Expression and Genetic Effects of GLI Pathogenesis-Related 1 Gene on Backfat Thickness in Pigs
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statements
2.2. Animals and Sample Collection
2.3. Genomic DNA and RNA Isolation
2.4. Expression Detection and Analysis of GLIPR1 Gene
2.5. SNP Identification and Association Analysis
2.6. Linkage Disequilibrium (LD) and Haplotype Analysis
3. Results
3.1. Tissue Expression Profiles of GLIPR1
3.2. SNP Identification and Association with BFT
3.3. Haplotype Analysis of GLIPR1 Gene
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Gozalo-Marcilla, M.; Buntjer, J.; Johnsson, M.; Batista, L.; Diez, F.; Werner, C.R.; Chen, C.Y.; Gorjanc, G.; Mellanby, R.J.; Hickey, J.M.; et al. Genetic architecture and major genes for backfat thickness in pig lines of diverse genetic backgrounds. Genet. Sel. Evol. 2021, 53, 76. [Google Scholar] [CrossRef] [PubMed]
- Lonergan, S.M.; Huff-Lonergan, E.; Rowe, L.J.; Kuhlers, D.L.; Jungst, S.B. Selection for lean growth efficiency in Duroc pigs influences pork quality. J. Anim. Sci. 2001, 79, 2075–2085. [Google Scholar] [CrossRef] [PubMed]
- Zambonelli, P.; Gaffo, E.; Zappaterra, M.; Bortoluzzi, S.; Davoli, R. Transcriptional profiling of subcutaneous adipose tissue in Italian Large White pigs divergent for backfat thickness. Anim. Genet. 2016, 47, 306–323. [Google Scholar] [CrossRef] [PubMed]
- Kojima, M.; Nakajima, I.; Arakawa, A.; Mikawa, S.; Matsumoto, T.; Uenishi, H.; Nakamura, Y.; Taniguchi, M. Differences in gene expression profiles for subcutaneous adipose, liver, and skeletal muscle tissues between Meishan and Landrace pigs with different backfat thicknesses. PLoS ONE 2018, 13, e0204135. [Google Scholar] [CrossRef]
- Meidtner, K.; Schwarzenbacher, H.; Scharfe, M.; Severitt, S.; Blöcker, H.; Fries, R. Haplotypes of the porcine peroxisome proliferator-activated receptor delta gene are associated with backfat thickness. BMC Genet. 2009, 10, 76. [Google Scholar] [CrossRef]
- Seo, Y.J.; Lim, B.; Kim, D.Y.; Lim, K.S.; Kim, J.M. Regulation of Swine Growth by Backfat Tissue during Growing and Finishing Stages. Animals 2021, 11, 3511. [Google Scholar] [CrossRef]
- Liu, X.; Gong, J.; Wang, L.; Hou, X.; Gao, H.; Yan, H.; Zhao, F.; Zhang, L.; Wang, L. Genome-Wide Profiling of the Microrna Transcriptome Regulatory Network to Identify Putative Candidate Genes Associated with Backfat Deposition in Pigs. Animals 2019, 9, 313. [Google Scholar] [CrossRef]
- Gibbs, G.M.; Roelants, K.; O’Bryan, M.K. The CAP Superfamily: Cysteine-Rich Secretory Proteins, Antigen 5, and Pathogenesis-Related 1 Proteins—Roles in Reproduction, Cancer, and Immune Defense. Endocr. Rev. 2008, 29, 865–897. [Google Scholar] [CrossRef]
- Murphy, E.V.; Zhang, Y.; Zhu, W.; Biggs, J. The human glioma pathogenesis-related protein is structurally related to plant pathogenesis-related proteins and its gene is expressed specifically in brain tumors. Gene 1995, 159, 131–135. [Google Scholar] [CrossRef]
- Chilukamarri, L.; Hancock, A.L.; Malik, S.; Zabkiewicz, J.; Baker, J.A.; Greenhough, A.; Dallosso, A.R.; Huang, T.H. Hypomethylation and aberrant expression of the glioma pathogenesis-related 1 gene in Wilms tumors. Neoplasia 2007, 9, 970–978. [Google Scholar] [CrossRef]
- Jacoby, E.; Yalon, M.; Leitner, M.; Cohen, Z.R.; Cohen, Y.; Fisher, T.; Eder, S.; Amariglio, N.; Rechavi, G.; Cazacu, S.; et al. Related to testes-specific, vespid and pathogenesis protein-1 is regulated by methylation in glioblastoma. Oncol. Lett. 2014, 7, 1209–1212. [Google Scholar] [CrossRef]
- Capalbo, G.; Mueller-Kuller, T.; Koschmieder, S.; Klein, H.U.; Ottmann, O.G.; Hoelzer, D.; Scheuring, U.J. Endoplasmic reticulum protein GliPR1 regulates G protein signaling and the cell cycle and is overexpressed in AML. Oncol. Rep. 2013, 30, 2254–2262. [Google Scholar] [CrossRef]
- Rosenzweig, T.; Ziv-Av, A.; Xiang, C.; Lu, W.; Cazacu, S.; Taler, D.; Miller, C.G.; Reich, R.; Shoshan, Y.; Anikster, Y.; et al. Related to testesspecifc, vespid, and pathogenesis protein-1 (RTVP-1) is overexpressed in gliomas and regulates the growth, survival, and invasion of glioma cells. Cancer Res. 2006, 66, 4139–4148. [Google Scholar] [CrossRef]
- Li, L.; Ren, C.; Yang, G.; Fattah, E.A.; Goltsov, A.A.; Kim, S.M.; Lee, J.S.; Park, S.; Demayo, F.J.; Ittmann, M.M.; et al. GLIPR1 suppresses prostate cancer development through targeted oncoprotein destruction. Cancer Res. 2011, 71, 7694–7704. [Google Scholar] [CrossRef]
- Sheng, X.; Bowen, N.; Wang, Z. GLI pathogenesis-related 1 functions as a tumor-suppressor in lung cancer. Mol. Cancer 2016, 15, 25. [Google Scholar] [CrossRef]
- Scheuring, U.J.; Ritter, S.; Martin, D.; Schackert, G.; Temme, A.; Tietze, S. GliPR1 knockdown by RNA interference exerts anti-glioma effects in vitro and in vivo. J. Neurooncol. 2021, 153, 23–32. [Google Scholar] [CrossRef]
- Jump, D.B.; Botolin, D.; Wang, Y.; Xu, J.; Christian, B.; Demeure, O. Fatty acid regulation of hepatic gene transcription. J. Nutr. 2005, 135, 2503–2506. [Google Scholar] [CrossRef]
- Goto., T.; Lee, J.; Teraminami, A.; Kim, Y.I.; Hirai, S.; Uemura, T.; Inoue, H.; Takahashi, N.; Kawada, T. Activation of peroxisome proliferator-activated receptor-α stimulates both differentiation and fatty acid oxidation in adipocytes. J. Lipid Res. 2011, 52, 873–884. [Google Scholar] [CrossRef]
- Luo, W.; Cheng, D.; Chen, S.; Wang, L.; Li, Y.; Ma, X.; Song, X.; Liu, X.; Li, W.; Liang, J.; et al. Genome-wide association analysis of meat quality traits in a porcine Large White × Minzhu intercross population. Int. J. Biol. Sci. 2012, 8, 580–595. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Zhang, Y.; Zhang, J.; Gong, H.; Cui, L.; Zhang, W.; Ma, J.; Chen, C.; Ai, H.; Xiao, S.; Huang, L.; et al. Genetic correlation of fatty acid composition with growth, carcass, fat deposition and meat quality traits based on GWAS data in six pig populations. Meat Sci. 2019, 150, 47–55. [Google Scholar] [CrossRef] [PubMed]
- Xing, K.; Wang, K.; Ao, H.; Chen, S.; Tan, Z.; Wang, Y.; Xitong, Z.; Yang, T.; Zhang, F.; Liu, Y.; et al. Comparative adipose transcriptome analysis digs out genes related to fat deposition in two pig breeds. Sci. Rep. 2019, 9, 12925. [Google Scholar] [CrossRef] [PubMed]
- Chen, Q.; Zhang, W.; Cai, J.; Ni, Y.; Xiao, L.; Zhang, J. Transcriptome analysis in comparing carcass and meat quality traits of Jiaxing Black Pig and Duroc × Duroc × Berkshire × Jiaxing Black Pig crosses. Gene 2022, 808, 145978. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Chen, L.; Tian, S.; Lin, Y.; Tang, Q.; Zhou, X.; Li, D.; Yeung, C.K.L.; Che, T.; Jin, L.; et al. Comprehensive variation discovery and recovery of missing sequence in the pig genome using multiple de novo assemblies. Genome Res. 2017, 27, 865–874. [Google Scholar] [CrossRef] [PubMed]
- Dong, J.; Bi, B.; Zhang, L.; Gao, K. GLIPR1 inhibits the proliferation and induces the differentiation of cancer-initiating cells by regulating miR-16 in osteosarcoma. Oncol. Rep. 2016, 36, 1585–1591. [Google Scholar] [CrossRef]
- Lee, S.S.; Chen, Y.; Moran, C.; Stratil, A.; Reiner, G.; Bartenschlager, H.; Moser, G.; Geldermann, H. Linkage and QTL mapping for Sus scrofa chromosome 5. J. Anim. Breed Genet. 2003, 120, 38–44. [Google Scholar] [CrossRef]
- Rohrer, G.A.; Keele, J.W. Identification of quantitative trait loci affecting carcass composition in swine: I. Fat deposition traits. J. Anim. Sci. 1998, 76, 2247–2254. [Google Scholar] [CrossRef][Green Version]
- Robert, F.; Pelletier, J. Exploring the Impact of Single-Nucleotide Polymorphisms on Translation. Front. Genet. 2018, 9, 507. [Google Scholar] [CrossRef]
- Krupa, E.; Moravčíková, N.; Krupová, Z.; Žáková, E. Assessment of the Genetic Diversity of a Local Pig Breed Using Pedigree and SNP Data. Genes 2021, 12, 1972. [Google Scholar] [CrossRef]
- Ramos, A.M.; Crooijmans, R.P.; Affara, N.A.; Amaral, A.J.; Archibald, A.L.; Beever, J.E.; Bendixen, C.; Churcher, C.; Clark, R.; Dehais, P.; et al. Design of a high density SNP genotyping assay in the pig using SNPs identified and characterized by next generation sequencing technology. PLoS ONE 2009, 4, e6524. [Google Scholar] [CrossRef]
- Orphanides, G.; Reinberg, D. A unified theory of gene expression. Cell 2002, 108, 439–451. [Google Scholar] [CrossRef]
- Deplancke, B.; Alpern, D.; Gardeux, V. The genetics of transcription factor DNA binding variation. Cell 2016, 166, 538–554. [Google Scholar] [CrossRef]
- Kang, H.S.; Okamoto, K.; Kim, Y.S.; Takeda, Y.; Bortner, C.D.; Dang, H.; Wada, T.; Xie, W.; Yang, X.P.; Liao, G.; et al. Nuclear orphan receptor TAK1/TR4-deficient mice are protected against obesity-linked inflammation, hepatic steatosis, and insulin resistance. Diabetes 2011, 60, 177–188. [Google Scholar] [CrossRef]
- Yang, T.T.; Suk, H.Y.; Yang, X.; Olabisi, O.; Yu, R.Y.; Durand, J.; Jelicks, L.A.; Kim, J.Y.; Scherer, P.E.; Wang, Y.; et al. Role of transcription factor NFAT in glucose and insulin homeostasis. Mol. Cell Biol. 2006, 26, 7372–7387. [Google Scholar] [CrossRef]
- Yang, T.T.; Chow, C.W. Transcription cooperation by NFAT.C/EBP composite enhancer complex. J. Biol. Chem. 2003, 278, 15874–15885. [Google Scholar] [CrossRef]
- Patil, N.; Berno, A.J.; Hinds, D.A.; Barrett, W.A.; Doshi, J.M.; Hacker, C.R.; Kautzer, C.R.; Lee, D.H.; Marjoribanks, C.; McDonough, D.P.; et al. Blocks of limited haplotype diversity revealed by high-resolution scanning of human chromosome 21. Science 2001, 294, 1719–1723. [Google Scholar] [CrossRef]
Primer Name | Primer F/R (5′–3′) |
---|---|
GLIPR1-F | CAACAAGCTCCGATCAGAAGTG |
GLIPR1-R | GGGTGTAGCCTGTAGGGTGACT |
GAPDH-F | TGGAGGCAAGGACCTAAAAGC |
GAPDH-R | TCCACCACCCTGTTGCTGTAG |
PRIMER1-F | AAGAAACTGAGCGGGCAAGG |
PRIMER1-R | AGTGAGGTCAGGGATCAAAC |
PRIMER2-F | ATACTTTACCAAAATGCTGC |
PRIMER2-R | AACCCTCTTGAGTGATCTGC |
PRIMER3-F | GTATGAGCAGATCACTCAAG |
PRIMER3-R | AAAGCCAGTAGACCTAAAAG |
Location | Sequence | TF |
---|---|---|
g.38756593 T>C | CGGTCATATCTGAGTCTATGCATGCCTCTC * | |
CGGTCATATCTGAGCCTATGCATGCCTCTC | RHOXF1 | |
g.38757892 G>C | CAGATCACTCAAGAGGGTTTTTCTCTTGTT | NKX2–4, NKX2–8 |
CAGATCACTCAAGACGGTTTTTCTCTTGTT | ||
g.38758089 T>G | ATGCACCTCTGCTATTTTCCCTGGCAACAG | NFATC3, NFATC2 |
ATGCACCTCTGCTAGTTTCCCTGGCAACAG | NFATC3 | |
g.38758114 G>C | AACAGATGAGCCAAGCTGACTTCAATTCC | NFIX |
AACAGATGAGCCAACCTGACTTCAATTCC | NFIX, NR2C2 |
Polymorphism Site | Genotype Frequency | Gene Frequency | χ2 | PIC | He | |||
---|---|---|---|---|---|---|---|---|
g.38756953 T>C | TT | TC | CC | T | C | 0.4508 | 0.2743 | 0.3282 |
0.6243 | 0.3376 | 0.0381 | 0.7931 | 0.2069 | ||||
g.38757892 G>C | GG | GA | AA | G | A | 26.8386 | 0.2421 | 0.2818 |
0.0599 | 0.2196 | 0.7205 | 0.1697 | 0.8303 | ||||
g.38758089 T>G | TT | TG | GG | T | G | 3.5656 | 0.3230 | 0.4050 |
0.0958 | 0.3725 | 0.5361 | 0.2821 | 0.7179 | ||||
g.38758114 G>C | AA | AG | GG | A | G | 3.5656 | 0.3230 | 0.4050 |
0.0958 | 0.3725 | 0.5316 | 0.2821 | 0.7179 |
Block | Haplotype | Haplotype Frequency | Haplotype Score | p-Value | Total p-Value |
---|---|---|---|---|---|
Block 1 | TAG | 0.70877 | −2.25228 | 0.0243 | 0.1263 |
TCT | 0.01094 | −0.31862 | 0.75002 | ||
CAG | 0.00913 | 0.66759 | 0.5044 | ||
CCT | 0.27116 | 2.23729 | 0.02527 | ||
Block 2 | TA | 0.5125 | −3.37577 | 0.00074 | 0.00143 |
CA | 0.20344 | 1.83631 | 0.06631 | ||
TG | 0.2806 | 1.84942 | 0.0644 | ||
Block 3 | GG | 0.22531 | −0.91245 | 0.36153 | 0.09193 |
AG | 0.49587 | −0.8357 | 0.40332 | ||
AA | 0.27448 | 1.90887 | 0.05628 | ||
Block 4 | CGGTCAGTA | 0.05715 | −1.62615 | 0.10392 | 0.12506 |
CGGTCTGTA | 0.00861 | −1.462 | 0.14374 | ||
CGGTCAGCA | 0.58356 | −1.33194 | 0.18288 | ||
CGGTCTGCA | 0.04678 | −0.60537 | 0.54493 | ||
CGGTCACCG | 0.00482 | −0.07727 | 0.93841 | ||
TATCGACCG | 0.26571 | 2.10239 | 0.03552 | ||
Block 5 | GA | 0.70004 | −2.40065 | 0.01637 | 0.09626 |
GG | 0.0129 | 0.01944 | 0.98449 | ||
AA | 0.00917 | 0.92225 | 0.3564 | ||
AG | 0.27789 | 2.28996 | 0.02202 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, X.; Li, H.; Zhang, L.; Wang, L.; Wang, L. Expression and Genetic Effects of GLI Pathogenesis-Related 1 Gene on Backfat Thickness in Pigs. Genes 2022, 13, 1448. https://doi.org/10.3390/genes13081448
Liu X, Li H, Zhang L, Wang L, Wang L. Expression and Genetic Effects of GLI Pathogenesis-Related 1 Gene on Backfat Thickness in Pigs. Genes. 2022; 13(8):1448. https://doi.org/10.3390/genes13081448
Chicago/Turabian StyleLiu, Xin, Hanmei Li, Longchao Zhang, Ligang Wang, and Lixian Wang. 2022. "Expression and Genetic Effects of GLI Pathogenesis-Related 1 Gene on Backfat Thickness in Pigs" Genes 13, no. 8: 1448. https://doi.org/10.3390/genes13081448
APA StyleLiu, X., Li, H., Zhang, L., Wang, L., & Wang, L. (2022). Expression and Genetic Effects of GLI Pathogenesis-Related 1 Gene on Backfat Thickness in Pigs. Genes, 13(8), 1448. https://doi.org/10.3390/genes13081448