Selected SNPs of FCN2 Associated with Chronic Tonsillitis in the Polish Adult Population
by
, , , , ,
Jadwiga Gaździcka
1,*
,
Karolina Gołąbek
1,
Dorota Hudy
1,
Katarzyna Miśkiewicz-Orczyk
2,
Natalia Zięba
2,
Wojciech Tynior
1,
Marek Asman
1,
Maciej Misiołek
2 and
Joanna Katarzyna Strzelczyk
1 1
Department of Medical and Molecular Biology, Faculty of Medical Sciences in Zabrze, Medical University of Silesia, 19 Jordana Str., 41-808 Zabrze, Poland
2
Department of Otorhinolaryngology and Oncological Laryngology, Faculty of Medical Sciences in Zabrze, Medical University of Silesia, 10 C Skłodowskiej Str., 41-800 Zabrze, Poland
*
Author to whom correspondence should be addressed.
Genes 2023, 14(2), 242; https://doi.org/10.3390/genes14020242
Submission received: 25 November 2022
/
Revised: 10 January 2023
/
Accepted: 16 January 2023
/
Published: 17 January 2023
(This article belongs to the Special Issue Head and Neck Genetics)
Abstract
:Chronic tonsillitis is a problem related to bacterial and viral infections. Ficolins play a key role in the defence against various pathogens. In the present study, we investigated the associations between the selected single nucleotide polymorphisms (SNPs) of the FCN2 gene and chronic tonsillitis in the Polish population. The study included 101 patients with chronic tonsillitis and 101 healthy individuals. The selected SNPs of FCN2 (rs3124953, rs17514136 and rs3124954) were genotyped using TaqMan SNP Genotyping Assays (Applied Biosystem, Foster City, CA, USA). The analysis of rs17514136 and rs3124953 showed no significant differences in genotype frequencies between the chronic tonsillitis patients and controls (p > 0.01). The CT genotype of rs3124954 was significantly more frequent, while the CC genotype was less frequent in chronic tonsillitis patients (p = 0.003 and p = 0.001, respectively). The frequency of the A/G/T haplotype (rs17514136/rs3124953/rs3124954) was significantly more common in chronic tonsillitis patients (p = 0.0011). Moreover, the FCN2 CT genotype of rs3124954 was associated with a higher risk of chronic tonsillitis, while the CC genotype of rs3124954 decreased this risk. Our findings demonstrate that FCN2 rs3124954 may be associated with chronic tonsillitis in the Polish adult population.
1. Introduction
Palatine tonsils are lymphatic tissues that are essential parts of Waldeyer’s ring, which forms the immune barrier of the respiratory and digestive systems by filtering exogenous antigens and by initiating immune responses [1]. Chronic tonsillitis is diagnosed in adult and children patients and is a global public health problem [2]. Aerobic and anaerobic bacterial and viral infections are connected with tonsillitis [3,4]. Additionally, the microbial biofilm may be crucial in chronic tonsillitis by promoting pathogen survival [1,2]. Patients with chronic tonsillitis may have frequent episodes of sore throats, sleepless nights, fevers and other complaints. Tonsillectomy is still one of the treatment methods that may increase patients’ quality of life [5,6].
The FCN2 gene encodes L-ficolin (also known as ficolin 2) and is located on chromosome 9p34 [7]. The expression of FCN2 occurs mainly in the liver. It is also present in the tonsils, bone marrow, small intestine, foetal lung and pancreas but at lower concentrations [8]. Ficolins are part of innate immunity and can recognise pathogen-associated molecular patterns (PAMPs) on pathogens. L-ficolin plays an important role in many viral and bacterial infections. It is also associated with parasites and fungi [9,10]. Additionally, the FCN2 gene has numerous single nucleotide polymorphisms (SNPs), which are located in promoters, introns or exons [7]. Some of them influence the serum concentrations of L-ficolin (e.g., rs17514136 and rs3124953), while others are associated with the risk of various diseases, such as systemic lupus erythematosus (SLE), schistosomiasis or Chagas disease [11,12,13,14,15,16]. Intronic polymorphisms may have a functional role and may also influence the expression of alternative transcripts of genes or change splicing efficiency [17].
The aim of the study was to evaluate the possible association of selected SNPs (rs17514136, rs3124953 and rs3124954) with chronic tonsillitis in the Polish adult population.
2. Materials and Methods
2.1. Study Group and Sample Collection
The present study included 101 patients with chronic tonsillitis and 101 healthy individuals. Patients with chronic tonsillitis were recruited at the Department of Otorhinolaryngology and Oncological Laryngology in Zabrze, Medical University of Silesia in Katowice (Poland). All study participants were of Caucasian origin. Data related to age, sex, comorbidities, smoking and drinking were collected using a questionnaire. The control group was sex- and age-matched. All study participants gave their informed consent to be included in the study. The Bioethics Committee of the Medical University of Silesia approved the present study (no. KNW/0022/KB1/49/16 and KNW/0022/KB1/49/II/16/17). The study was conducted in accordance with the Declaration of Helsinki.
Chronic tonsillitis specimens were obtained during tonsillectomy and frozen at −80 °C before DNA isolation. All palatine tonsil samples were verified by a pathologist. Oral epithelial cells were collected from the control group by buccal swabs.
2.2. SNPs Selection
The selection of FCN2 SNPs was based on the minor allele frequency (MAF) in the European population (minimum 0.1) (based on the National Center for Biotechnology Information, dbSNP) [18]. Moreover, all selected FCN2 SNPs have been analysed in various diseases related to inflammation or infection [11,12,13,14,15,16].
2.3. DNA Isolation
Tonsil tissue homogenisation was carried out using the FastPrep®-24 instrument (MP Biomedicals, Solon, CA, USA) with Lysing Matrix A tubes (MP Biomedicals, Solon, CA, USA). Genomic DNA was isolated from tonsillar tissue using GeneMatrix Tissue DNA Purification Kits (EURx, Gdańsk, Poland) according to the manufacturer’s protocol. DNA from the swab was extracted using the GeneMATRIX Swab-Extract DNA Purification Kit (EURx, Gdańsk, Poland). A NanoPhotometer® Pearl spectrophotometer (IMPLEN, München, Germany) was used to measure the quality and quantity of extracted DNA.
2.4. FCN2 Genotyping
Genotyping of the selected SNPs was performed with a QuantStudio™ 5 Real-Time PCR System and QuantStudio Design and Analysis Software v1.5.1 (Applied Biosystems, Foster City, CA, USA). The primers used in real-time PCR are given in Table 1. The total volume used in the PCR amplification was 25 µL and contained a 11.25 μL DNA sample, a 12.5 μL TaqMan® Genotyping Master Mix (Applied Biosystems, Foster City, CA, USA) and 1.25 μL TaqMan® Genotyping Assays (Applied Biosystems, Foster City, CA, USA). The catalogue numbers for rs17514136, rs3124953 and rs3124954 were C_25765134_10, C_27461651_20 and C_27462209_20, respectively. The PCR conditions were as follows: denaturation at 95 °C for 10 min, 40 cycles of 95 °C for 15 s and 60 °C for 1 min.
2.5. Statistical Analysis
STATISTICA v. 13.1 (StatSoft, Krakow, Poland) was used for statistical calculations. The Shapiro–Wilk test was used to check the normality of the age parameter, and the Mann–Whitney U test was used to assess statistical significance between the groups. The SNPs significances were tested by logistic regression. The different-models and haplotype analyses were conducted with SNPStats program [19]. A p-value below 0.017 was considered significant; this p-value threshold was obtained after Bonferroni correction. All analysed SNPs satisfied the Hardy–Weinberg equilibrium.
3. Results
3.1. Study Group
The study group of patients with chronic tonsillitis was composed of 101 subjects (56 females and 45 males). The control group included 101 healthy volunteers (56 females and 45 males). Table 2 shows the characteristics of the study group.
Lower age was positively correlated with the risk of chronic tonsillitis (p = 0.014). There were no significant difference in smoking status between chronic tonsillitis and controls (p > 0.05). Alcohol consumption was negatively correlated with tonsillitis (p < 0.01). This may be due to the fact that significantly more individuals in the control group consumed alcohol. We also simultaneously analysed the effect of SNP in men and women on the risk of chronic tonsillitis. However, we found no associations (p > 0.05).
Table 3 shows that all analysed SNPs satisfied the Hardy–Weinberg equilibrium.
3.2. Distribution of Selected FCN2 SNPs in the Study Group
The FCN2 genotype distributions are given in Table 4.
The analysis of rs17514136 and rs3124953 showed no significant differences in the frequency of genotypes between chronic tonsillitis patients and controls (Table 4.).
The investigation of rs3124954 showed that the frequency of the CT genotype was significantly higher in chronic tonsillitis patients compared to the controls (p = 0.003), while the CC genotype was significantly less prevalent in the study group than in the controls (p < 0.001). The TT genotype was at a similar level in the study group and controls.
Our results indicate that the FCN2 CT genotype of rs3124954 was associated with a higher risk of chronic tonsillitis, while the CC genotype of rs3124954 could decrease the risk of inflammation.
The different-models analysis of the frequency of FCN2 genotypes in patients with chronic tonsillitis and controls are presented in Table 5.
The haplotypes and their frequencies in the study group are shown in Table 6. The frequency of the haplotype A/G/T (rs17514136/rs3124953/rs3124954) was significantly more common in chronic tonsillitis patients (p = 0.0011).
4. Discussion
In this study, we investigated the associations between the SNPs of FCN2 (rs17514136, rs3124953, and rs3124954) and susceptibility to chronic tonsillitis among adult patients in the Polish population.
Some studies found that FCN2 rs3124953 and rs17514136 were associated with changes in serum L-ficolin [11,20]. Studies found that both FCN2 SNPs were significantly differently distributed worldwide, depending on ethnicity (e.g., European Caucasians or Brazilians) [21,22]. These ethnic differences in FCN2 SNPs may influence the concentration and function of L-ficolin and may be associated with different susceptibilities to infections or diseases among different populations [22].
These SNPs were analysed in various diseases, including inflammation among European Caucasians. In this study, we found no significant differences in the genotype frequencies of rs17514136 and rs3124953 between the chronic tonsillitis patients and controls. Similar to our study, Erkan et al. [23] analysed both FCN2 SNPs in Turkish paediatric patients diagnosed with chronic adenotonsillitis. They found no significant differences in genotype frequencies of these SNPs between patients and controls [23].
Other studies also related to infections found no significant association of FCN2 rs17514136 and rs3124953 with the risk of dental caries in young Polish patients [24], invasive pneumococcal disease in Caucasians from the United Kingdom [25] or the risk of recurrent respiratory tract infections in Dutch Caucasian children [26]. Additionally, among Japanese patients with inflammatory disorders, no differences were found in the genotype or allele frequencies of rs17514136 and rs3124953 in patients with Behcet’s disease compared to healthy individuals [27]. In addition, these SNPs were not associated with dengue fever or hepatitis B infection in subjects of Vietnamese ethnicity [28,29] or pulmonary tuberculosis in patients from Southeast China [30]. Moreover, none of the genotypes of rs17514136 was associated with susceptibility to rheumatoid arthritis in Brazilian patients [14]. Studies based on the Polish population that analysed the possible associations between rs17514136 and cancer risk showed no association of any genotype of SNP with ovarian cancer [31] or acute myeloid leukaemia [32]. However, the AG genotype and minor G allele in rs17514136 significantly increased the risk of schistosomiasis infection among the Nigerian population, while the AA genotype protected against Schistosoma haematobium infection [15]. Elshamaa et al. [33] found that the frequency of the AA genotype of rs17514136 was significantly higher in rheumatic fever (RF) and rheumatic heart disease (RHD) in teenage Caucasian Egyptian patients. Moreover, the A allele was associated with the risk of RF. No association was observed between rs3124953, and the risk of RF or RHD [23]. Marzetti et al. [34] showed that the GG genotype of rs17514136 was a protective factor against RF in Italian children, while the AG genotype protected RF patients against carditis. In addition, the AA genotype of rs3124953 was connected with a late onset of RF [34].
To our knowledge, the present study is the first to investigate the connection between rs3124954 and chronic tonsillitis. Our study showed that the CT genotype of rs3124954 was associated with a higher risk of chronic tonsillitis, while the CC genotype could decrease the risk of tonsillitis. However, Ashmawy et al. [35] investigated rs3124954 in Egyptian children diagnosed with juvenile-onset systemic lupus erythematosus (joSLE). They found that CC homozygotes had a significantly higher risk of joSLE. Moreover, they suggested that the T allele could protect against joSLE [35]. Another study also analysed SLE and rheumatoid arthritis in adult patients in the Brazilian population [14]. No association was observed between the SNPs and these diseases. Instead, the T allele and the TT genotype were significantly associated with nephritis, which is one of the clinical manifestations of SLE [14].
In this study, we found that lower age was associated with a higher risk of chronic tonsillitis. Chronic tonsillitis may be diagnosed at any age. However, it is more common in young adults with the median age of 26–27 years [6,36]. Lower age may be connected to exposure to common pathogens and the developing immune system [4,37].
Moreover, we detected that alcohol was negatively correlated with tonsillitis, which is probably related to the higher number of alcohol consumers in the control group. However, further studies on larger cohorts of patients are warranted to confirm these findings.
Tonsillitis is diagnosed more commonly in women [38,39]. Therefore, we analysed the potential influence of the genotype on the risk of chronic tonsillitis in both sexes. However, we found no significant associations.
The main limitation of the current study was the small sample size. Furthermore, we did not measure L-ficolin serum concentrations, which may have influenced immune defence in patients with chronic tonsillitis. However, we plan to conduct such a study in the future. Moreover, data related to comorbidities were collected using a questionnaire. However, it may not be sufficient to exclude, e.g., asymptomatic liver disease. We should have used a more precise test: ultrasound or assessment of liver enzymes.
5. Conclusions
Our findings demonstrate that FCN2 rs3124954 may contribute to susceptibility to chronic tonsillitis in the Polish population. We suggested that the CT genotype of rs3124954 could increase the risk of chronic tonsillitis. On the contrary, the CC genotype of rs3124954 may decrease this risk. Moreover, the frequency of the A/G/T haplotype was significantly more common in chronic tonsillitis patients. In addition, we reported that chronic tonsillitis was associated with age. Further studies on larger cohorts are warranted to confirm our findings. Furthermore, future investigations are needed to clarify the possible associations between the selected FCN2 SNPs and clinical manifestations of patients, and L-ficolin serum concentration in patients with chronic tonsillitis.
Author Contributions
Conceptualisation, J.G. and K.G.; methodology, J.G. and K.G.; formal analysis, D.H.; investigation, J.G. and K.G.; data curation, D.H., J.G., K.M.-O. and N.Z.; resources, K.M.-O., N.Z., W.T., M.A., D.H., K.G. and J.G.; writing—original draft preparation, J.G.; writing—review and editing, K.G.; supervision, J.K.S. and M.M.; project administration, J.G.; funding acquisition, J.G. All authors have read and agreed to the published version of the manuscript.
Funding
This work was supported by a grant from the Medical University of Silesia (PCN-2-093/N/0/O).
Institutional Review Board Statement
The study was conducted in accordance with the Declaration of Helsinki and approved by the Bioethics Committee of the Medical University of Silesia (no. KNW/0022/KB1/49/16 and KNW/0022/KB1/49/II/16/17).
Informed Consent Statement
Informed consent was obtained from all subjects involved in the study.
Data Availability Statement
The data used to support the findings of this research are available upon request.
Conflicts of Interest
The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.
References
- Arambula, A.; Brown, J.R.; Neff, L. Anatomy and physiology of the palatine tonsils, adenoids, and lingual tonsils. World J. Otorhinolaryngol. Head Neck Surg. 2021, 7, 155–160. [Google Scholar] [CrossRef] [PubMed]
- Abu Bakar, M.; McKimm, J.; Haque, S.Z.; Majumder, M.A.A.; Haque, M. Chronic tonsillitis and biofilms: A brief overview of treatment modalities. J. Inflamm. Res. 2018, 11, 329–337. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Anderson, J.; Paterek, E. Tonsillitis. In StatPearls; StatPearls Publishing: Treasure Island, FL, USA, 2022. Available online: https://www.ncbi.nlm.nih.gov/books/NBK544342/ (accessed on 26 September 2022).
- Bathala, S.; Eccles, R. A review on the mechanism of sore throat in tonsillitis. J. Laryngol. Otol. 2013, 12, 227–232. [Google Scholar] [CrossRef]
- Burton, M.J.; Glasziou, P.P.; Chong, L.Y.; Venekamp, R.P. Tonsillectomy or adenotonsillectomy versus non-surgical treatment for chronic/recurrent acute tonsillitis. Cochrane Database Syst. Rev. 2014, 2014, CD001802. [Google Scholar] [CrossRef] [Green Version]
- Senska, G.; Ellermann, S.; Ernst, S.; Lax, H.; Dost, P. Recurrent tonsillitis in adults: Quality of life after tonsillectomy. Dtsch. Ärzteblatt Int. 2010, 107, 622–628. [Google Scholar] [CrossRef]
- Garred, P.; Honoré, C.; Ma, Y.J.; Rørvig, S.; Cowland, J.; Borregaard, N.; Hummelshøj, T. The genetics of ficolins. J. Innate Immun. 2010, 2, 3–16. [Google Scholar] [CrossRef]
- Hummelshoj, T.; Fog, L.M.; Madsen, H.O.; Sim, R.B.; Garred, P. Comparative study of the human ficolins reveals unique features of Ficolin-3 (Hakata antigen). Mol. Immunol. 2008, 45, 1623–1632. [Google Scholar] [CrossRef] [PubMed]
- Bidula, S.; Sexton, D.W.; Schelenz, S. Ficolins and the Recognition of Pathogenic Microorganisms: An Overview of the Innate Immune Response and Contribution of Single Nucleotide Polymorphisms. J. Immunol. Res. 2019, 2019, 3205072. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ren, Y.; Ding, Q.; Zhang, X. Ficolins and infectious diseases. Virol. Sin. 2014, 29, 25–32. [Google Scholar] [CrossRef]
- Hummelshoj, T.; Munthe-Fog, L.; Madsen, H.O.; Fujita, T.; Matsushita, M.; Garred, P. Polymorphisms in the FCN2 gene determine serum variation and function of Ficolin-2. Hum. Mol. Genet. 2005, 14, 1651–1658. [Google Scholar] [CrossRef]
- Cedzynski, M.; Nuytinck, L.; Atkinson, A.P.; St Swierzko, A.; Zeman, K.; Szemraj, J.; Szala, A.; Turner, M.L.; Kilpatrick, D.C. Extremes of L-ficolin concentration in children with recurrent infections are associated with single nucleotide polymorphisms in the FCN2 gene. Clin. Exp. Immunol. 2007, 150, 99–104. [Google Scholar] [CrossRef]
- Kilpatrick, D.C.; St Swierzko, A.; Matsushita, M.; Domzalska-Popadiuk, I.; Borkowska-Klos, M.; Szczapa, J.; Cedzynski, M. The relationship between FCN2 genotypes and serum ficolin-2 (L-ficolin) protein concentrations from a large cohort of neonates. Hum. Immunol. 2013, 74, 867–871. [Google Scholar] [CrossRef] [PubMed]
- Addobbati, C.; de Azevêdo Silva, J.; Tavares, N.A.; Monticielo, O.; Xavier, R.M.; Brenol, J.C.; Crovella, S.; Chies, J.A.; Sandrin-Garcia, P. Ficolin Gene Polymorphisms in Systemic Lupus Erythematosus and Rheumatoid Arthritis. Ann. Hum. Genet. 2016, 80, 1–6. [Google Scholar] [CrossRef]
- Ouf, E.A.; Ojurongbe, O.; Akindele, A.A.; Sina-Agbaje, O.R.; Van Tong, H.; Adeyeba, A.O.; Kremsner, P.G.; Kun, J.F.; Velavan, T. Ficolin-2 levels and FCN2 genetic polymorphisms as a susceptibility factor in schistosomiasis. J. Infect. Dis. 2012, 206, 562–570. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Luz, P.R.; Boldt, A.B.; Grisbach, C.; Kun, J.F.; Velavan, T.P.; Messias-Reason, I.J. Association of L-ficolin levels and FCN2 genotypes with chronic Chagas disease. PLoS ONE 2013, 8, e60237. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cooper, D.N. Functional intronic polymorphisms: Buried treasure awaiting discovery within our genes. Hum. Genom. 2010, 4, 284–288. [Google Scholar] [CrossRef] [PubMed]
- Available online: http://www.ncbi.nlm.nih.gov/SNP/ (accessed on 1 January 2022).
- Solé, X.; Guinó, E.; Valls, J.; Iniesta, R.; Moreno, V. SNPStats: A web tool for the analysis of association studies. Bioinformatics 2006, 22, 1928–1929. [Google Scholar] [CrossRef] [Green Version]
- Munthe-Fog, L.; Hummelshøj, T.; Hansen, B.E.; Koch, C.; Madsen, H.O.; Skjødt, K.; Garred, P. The impact of FCN2 polymorphisms and haplotypes on the Ficolin-2 serum levels. Scand. J. Immunol. 2007, 65, 383–392. [Google Scholar] [CrossRef]
- Ojurongbe, O.; Ouf, E.A.; Van Tong, H.; Toan, N.L.; Song le, H.; Luz, P.R.; Messias-Reason, I.J.; Nurjadi, D.; Zanger, P.; Kun, J.F.; et al. Reliable and rapid characterization of functional FCN2 gene variants reveals diverse geographical patterns. BMC Med. Genet. 2012, 13, 37. [Google Scholar] [CrossRef]
- Hummelshøj, T.; Munthe-Fog, L.; Madsen, H.O.; Garred, P. Functional SNPs in the human ficolin (FCN) genes reveal distinct geographical patterns. Mol. Immunol. 2008, 45, 2508–2520. [Google Scholar] [CrossRef]
- Erkan, A.N.; Oz, I.; Terzi, Y.K.; Aydin, E.; Ozkale, M.; Babakurban, S.T.; Koycu, A.; Sahin, F.I. FCN2 c.772G>T polymorphism is associated with chronic adenoiditis and/or tonsillitis, but not -4 A>G and -602 G>A. Int. J. Pediatr. Otorhinolaryngol. 2016, 87, 1–4. [Google Scholar] [CrossRef] [PubMed]
- Olszowski, T.; Milona, M.; Janiszewska-Olszowska, J.; Safranow, K.; Skonieczna-Żydecka, K.; Walczak, A.; Sikora, M.; Chlubek, D.; Madlani, A.; Adler, G. The Lack of Association between FCN2 Gene Promoter Region Polymorphisms and Dental Caries in Polish Children. Caries Res. 2017, 51, 79–84. [Google Scholar] [CrossRef] [PubMed]
- Chapman, S.J.; Vannberg, F.O.; Khor, C.C.; Segal, S.; Moore, C.E.; Knox, K.; Day, N.P.; Davies, R.J.; Crook, D.W.; Hill, A.V. Functional polymorphisms in the FCN2 gene are not associated with invasive pneumococcal disease. Mol. Immunol. 2007, 44, 3267–3270. [Google Scholar] [CrossRef] [PubMed]
- Ruskamp, J.M.; Hoekstra, M.O.; Postma, D.S.; Kerkhof, M.; Bottema, R.W.; Koppelman, G.H.; Rovers, M.M.; Wijga, A.H.; de Jongste, J.C.; Brunekreef, B.; et al. Exploring the role of polymorphisms in ficolin genes in respiratory tract infections in children. Clin. Exp. Immunol. 2009, 155, 433–440. [Google Scholar] [CrossRef]
- Chen, X.; Katoh, Y.; Nakamura, K.; Oyama, N.; Kaneko, F.; Endo, Y.; Fujita, T.; Nishida, T.; Mizuki, N. Single nucleotide polymorphisms of Ficolin 2 gene in Behçet’s disease. J. Dermatol. Sci. 2006, 43, 201–205. [Google Scholar] [CrossRef]
- Giang, N.T.; Tong, H.V.; Nghia, T.H.; Hung, H.V.; Anh, D.T.; Nam, L.V.; Mao, C.V.; Giang, N.T.; Thanh, L.D.; Son, H.A.; et al. Association of FCN2 polymorphisms and Ficolin-2 levels with dengue fever in Vietnamese patients. Int. J. Infect. Dis. 2020, 95, 253–261. [Google Scholar] [CrossRef]
- Hoang, T.V.; Toan, N.L.; Song le, H.; Ouf, E.A.; Bock, C.T.; Kremsner, P.G.; Kun, J.F.; Velavan, T.P. Ficolin-2 levels and FCN2 haplotypes influence hepatitis B infection outcome in Vietnamese patients. PLoS ONE 2011, 6, e28113. [Google Scholar] [CrossRef]
- Xu, D.D.; Wang, C.; Jiang, F.; Wei, L.L.; Shi, L.Y.; Yu, X.M.; Liu, C.M.; Liu, X.H.; Feng, X.M.; Ping, Z.P.; et al. Association of the FCN2 Gene Single Nucleotide Polymorphisms with Susceptibility to Pulmonary Tuberculosis. PLoS ONE 2015, 10, e0138356. [Google Scholar] [CrossRef]
- Szala, A.; Sawicki, S.; Swierzko, A.S.; Szemraj, J.; Sniadecki, M.; Michalski, M.; Kaluzynski, A.; Lukasiewicz, J.; Maciejewska, A.; Wydra, D.; et al. Ficolin-2 and ficolin-3 in women with malignant and benign ovarian tumours. Cancer Immunol. Immunother. 2013, 62, 1411–1419. [Google Scholar] [CrossRef] [Green Version]
- Sokołowska, A.; Świerzko, A.S.; Gajek, G.; Gołos, A.; Michalski, M.; Nowicki, M.; Szala-Poździej, A.; Wolska-Washer, A.; Brzezińska, O.; Wierzbowska, A.; et al. Associations of ficolins and mannose-binding lectin with acute myeloid leukaemia in adults. Sci. Rep. 2020, 10, 10561. [Google Scholar] [CrossRef]
- Elshamaa, M.F.; Hamza, H.; El Rahman, N.A.; Emam, S.; Elghoroury, E.A.; Farid, T.M.; Zaher, A.Z.; Ibrahim, M.H.; Kamel, S.; El-Aziz, D.A. Association of ficolin-2 (FCN2) functional polymorphisms and protein levels with rheumatic fever and rheumatic heart disease: Relationship with cardiac function. Arch. Med. Sci. Atheroscler. Dis. 2018, 3, e142–e155. [Google Scholar] [CrossRef] [PubMed]
- Marzetti, V.; Di Battista, C.; Ferrante, R.; Carlucci, L.; Balsamo, M.; Stuppia, L.; Lapergola, G.; Antonucci, I.; Chiarelli, F.; Breda, L. MBL2 and FCN2 gene polymorphisms in a cohort of Italian children with rheumatic fever: A case-control study. Semin. Arthritis Rheum. 2017, 47, 264–268. [Google Scholar] [CrossRef] [PubMed]
- Ashmawy, I.; El-Lebedy, D.; Awadallah, E.; Marzouk, H.; Farag, Y.; Ibrahim, A.A. Association of FCN2 gene rs3124954 and STAT4 gene rs7582694 polymorphisms with juvenile onset systemic lupus erythematosus and lupus nephritis in a sample of Egyptian children. Gene Rep. 2020, 21, 100968. [Google Scholar] [CrossRef]
- Slouka, D.; Čejková, Š.; Hanáková, J.; Hrabačka, P.; Kormunda, S.; Kalfeřt, D.; Skálová, A.; Šimánek, V.; Kucera, R. Risk of Postoperative Bleeding in Tonsillectomy for Peritonsillar Abscess, as Opposed to in Recurrent and Chronic Tonsillitis—A Retrospective Study. Int. J. Environ. Res. Public Health 2021, 18, 1946. [Google Scholar] [CrossRef]
- ESCMID Sore Throat Guideline Group; Pelucchi, C.; Grigoryan, L.; Galeone, C.; Esposito, S.; Huovinen, P.; Little, P.; Verheij, T. Guideline for the management of acute sore throat. Clin. Microbiol. Infect. 2012, 18, 1–28. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Falagas, M.E.; Mourtzoukou, E.G.; Vardakas, K.Z. Sex differences in the incidence and severity of respiratory tract infections. Respir. Med. 2007, 101, 1845–1863. [Google Scholar] [CrossRef] [Green Version]
- Gay, L.; Melenotte, C.; Lakbar, I.; Mezouar, S.; Devaux, C.; Raoult, D.; Bendiane, M.K.; Leone, M.; Mège, J.L. Sexual Dimorphism and Gender in Infectious Diseases. Front. Immunol. 2021, 12, 698121. [Google Scholar] [CrossRef]
Table 1.
Polymorphisms and primers used in genotyping reaction.
| SNP ID | Allele Change | SNP Type | Sequence (VIC/FAM) |
|---|---|---|---|
| rs17514136 | A/G | intron | GGCACCTTTTGAAGCAAAGACCAGA[A/G]GAGATGGAGCTGGACAGAGCTGTGG |
| rs3124953 | A/G | intron | CTCTTCTCTCCTTTCCCTCCTGTTC[A/G]TGTGCCCCTGTGCTCTACATACTGC |
| rs3124954 | C/T | intron | GATTCGTGTCAGGATTTCTGGAATG[C/T]ATGTGAGACACAGAGCTCTGCGGTG |
Table 2.
Characteristics of the study group.
| Characteristic | Chronic Tonsillitis, n (%) | Controls, n (%) | |
|---|---|---|---|
| Sex | female | 56 (55.45) | 56 (55.45) |
| male | 45 (44.55) | 45 (44.55) | |
| Median age (range) | 32 (18–64) | 37 (18–69) | |
| Smoking | yes | 13 (12.87) | 21 (20.79) |
| no | 88 (87.13) | 80 (79.21) | |
| Drinking | yes | 33 (32.67) | 81 (80.20) |
| no | 68 (67.33) | 20 (19.80) | |
| Smoking and drinking | yes | 10 (9.90) | 21 (20.79) |
| no | 91 (90.10) | 80 (79.21) | |
Table 3.
Hardy–Weinberg equilibrium for FCN2 SNPs.
| SNP | Study Group | p-Value |
|---|---|---|
| rs17514136 (n = 198) | All cases | 0.368 |
| Chronic tonsillitis | 0.245 | |
| Controls | 0.685 | |
| rs3124953 (n = 199) | All cases | 0.816 |
| Chronic tonsillitis | 0.112 | |
| Controls | 0.172 | |
| rs3124954 (n = 194) | All cases | 0.999 |
| Chronic tonsillitis | 0.372 | |
| Controls | 0.469 |
Table 4.
Frequency of FCN2 genotypes in patients with chronic tonsillitis and controls.
| FCN2 SNP | Variable | Chronic Tonsillitis n (%) | Controls n (%) | Without Adjustment | Adjusted by Age and Alcohol * | ||
|---|---|---|---|---|---|---|---|
| OR (95%CI) | p-Value | OR (95%CI) | p-Value | ||||
| rs17514136 | AA | 43 (43.43) | 28 (28.28) | 0.72 (0.53–0.96) | 0.027 | 0.72 (0.50–1.02) | 0.061 |
| AG | 49 (49.50) | 52 (52.53) | 1.06 (0.80–1.40) | 0.700 | 1.04 (0.75–1.44) | 0.830 | |
| GG | 7 (7.07) | 19 (19.19) | 1.77 (1.12–2.79) | 0.015 | 1.83 (1.07–3.11) | 0.026 | |
| rs3124953 | GG | 60 (60.61) | 70 (70.00) | 1.23 (0.92–1.65) | 0.165 | 1.35 (0.96–1.91) | 0.085 |
| AG | 38 (38.38) | 25 (25.00) | 0.73 (0.54–0.99) | 0.044 | 0.66 (0.47–0.95) | 0.024 | |
| AA | 1 (1.01) | 5 (5.00) | 2.27 (0.77–6.71) | 0.552 | 2.13 (0.66–6.92) | 0.208 | |
| rs3124954 | CC | 41 (41.41) | 66 (69.47) | 1.79 (1.33–2.41) | 1.09 × 10−4 | 1.86 (1.30–2.65) | 0.001 |
| CT | 49 (49.50) | 25 (26.32) | 0.60 (0.45–0.82) | 0.001 | 0.58 (0.40–0.83) | 0.003 | |
| TT | 9 (9.09) | 4 (4.21) | 0.66 (0.36–1.22) | 0.184 | 0.62 (0.28–1.35) | 0.224 | |
* Adjusted by age and alcohol, becausesmoking and gender do not have significant effects.
Table 5.
Different-models analysis of frequency of FCN2 genotypes in patients with chronic tonsillitis and controls.
Table 5.
Different-models analysis of frequency of FCN2 genotypes in patients with chronic tonsillitis and controls.
| rs17514136 Association with Chronic Tonsillitis/Control Probes (n = 198, Adjusted by Age and Alcohol) | |||||
| Model | Genotype | Chronic Tonsillitis n (%) | Controls n (%) | OR (95%CI) | p-Value |
| Codominant | A/A | 43 (43.4%) | 28 (28.3%) | 1 | 0.028 |
| A/G | 49 (49.5%) | 52 (52.5%) | 1.61 (0.78–3.34) | ||
| G/G | 7 (7.1%) | 19 (19.2%) | 4.47 (1.41–14.20) | ||
| Dominant | A/A | 43 (43.4%) | 28 (28.3%) | 1 | 0.059 |
| A/G-G/G | 56 (56.6%) | 71 (71.7%) | 1.95 (0.97–3.93) | ||
| Recessive | A/A-A/G | 92 (92.9%) | 80 (80.8%) | 1 | 0.020 |
| G/G | 7 (7.1%) | 19 (19.2%) | 3.34 (1.15–9.65) | ||
| Over-dominant | A/A-G/G | 50 (50.5%) | 47 (47.5%) | 1 | 0.830 |
| A/G | 49 (49.5%) | 52 (52.5%) | 1.07 (0.56–2.07) | ||
| rs3124953 association with Chronic tonsillitis/Control probes (n = 199, adjusted by age and alcohol) | |||||
| Model | Genotype | Chronic tonsillitis n (%) | Controls n (%) | OR (95%CI) | p-value |
| Codominant | G/G | 60 (60.6%) | 70 (70%) | 1 | 0.039 |
| A/G | 38 (38.4%) | 25 (25%) | 0.46 (0.23–0.95) | ||
| A/A | 1 (1%) | 5 (5%) | 3.49 (0.32–37.66) | ||
| Dominant | G/G | 60 (60.6%) | 70 (70%) | 1 | 0.083 |
| A/G-A/A | 39 (39.4%) | 30 (30%) | 0.55 (0.27–1.09) | ||
| Recessive | G/G-A/G | 98 (99%) | 95 (95%) | 1 | 0.160 |
| A/A | 1 (1%) | 5 (5%) | 4.54 (0.43–47.84) | ||
| Over-dominant | G/G-A/A | 61 (61.6%) | 75 (75%) | 1 | 0.022 |
| A/G | 38 (38.4%) | 25 (25%) | 0.44 (0.22–0.90) | ||
| rs3124954 association with Chronic tonsillitis/Control probes (n = 194, adjusted by age and alcohol) | |||||
| Model | Genotype | Chronic tonsillitis n (%) | Controls n (%) | OR (95%CI) | p-value |
| Codominant | C/C | 41 (41.4%) | 66 (69.5%) | 1 | 0.0022 |
| C/T | 49 (49.5%) | 25 (26.3%) | 0.30 (0.14–0.63) | ||
| T/T | 9 (9.1%) | 4 (4.2%) | 0.24 (0.05–1.19) | ||
| Dominant | C/C | 41 (41.4%) | 66 (69.5%) | 1 | 0.0005 |
| C/T-T/T | 58 (58.6%) | 29 (30.5%) | 0.29 (0.14–0.59) | ||
| Recessive | C/C-C/T | 90 (90.9%) | 91 (95.8%) | 1 | 0.220 |
| T/T | 9 (9.1%) | 4 (4.2%) | 0.38 (0.08–1.81) | ||
| Over-dominant | C/C-T/T | 50 (50.5%) | 70 (73.7%) | 1 | 0.0026 |
| C/T | 49 (49.5%) | 25 (26.3%) | 0.34 (0.16–0.69) | ||
Table 6.
Haplotype analysis.
| Haplotype Frequencies Estimation (n = 202) | |||||||
| rs17514136 | rs3124953 | rs3124954 | Total | Chronic Tonsillitis | Controls | Cumulative Frequency | |
| 1 | G | G | C | 0.3633 | 0.2982 | 0.428 | 0.3633 |
| 2 | A | G | T | 0.2518 | 0.3244 | 0.1712 | 0.6151 |
| 3 | A | G | C | 0.1935 | 0.1632 | 0.2258 | 0.8086 |
| 4 | A | A | C | 0.1689 | 0.1952 | 0.149 | 0.9775 |
| 5 | G | A | C | 0.0176 | 0.003 | 0.0259 | 0.9951 |
| 6 | G | G | T | 0.0049 | 0.016 | 0 | 1 |
| 7 | G | A | T | 0 | NA | 0 | 1 |
| 8 | A | A | T | 0 | 0 | 0 | 1 |
| Haplotype analysis (n = 202, adjusted by age and alcohol) | |||||||
| rs17514136 | rs3124953 | rs3124954 | Frequency | OR (95%CI) | p-value | ||
| 1 | G | G | C | 0.3638 | 1 | --- | |
| 2 | A | G | T | 0.2489 | 0.31 (0.15–0.62) | 0.0011 | |
| 3 | A | G | C | 0.1949 | 0.98 (0.47–2.04) | 0.950 | |
| 4 | A | A | C | 0.17 | 0.46 (0.23–0.95) | 0.038 | |
| 5 | G | A | C | 0.0166 | 1.58 (0.13–19.17) | 0.720 | |
| rare | * | * | * | 0.0058 | 0.00 (-Inf-Inf) | 1.00 | |
Global haplotype association p-value: 0.0029. * denotes other haplotypes that occur very rarely or never in our study.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Gaździcka, J.; Gołąbek, K.; Hudy, D.; Miśkiewicz-Orczyk, K.; Zięba, N.; Tynior, W.; Asman, M.; Misiołek, M.; Strzelczyk, J.K. Selected SNPs of FCN2 Associated with Chronic Tonsillitis in the Polish Adult Population. Genes 2023, 14, 242. https://doi.org/10.3390/genes14020242
AMA Style
Gaździcka J, Gołąbek K, Hudy D, Miśkiewicz-Orczyk K, Zięba N, Tynior W, Asman M, Misiołek M, Strzelczyk JK. Selected SNPs of FCN2 Associated with Chronic Tonsillitis in the Polish Adult Population. Genes. 2023; 14(2):242. https://doi.org/10.3390/genes14020242
Chicago/Turabian StyleGaździcka, Jadwiga, Karolina Gołąbek, Dorota Hudy, Katarzyna Miśkiewicz-Orczyk, Natalia Zięba, Wojciech Tynior, Marek Asman, Maciej Misiołek, and Joanna Katarzyna Strzelczyk. 2023. "Selected SNPs of FCN2 Associated with Chronic Tonsillitis in the Polish Adult Population" Genes 14, no. 2: 242. https://doi.org/10.3390/genes14020242
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
