kahlert, C.; Koller, S.; Berger, W. Nanopore Deep Sequencing as a Tool to Characterize and Quantify Aberrant Splicing Caused by Variants in Inherited Retinal Dystrophy Genes. Int. J. Mol. Sci. 2024, 25, 9569. [Google Scholar] [CrossRef]
- Li, H. Minimap2: Pairwise Alignment for Nucleotide Sequences. Bioinformatics 2018, 34, 3094–3100. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. The Sequence Alignment/Map Format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef] [PubMed]
- Atac, D.; Maggi, K.; Feil, S.; Maggi, J.; Cuevas, E.; Sowden, J.C.; Koller, S.; Berger, W. Identification and Characterization of ATOH7-Regulated Target Genes and Pathways in Human Neuroretinal Development. Cells 2024, 13, 1142. [Google Scholar] [CrossRef]
- Maggi, K.; Atac, D.; Maggi, J.; Feil, S.; Koller, S.; Berger, W. Putative Role of Norrin in Neuronal Differentiation Revealed by Bulk- and ScRNA Sequencing of Human Retinal Organoids. Biorxiv 2024, 1–27. [Google Scholar] [CrossRef]
- Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: Ultrafast Universal RNA-Seq Aligner. Bioinformatics 2013, 29, 15–21. [Google Scholar] [CrossRef] [PubMed]
- Rozet, J.M.; Gerber, S.; Souied, E.; Perrault, I.; Châtelin, S.; Ghazi, I.; Leowski, C.; Dufier, J.L.; Munnich, A.; Kaplan, J. Spectrum of ABCR Gene Mutations in Autosomal Recessive Macular Dystrophies. Eur. J. Hum. Genet. 1998, 6, 291–295. [Google Scholar] [CrossRef]
- Sodi, A.; Bini, A.; Passerini, I.; Menchini, U.; Torricelli, F. Occurrence of Full-Thickness Macular Hole Complicating Stargardt Disease with ABCR Mutation. Eur. J. Ophthalmol. 2006, 16, 335–338. [Google Scholar] [CrossRef]
- Del Pozo-Valero, M.; Riveiro-Alvarez, R.; Martin-Merida, I.; Blanco-Kelly, F.; Swafiri, S.; Lorda-Sanchez, I.; Trujillo-Tiebas, M.J.; Carreño, E.; Jimenez-Rolando, B.; Garcia-Sandoval, B.; et al. Impact of Next Generation Sequencing in Unraveling the Genetics of 1036 Spanish Families with Inherited Macular Dystrophies. Investig. Ophthalmol. Vis. Sci. 2022, 63, 11. [Google Scholar] [CrossRef]
- Hanany, M.; Rivolta, C.; Sharon, D. Worldwide Carrier Frequency and Genetic Prevalence of Autosomal Recessive Inherited Retinal Diseases. Proc. Natl. Acad. Sci. USA 2020, 117, 2710–2716. [Google Scholar] [CrossRef]
- Duncker, T.; Tsang, S.H.; Lee, W.; Zernant, J.; Allikmets, R.; Delori, F.C.; Sparrow, J.R. Quantitative Fundus Autofluorescence Distinguishes ABCA4-Associated and Non-ABCA4-Associated Bull’s-Eye Maculopathy. Ophthalmology 2015, 122, 345–355. [Google Scholar] [CrossRef]
- Bax, N.M.; Sangermano, R.; Roosing, S.; Thiadens, A.A.H.J.; Hoefsloot, L.H.; van den Born, L.I.; Phan, M.; Klevering, B.J.; Westeneng-van Haaften, C.; Braun, T.A.; et al. Heterozygous Deep-Intronic Variants and Deletions in ABCA4 in Persons with Retinal Dystrophies and One Exonic ABCA4 Variant. Hum. Mutat. 2015, 36, 43–47. [Google Scholar] [CrossRef] [PubMed]
- Huang, D.; Thompson, J.A.; Chen, S.-C.; Adams, A.; Pitout, I.; Lima, A.; Zhang, D.; Jeffery, R.C.H.; Attia, M.S.; McLaren, T.L.; et al. Characterising Splicing Defects of ABCA4 Variants within Exons 13–50 in Patient-Derived Fibroblasts. Exp. Eye Res. 2022, 225, 109276. [Google Scholar] [CrossRef] [PubMed]
- Bauwens, M.; De Zaeytijd, J.; Weisschuh, N.; Kohl, S.; Meire, F.; Dahan, K.; Depasse, F.; De Jaegere, S.; De Ravel, T.; De Rademaeker, M.; et al. An Augmented ABCA4 Screen Targeting Noncoding Regions Reveals a Deep Intronic Founder Variant in Belgian Stargardt Patients. Hum. Mutat. 2015, 36, 39–42. [Google Scholar] [CrossRef] [PubMed]
- Albert, S.; Garanto, A.; Sangermano, R.; Khan, M.; Bax, N.M.; Hoyng, C.B.; Zernant, J.; Lee, W.; Allikmets, R.; Collin, R.W.J.; et al. Identification and Rescue of Splice Defects Caused by Two Neighboring Deep-Intronic ABCA4 Mutations Underlying Stargardt Disease. Am. J. Hum. Genet. 2018, 102, 517–527. [Google Scholar] [CrossRef] [PubMed]
- Sangermano, R.; Bax, N.M.; Bauwens, M.; van den Born, L.I.; De Baere, E.; Garanto, A.; Collin, R.W.J.; Goercharn-Ramlal, A.S.A.; den Engelsman-van Dijk, A.H.A.; Rohrschneider, K.; et al. Photoreceptor Progenitor MRNA Analysis Reveals Exon Skipping Resulting from the ABCA4 c.5461-10T→C Mutation in Stargardt Disease. Ophthalmology 2016, 123, 1375–1385. [Google Scholar] [CrossRef]
- Vázquez-Domínguez, I.; Duijkers, L.; Fadaie, Z.; Alaerds, E.C.W.; Post, M.A.; van Oosten, E.M.; O’Gorman, L.; Kwint, M.; Koolen, L.; Hoogendoorn, A.D.M.; et al. The Predicted Splicing Variant c.11+5G>A in RPE65 Leads to a Reduction in MRNA Expression in a Cell-Specific Manner. Cells 2022, 11, 3640. [Google Scholar] [CrossRef]
- Slaugenhaupt, S.A. Genetics of Familial Dysautonomia. Clin. Auton. Res. 2002, 12, I15–I19. [Google Scholar] [CrossRef]
- Fathi, M.; Ross, C.T.; Hosseinzadeh, Z. Functional 3-Dimensional Retinal Organoids: Technological Progress and Existing Challenges. Front. Neurosci. 2021, 15, 668857. [Google Scholar] [CrossRef]
- Collin, R.W.J.; Garanto, A. Applications of Antisense Oligonucleotides for the Treatment of Inherited Retinal Diseases. Curr. Opin. Ophthalmol. 2017, 28, 260–266. [Google Scholar] [CrossRef]
- Garanto, A.; Chung, D.C.; Duijkers, L.; Corral-Serrano, J.C.; Messchaert, M.; Xiao, R.; Bennett, J.; Vandenberghe, L.H.; Collin, R.W.J. In Vitro and in Vivo Rescue of Aberrant Splicing in CEP290-Associated LCA by Antisense Oligonucleotide Delivery. Hum. Mol. Genet. 2016, 25, 2552–2563. [Google Scholar] [CrossRef]
- Duijkers, L.; Van Den Born, L.I.; Neidhardt, J.; Bax, N.M.; Pierrache, L.H.M.; Klevering, B.J.; Collin, R.W.J.; Garanto, A. Antisense Oligonucleotide-Based Splicing Correction in Individuals with Leber Congenital Amaurosis Due to Compound Heterozygosity for the c.2991+1655A>G Mutation in CEP290. Int. J. Mol. Sci. 2018, 19, 753. [Google Scholar] [CrossRef] [PubMed]
- Russell, S.R.; Drack, A.V.; Cideciyan, A.V.; Jacobson, S.G.; Leroy, B.P.; Van Cauwenbergh, C.; Ho, A.C.; Dumitrescu, A.V.; Han, I.C.; Martin, M.; et al. Intravitreal Antisense Oligonucleotide Sepofarsen in Leber Congenital Amaurosis Type 10: A Phase 1b/2 Trial. Nat. Med. 2022, 28, 1014–1021. [Google Scholar] [CrossRef] [PubMed]
- Ferenchak, K.; Deitch, I.; Huckfeldt, R. Antisense Oligonucleotide Therapy for Ophthalmic Conditions. Semin. Ophthalmol. 2021, 36, 452–457. [Google Scholar] [CrossRef] [PubMed]
- Justin, G.A.; Girach, A.; Maldonado, R.S. Antisense Oligonucleotide Therapy for Proline-23-Histidine Autosomal Dominant Retinitis Pigmentosa. Curr. Opin. Ophthalmol. 2023, 34, 226–231. [Google Scholar] [CrossRef] [PubMed]
- Petersen, U.S.S.; Doktor, T.K.; Andresen, B.S. Pseudoexon Activation in Disease by Non-Splice Site Deep Intronic Sequence Variation—Wild Type Pseudoexons Constitute High-Risk Sites in the Human Genome. Hum. Mutat. 2022, 43, 103–127. [Google Scholar] [CrossRef]
Gene | cNomen | gnomAD All (%) | ACMG | LOVD | ClinVar | HGMD | Ref. | Testing Assay |
---|---|---|---|---|---|---|---|---|
ABCA4 | NM_000350.2:c.3322C>T | 0.013 | P/P | VUS/LP/P | LP/P | DM | [66] | WES/LR-PCR/WGS |
ABCA4 | NM_000350.2:c.1555-5784C>G | NA | VUS/LB | - | - | - | - | LR-PCR/WGS |
ABCA4 | NM_000350.2:c.1555-5882C>A | NA | VUS/LB | - | - | - | - | LR-PCR/WGS |
ALMS1 | NM_001378454.1:c.3177C>A | NA | LP/LP | - | - | - | - | WES/WGS |
C1QTNF5 | NM_015645.4:c.212C>A | 0.004 | VUS/VUS | VUS | VUS | - | - | WES/WGS |
CFH | NM_000186.4:c.3494-405A>G | 0.032 | VUS/LB | - | - | - | - | WGS |
MFSD8 | NM_152778.3:c.199-1334A>G | 0.298 | VUS/LB | - | - | - | - | WGS |
Transcript | Length | WT (%) | MT (%) | Δ MT-WT (%) | Counts WT | Counts MT | Effect on Transcript | |
---|---|---|---|---|---|---|---|---|
T1 | RHO_ex3-RHO_ex5 | 119 bp | 98.69 | 54.15 | −44.54 | 58,175 | 61,349 | WT |
T2 | RHO_ex3-ABCA4_pe11a-RHO_ex5 | 246 bp | 0.74 | 0.04 | −0.7 | 438 | 49 | pe11a |
T3 | RHO_ex3-ABCA4_pe11b-RHO_ex5 | 293 bp | 0.05 | 44.64 | 44.59 | 30 | 50,572 | pe11b |
T4 | RHO_ex3-ABCA4_pe11a-ABCA4_pe11b-RHO_ex5 | 420 bp | 0 | 0.41 | 0.41 | 1 | 456 | pe11a + pe11b |
AON# | Sequence | Length | Tm | GC |
---|---|---|---|---|
AON1 | ACAAGCTGCAGTAGCAGCAGG | 21 bp | 59.5 | 57.1 |
AON2 | ACCAGGAAGCAGAGTTCACC | 20 bp | 56.0 | 55.0 |
Transcript | Length | WT (%) | MT (%) | Δ MT-WT (%) | Counts WT | Counts MT | Effect on Transcript | |
---|---|---|---|---|---|---|---|---|
T1 | RHO_ex3-RHO_ex5 | 119 bp | 99.15 | 77.18 | −21.97 | 89,966 | 36,962 | WT |
T2 | RHO_ex3-ABCA4_pe11a-RHO_ex5 | 246 bp | 0.29 | 0.31 | 0.02 | 262 | 150 | pe11a |
T3 | RHO_ex3-ABCA4_pe11b-RHO_ex5 | 293 bp | 0.02 | 21.05 | 21.03 | 26 | 10,082 | pe11b |
T4 | RHO_ex3-ABCA4_pe11a-ABCA4_pe11b-RHO_ex5 | 420 bp | 0 | 0.23 | 0.23 | 2 | 108 | pe11a + pe11b |
Transcript | Length | WT (%) | MT (%) | Δ MT-WT (%) | Counts WT | Counts MT | Effect on Transcript | |
---|---|---|---|---|---|---|---|---|
T1 | RHO_ex3-RHO_ex5 | 119 bp | 98.53 | 99.15 | 0.62 | 58,968 | 44,223 | WT |
T2 | RHO_ex3-ABCA4_pe11a-RHO_ex5 | 246 bp | 0.78 | 0.21 | −0.57 | 468 | 94 | pe11a |
T3 | RHO_ex3-ABCA4_pe11b-RHO_ex5 | 293 bp | 0.05 | 0.05 | 0 | 33 | 24 | pe11b |
T4 | RHO_ex3-ABCA4_pe11a-ABCA4_pe11b-RHO_ex5 | 420 bp | 0.01 | 0.01 | 0 | 4 | 4 | pe11a + pe11b |
PCR Primers | Expected Length | Measured Length | Conc. (ng/µl) |
---|---|---|---|
Ex11_F + Ex12_R | 224 bp | - | 47 |
Pe11a_F + Ex12_R | 239 bp | 245 bp | 3.2 |
Pe11b_F + Ex12_R | 171 bp | 174 bp | 2.1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Maggi, J.; Feil, S.; Gloggnitzer, J.; Maggi, K.; Hanson, J.V.M.; Koller, S.; Gerth-Kahlert, C.; Berger, W. Rescue of Aberrant Splicing Caused by a Novel Complex Deep-intronic ABCA4 Allele. Genes 2024, 15, 1503. https://doi.org/10.3390/genes15121503
Maggi J, Feil S, Gloggnitzer J, Maggi K, Hanson JVM, Koller S, Gerth-Kahlert C, Berger W. Rescue of Aberrant Splicing Caused by a Novel Complex Deep-intronic ABCA4 Allele. Genes. 2024; 15(12):1503. https://doi.org/10.3390/genes15121503
Chicago/Turabian StyleMaggi, Jordi, Silke Feil, Jiradet Gloggnitzer, Kevin Maggi, James V. M. Hanson, Samuel Koller, Christina Gerth-Kahlert, and Wolfgang Berger. 2024. "Rescue of Aberrant Splicing Caused by a Novel Complex Deep-intronic ABCA4 Allele" Genes 15, no. 12: 1503. https://doi.org/10.3390/genes15121503
APA StyleMaggi, J., Feil, S., Gloggnitzer, J., Maggi, K., Hanson, J. V. M., Koller, S., Gerth-Kahlert, C., & Berger, W. (2024). Rescue of Aberrant Splicing Caused by a Novel Complex Deep-intronic ABCA4 Allele. Genes, 15(12), 1503. https://doi.org/10.3390/genes15121503