Next Article in Journal
Lipogenic Gene Single Nucleotide Polymorphic DNA Markers Associated with Intramuscular Fat, Fat Melting Point, and Health-Beneficial Omega-3 Long-Chain Polyunsaturated Fatty Acids in Australian Pasture-Based Bowen Genetics Forest Pastoral Angus, Hereford, and Wagyu Beef Cattle
Next Article in Special Issue
Development of SLAF-Sequence and Multiplex SNaPshot Panels for Population Genetic Diversity Analysis and Construction of DNA Fingerprints for Sugarcane
Previous Article in Journal
FHH Quick App Review: How Can a Quality Review Process Assist Primary Care Providers in Choosing a Family Health History App for Patient Care?
Previous Article in Special Issue
iPBS-Retrotransposon Markers in the Analysis of Genetic Diversity among Common Bean (Phaseolus vulgaris L.) Germplasm from Türkiye
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Determining Genetic Diversity and Population Structure of Common Bean (Phaseolus vulgaris L.) Landraces from Türkiye Using SSR Markers

1
Department of Biology, Faculty of Science, Ankara University, Ankara 06100, Türkiye
2
Department of Field Crops, Faculty of Agriculture, Ataturk University, Erzurum 25240, Türkiye
3
Department of Biology, Faculty of Science, Cankiri Karatekin University, Çankırı 18200, Türkiye
4
Department of Field Crops, Faculty of Agriculture, Necmettin Erbakan University, Konya 42310, Türkiye
5
Health Services Vocational School, Binali Yıldırım University, Erzincan 24100, Türkiye
6
Vocational High School, Department of Plant and Animal Production, İbrahim Çeçen University, Ağrı 04100, Türkiye
7
Botany Unit, Finnish Museum of Natural History, University of Helsinki, FI-00014 Helsinki, Finland
8
Institute of Advanced Studies Kőszeg (iASK), H-9731 Kőszeg, Hungary
*
Authors to whom correspondence should be addressed.
Genes 2022, 13(8), 1410; https://doi.org/10.3390/genes13081410
Submission received: 24 June 2022 / Revised: 3 August 2022 / Accepted: 4 August 2022 / Published: 8 August 2022

Abstract

Assessment of genetic diversity among different varieties helps to improve desired characteristics of crops, including disease resistance, early maturity, high yield, and resistance to drought. Molecular markers are one of the most effective tools for discovering genetic diversity that can increase reproductive efficiency. Simple sequence repeats (SSRs), which are codominant markers, are preferred for the determination of genetic diversity because they are highly polymorphic, multi-allelic, highly reproducible, and have good genome coverage. This study aimed to determine the genetic diversity of 40 common bean (Phaseolus vulgaris L.) landraces collected from the Ispir district located in the Northeast Anatolia region of Türkiye and five commercial varieties using SSR markers. The Twenty-seven SSR markers produced a total of 142 polymorphic bands, ranging from 2 (GATS91 and PVTT001) to 12 (BM153) alleles per marker, with an average number of 5.26 alleles. The gene diversity per marker varied between 0.37 and 0.87 for BM053 and BM153 markers, respectively. When heterozygous individuals are calculated proportional to the population, the heterozygosity ranged from 0.00 to 1.00, with an average of 0.30. The expected heterozygosity of the SSR locus ranged from 0.37 (BM053) to 0.88 (BM153), with an average of 0.69. Nei’s gene diversity scored an average of 0.69. The polymorphic information content (PIC) values of SSR markers varied from 0.33 (BM053) to 0.86 (BM153), with an average of 0.63 per locus. The greatest genetic distance (0.83) was between lines 49, 50, 53, and cultivar Karacaşehir-90, while the shortest (0.08) was between lines 6 and 26. In cluster analysis using Nei’s genetic distance, 45 common bean genotypes were divided into three groups and very little relationship was found between the genotypes and the geographical distances. In genetic structure analysis, three subgroups were formed, including local landraces and commercial varieties. The result confirmed that the rich diversity existing in Ispir bean landraces could be used as a genetic resource in designing breeding programs and may also contribute to Türkiye bean breeding programs.

1. Introduction

Bean (Phaseolus vulgaris L.) is one of the most important cultivated plants from the legume family worldwide in terms of total yield and cultivated area [1]. Beans consumed in different forms (green pods, immature or dried seeds) are a primary source of vegetable protein in the human diet [2]. For many people living in European countries, P. vulgaris is a traditional dietary component [3,4].
Bean has two centers of genetic diversity that are distinguished and recognized according to their phenotypic, biochemical, and genotypic differences. These are Middle American and Andean gene centers. These centers of genetic diversity are separated from each other by both geographical and partial reproductive barriers [1,5]. In addition, these gene pools vary strongly with morphological and biochemical markers [6]. In terms of genetic diversity, the Mesoamerican gene pool has more diversity than the Andean gene pool [7]. Seeds of beans in the Middle American gene pool are characterized as either small or medium-sized, while seeds of phenotypes in the Andean gene pool are usually described as larger [8]. It is thought that the common bean was introduced to Europe in the 16th and 17th centuries, and it was introduced to Türkiye in the 17th century [9].
People living in different regions of Türkiye have been cultivating beans for centuries, and it is an important food in their diet. Local bean genotypes are still used by people living in many rural areas of the country. Beans have spread to many regions of the country with both natural and artificial selections over time and have created populations known with names specific to these regions [2]. Beans show marked genetic variation in terms of many morphological characteristics such as seed, pod, and flower characteristics [10]. However, the increase in the use of commercial varieties in recent years and the insufficient use of local varieties in breeding programs have led to a significant narrowing of the genetic base [11,12]. Therefore, knowledge of genetic diversity, examination of population structure, and understanding of the relationships of varieties within and between commercial classes are essential steps for genetic improvement and preservation of the genetic diversity of beans [13]. In addition to being the center of domestication for important Old-World cereal and grain legume crops with its ecological and geographical characteristics, Türkiye has an important place globally regarding plant genetic diversity. Beans, which have a critical role in Türkiye in both the economy and human nutrition, have a high genetic diversity [14].
Genetic diversity studies are important for breeding programs since they provide valuable information for the effective conservation and application of existing germplasms [15]. Such studies facilitate understanding of genetic relationships between accessions, identification of germplasm excesses and admixtures, and identification of genitor pairs with sufficient genetic distance [16]. Evaluation of morphological traits is a traditional method to identify and define the relationship between local bean genotypes. Genotypes can be divided into groups according to their morphological characteristics, e.g., fruit flesh, flower structure, leaf shape, and seed [2]. However, morphological features may change under the influence of ecological conditions. Therefore, the use of these markers is not fully effective in determining diversity. In recent years, molecular markers have been used together with morphological markers to evaluate genetic diversity in plants. Because molecular markers are not affected by ecological factors, it is an important method for genetic mapping and examining genetic diversity, population structure, and phylogenetic relationships in many plants such as beans [17,18].
Detection of genetic diversity and higher genetic diversity provide extremely important information in selecting superior genotypes for plant breeding [19]. Many molecular methods, such as random amplified polymorphic DNA (RAPD) [20], inter-simple sequence repeat (ISSR) [21], amplified fragment length polymorphism (AFLP) [22], simple-sequence repeats (SSR) [4], inter-primer binding site (iPBS) retrotransposon [23], single-nucleotide polymorphisms (SNPs) [12], and start codon targeted markers (SCoT) [24], are used for the analysis of genetic diversity and population structure in beans. Among molecular markers, SSRs have special relevance in analyzing genetic diversity [25]. SSRs, highly polymorphic and codominant markers [26], have short repeating DNA sequences, usually 2–6 bp in length, and are used in genome mapping, gene tagging, genetic diversity estimation, variety identification, and marker-assisted selection [27]. SSRs are widely and successfully used to determine genetic diversity in beans and to create genetic maps [4,13,28,29,30]. in reviewed recent studies, the bean genotypes evaluated by SSR markers used only a narrow or different region source. In addition, a wide-ranging study has not yet been conducted to measure the genetic diversity of bean germplasm in Türkiye. This research was carried out to reveal the genetic diversity and population structure of the landraces obtained from the bean population grown in the Ispir district by using the SSR molecular marker method to determine the degree of inbreeding between the landraces and to reveal suitable lines for breeding studies. Therefore, the germplasm information yielded from this study will be useful for bean breeding studies. In addition, the findings are anticipated to contribute to the development of strategies to protect endangered bean genetic resources in the Erzurum-Ispir region.

2. Materials and Methods

2.1. Plant Material

The common bean genotypes used in this study were collected from the Ispir Valley in Northeast Anatolia, Türkiye. A total of 45 common bean genotypes together with five nationally registered cultivars were used for SSR analysis. (Figure 1 and Table 1). In addition, some seed characteristics (100-seed weight, seed color, and seed shape) of bean accessions are presented in Table 1.

2.2. DNA Extraction

Sample plants were grown in a greenhouse of the Atatürk University Field Crops Department. Bulk DNA of 45 individuals per accession was prepared from young leaves of 2-week-old plants in the Laboratory of Molecular Biology and Genetics, Department of Field Crops, Ataturk University, Türkiye. Genomic DNA extractions were performed as described by Zeinalzadehtabrizi et al. [31]. DNA quality was affirmed through electrophoresis in 0.8% agarose gel. The NanoDrop® ND-1000 UV/V spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) was used to determine DNA concentrations. For SSR analysis, the final DNA concentration was adjusted to 50 µg/mL. Diluted DNA samples were stored at −20 °C to await SSR-polymerase chain reaction (PCR).

2.3. SSR Analysis

Twenty-seven SSR primer pairs were selected from previous studies based on their reliable amplification patterns and high polymorphic information contents. There are three markers on the Pv01 chromosome, five markers on the Pv02 chromosome, five markers on the Pv04 chromosome, two markers on the Pv06 chromosome, and two markers on the Pv07 chromosome, three markers on the Pv08 chromosome, and five markers on the Pv09 chromosome. There was only one marker on the Pv01 (BM053 marker) and Pv05 (BM175 marker) chromosomes. In addition, none of the markers used in our study were markers located on the Pv10 and Pv11 chromosomes (Table 2). These primer pairs resulted in specific and stable DNA profiles in this study. PCR amplifications were performed in Labcycler. The PCR mixture consisted of 10× buffer, 2 mM MgCl2, 0.25 mM of each dNTP, 2 µM (20 pmol) primer, 0.5 U Taq polymerase, and 50 µg/ng DNA template in a 20 µL reaction mixture. The amplification conditions were as follows: an initial denaturation step of 2 min at 95 °C, 37 cycles of 30 s at 95 °C, 60 s at 47–58 °C and 60 s at 72 °C, and a final extension step of 5 min at 72 °C. The amplification products were resolved on 3% agarose gel in 1X SB buffer at 150 V/cm for 120 min, stained with ethidium bromide (0.2 ug/mL), visualized under a UV-transilluminator, and photographed under ultraviolet light with Nikon Coolpix5000. The sizes of the base pairs were determined based on a DNA ladder between 50 and 1000 bp (Vivantis product no. NM2421) [32].

2.4. Molecular Data Analysis

Scoring was given as 1 (presence) and 0 (absence) for amplified fragments at each SSR locus, and data matrices were constructed accordingly. In this study, Phylogenetic analysis was performed with MEGA software (v. 7.0.14). In this study, Phylogenetic analysis was performed with MEGA 6.0 software. The dendrogram was constructed using the neighbor-joining method of the MEGA software with the maximum composite likelihood substitution model, and bootstrapping with 1000 replicates [38]. Marker index for SSR markers was calculated in order to characterize the capacity of each primer to detect polymorphic loci among the genotypes. It is the sum total of the polymorphism information content (PIC) values of SSR markers produced by a particular primer. The PIC value was calculated using the formula PICi = 1 − ∑ P(i)2 [39], where pi is the frequency of the allele. The PIC values provided an estimate of the discriminatory power of any locus by considering the number of alleles per locus and the relative frequencies of these alleles in the population. The genetic diversity within the genotypes was calculated from the following equations and the PopGen program [40] using Nei’s gene diversity index [41] and the Shannon information index [42]. Structure 2.2 program was used to determine the genetic structure of genotypes [43]. In many genetic diversity studies with beans, genotypes are successfully divided into groups using the Structure program [44,45]. The F-statistics (FST) value reflects the difference between subpopulations [46]. Using the GenAlex program, basic coordinate analysis was carried out to better understand the diversity among genotypes. On the two-dimensional diagram obtained by covering the total variance of the first two coordinates, groups were determined and compared with cluster analysis. Genetic variation within and between populations was examined with the GenAlex program [47] using the analysis of molecular variance (AMOVA) method. Fst measures the amount of genetic variance that can be explained by population structure based on Wright’s F-statistics. An Fst value of 0 indicates no differentiation between the subpopulations while a value of 1 indicates complete differentiation [48]. In addition, genetic indices such as number of loci with private allele, number of different alleles (Na), number of effective alleles (Ne), Shannon’s information index (I), unbiased expected (uHe) and expected (He) for each proposed geographic region using the Genalex 6.5 software [45].

3. Results and Discussion

3.1. SSR Marker Information

Twenty-seven SSR markers produced a total of 142 bands, and the number of alleles per locus ranged from 2 (PVTT001) to 12 (BM153), with an average of 5.26. The polymorphism rate for each SSR marker was 100%. The allele frequency varied between 0.20 (BM153) and 0.78 (BM053). The lowest genetic diversity was 0.37 (BM053) and the highest 0.87 (BM153). Gene diversity is an important parameter used in the estimation of genetic variability between genotypes [41,49]. In a similar study, Dutta et al. [50] obtained a total of 150 alleles using 30 SSR markers in 52 Indian common bean genotypes. They found that the number of alleles ranged from 1 to 19 and the number of alleles per locus was 5. Investigating genetic variation in 60 Brazilian bean genotypes, [25] obtained 196 polymorphic alleles from 85 SSR markers and reported the average number of alleles per locus to range from 2 to 6, with an average of 2.8. Zhang et al. [51] investigated genetic diversity in 229 Chinese native bean genotypes using 30 SSR markers and the number of alleles varied between 2 and 19; they obtained an average of 5.5 alleles per locus and 116 alleles in total. The average PIC value obtained as a result of the analysis with the SSR marker, showing the discriminatory power of a marker, was 0.63, ranging between 0.33 (BM053) and 0.86 (BM153) depending on the markers. Having a high PIC value for a marker is one of the most important indicators that the marker can be used successfully in the evaluation of genetic variation [50]. Markers with high PIC values, such as BM141 (0.81), BMd1 (0.81), BM153 (0.86), and PVAT001 (0.81), are preferred in bean genetic diversity studies (Table 3). In other studies, with SSR markers in beans, the PIC value was 0.23–0.87 [51], 0.03–0.70 [25], 0–0.79 [37], 0.38–0.94 [50], 0.40–0.82 [52], and 0.42–0.88 [4]; these values varied widely and are consistent with our research results.
The number of effective alleles, which was 3.749 on average in the study, varied between 1.578 (BM053) and 7.864 (BM153) according to the markers (Table 4). The observed heterozygosity was 0.30 on average. The relatively low heterozygosity seen may be due to the autogamous structure of the bean [22,45,53]. However, compared with some other research results, e.g., Kyrgyzstan (0.05) [45], India (0.019) [54], and Brazil (0.16) [25], our value is higher. The expected heterozygosity, with a mean of 0.693, was lowest (0.370) at the BM053 locus and highest (0.882) at the BM153 locus (Table 4). Similar to our findings, [44] reported with 36 SSR markers in 104 wild bean genotypes that the mean expected heterozygosity value was 0.66, and the highest expected heterozygosity value (0.96) was obtained from the PVAT001 marker. Zargar et al. [46] determined the expected heterozygosity values as 0.2192 in the first subpopulation, 0.2124 in the second subpopulation, and 0.2821 in the third subpopulation, respectively, in their analysis using 15 RAPD and 23 SSR markers in 51 Indian bean genotypes. In this study, Shannon information index (I), which ranged from 0.663 (GATS91) to 2.202 (BM153), was found to be on average 1.343 (Table 4). The high Shannon knowledge index in our study showed that the SSR markers employed were useful in determining genetic diversity [55]. Gioia et al. [13] reported the Shannon information index to range from 0.19 to 0.74 (mean 0.66) with 58 SSR markers in 192 bean genotypes. In another study using 65 Vigna umbellata genotypes and 28 SSR markers, six geographical groups were formed, and the Shannon information index varied between 0.845 and 1.019 [56]. On the other hand, Öztürk et al. [2] investigated genetic diversity in 75 bean genotypes using 27 iPBS markers and found the Shannon information index to range from 0.570 to 0.636 (mean 0.599).

3.2. Cluster Analysis

Comparative analysis of molecular sequence data enables the determination of proximity or distance between genotypes and displays clusters of genotypes by constructing a phylogenetic tree. For this purpose, cluster analysis was performed among beans by the neighbor-joining method of the maximum composite likelihood substitution model, identifying three clustered groups. Considering the higher cophenetic correlation coefficient, the dendrogram was assumed to represent the similarity matrix very well. Cluster III consists of two subgroups; Aras-98, Elkoca-05, Göynük-98, Yakutiye-98 and Karacaşehir-90 cultivars were included in the first subcluster, along with five Ispir bean lines, and 63, 64, 65, 69 accessions were included in the second subcluster. In addition, cluster I consisted of two subgroups; there were twenty-three participants in the first subgroup and four participants in the second subgroup. In the cluster II, there were eight participants. (Figure 2 and Table 5). This clustering of genotypes showed that there was no significant relationship between geographic origin and genetic similarity. This result suggests that there may be some level of gene flow between genotypes or a recent introduction from a common source. In a similar study aiming to determine genetic diversity using 30 SSR markers in 50 bean genotypes, including 38 local bean genotypes obtained from the Northeast Anatolia region and 12 registered varieties, the genotypes clustered into two groups [57]. However, Öztürk et al. [2], who investigated genetic diversity by using 27 iPBS markers in 71 bean genotypes and 4 commercial varieties collected from Erzincan, determined that the genotypes clustered into two groups and both groups were further divided into two subgroups. In a study by [58], they conducted a genetic diversity study in beans using 26 iPBS primers. At the end of the research, it was determined that the bean inclusions were divided into three main clusters. However, while three subgroups were formed in our study, five subgroups were identified in the findings of the researchers.
Knowing the genetic distances between genotypes provides an enormous advantage in selecting suitable parents for bean breeding programs. In this study, the greatest genetic distance (0.83) was determined between the Karacaşehir-90 variety and Ispir bean lines 49, 50, and 53. The shortest genetic distance was observed between lines 6 and 26 and lines 27 and 28 (0.08 and 0.09, respectively) (Table S1).

3.3. Determination of Genetic Diversity Based on Principal Coordinate Analysis

Principal coordinate analysis (PCoA) is a multivariate dataset that provides the ability to find and archive key patterns in multiple loci and multiple samples. With this technique, the distances between the groups, which are based on the two-dimensional diagram formed by the similarity or distance matrix between the individuals, reflect actual distances [59]. PCoA is used to provide a spatial representation of the relative genetic distances between populations [60].
In our study, the baseline coordinate analysis was performed using the neutral genetic distance of Nei. The percentage of genetic diversity explained by each of the three main coordinates of the basic coordinate analysis was 20.57, 16.96, and 13.33; together, these three components explained 50.85% of the diversity. Although the groups were not completely separated in the two-dimensional diagram obtained over the first two components, the distribution of genotypes on the diagram indicated the presence of genetic diversity (Figure 3). Genotypes taken from the Gaziler District of Ispir center are located on the upper left, the Maden village and Elmalı Town Ağıldere village genotypes on the lower left, and commercial varieties and Kirazlı village and Maden Köprübaşı Town Akbağ District genotypes on the lower right of Axis 1. The remaining genotypes are distributed over several sections of the diagram. For example, genotypes collected from Öztoprak village are clustered on the upper left and upper right sides of Axis 1, while Ulubel Village genotypes are distributed over all parts of the diagram. Yeşilyurt Village genotypes were located on the lower left sections of Axis 1 (Figure 3). This distribution of genotypes on the diagram shows that genetic diversity is weak both between commercial varieties and between Maden Village genotypes and Elmalı Town Ağıldere Village genotypes. Klaedtke et al. [60] reported that the baseline coordinate analysis they applied on 15 bean genotypes using the SSR marker grouped the genotypes in a meaningful way and the first two components explained 77.7% of the total variation. In their study using SSR markers in 349 wild and cultivated bean genotypes from the Andean and Mesoamerican gene pools, Kwak and Gepts [53] found that the results of basic coordinate analysis and genetic structure analysis were similar, and the first two components explained 66% of the total variation.

3.4. Molecular Variance Analysis

Analysis of molecular variance (AMOVA) revealed that within-population variance (66%) was higher than between-population variance (34%) (Table 6). This result indicates that there is gene flow between populations [45]. Blair et al. [44] in their study with 36 SSR markers in 104 wild bean genotypes determined that the variance within populations was 98%. Another study using 11 SSR markers in 28 bean genotypes grown in Kyrgyzstan [45] reported that the variance between populations was higher, contrary to our research findings. Rebaa et al. [55] who used 21 genotypes and 8 SSR markers in broad beans noted an intra-population variance of 83% and an inter-population variance of 17%, and their molecular variance analysis using SSR data revealed a significant intra-population genetic variation. Similarly, research results have been reported in which the within-population variance is higher than the between-population variance in different plant species such as apple [61] and lettuce [62].
The summary statistics for nine populations are listed in Table 7. We determined that the He value ranged from 0.038 (Ic) to 0.189 (Ov) (Mean 0.115), while the uHe value ranged from 0.051 (Ic) to 0.196 (Ov) (Mean 0.131). The I value among the nine populations ranged from 0.055 (Ic) to 0.290 (Ov) (Mean 0.173). The percentage of polymorphic loci (PPL) for bean was lowest at 9.15% (Ic) and 15.49% (Mka). Among the nine populations of bean, the PPL value ranged from 9.15% (Ic) to 64.08% (Ov) (Mean 33.41%). The Nei genetic (h) values of the nine bean populations are presented in Table 8. Among the nine populations of bean from Ispir, the smallest h values observed were in Ev/Mv (0.087), while the greatest were observed in Mka/Ic (0.341).

3.5. Genetic Structure Analysis

In many genetic diversity studies with beans, genotypes are successfully separated into groups using the structure program [44,45]. In this study, the population structure of accession in 45 bean genotypes was classified according to the SSR data, and three subpopulations were obtained with little mixing of genotypes regardless of geographical distribution (Figure 4). Geographical distribution is an important factor in terms of the genetic diversity of species [2,63]. In this study, the proximity of the places where the samples were collected can be counted as the reason for the mixing of these three populations [46]. The low number of populations in our study (K = 3) is due to the high rate of gene flow between the regions where the samples were taken [2,23]. According to these data, there are 17 local genotypes in the first subpopulation, 9 local genotypes together with the 5 commercial varieties in the second subpopulation, and 14 local genotypes in the third subpopulation (Table 9). Bean genotypes and geographic distributions of populations are presented in Figure 5. The FST (F-statistic) value was determined as 0.34, 0.26, and 0.41 in the first, second, and third subpopulations, respectively, and the mean FST (F-statistic) value of 0.34 confirmed the segregation of all subpopulations and the diversity into SSR alleles [44] (Table 10). Evaluating genetic diversity in 149 common bean genotypes using 24 SSR markers, Sharma et al. [54] determined that the genotypes were divided in three subpopulations. Zargar et al. [46] who performed genetic structure analysis and UPGMA clustering analysis on 51 Indian bean genotypes using 15 RAPD and 23 SSR markers stated that three groups were formed in both analyses. They emphasized that the FST values obtained as a result of the genetic structure analysis (0.4047, 0.3799, and 0.2059 for the 1st, 2nd, and 3rd subgroups, respectively) are a strong indicator of the effective separation of the subpopulations and the diversity in the SSR alleles. The results of the study reported by Khaidizar et al. [57] showed higher genetic polymorphism when they used SSR to investigate the level of polymorphism in Turkish common bean genotypes, which includes most of the genotypes used in Ceylan et al. [19] study. Consistent with several previous studies, cluster analysis revealed that it resulted in two major clusters, possibly representing two major gene pools, namely Andean and Mesoamerican. It was stated that these small-seeded cultivars, which clustered separately from the others in both plastid and nuclear marker analysis, may belong to the Mesoamerican gene pool.

4. Conclusions

Assessment of genetic variability of the germplasm is the first step, termed pre-breeding, for the improvement and development of superior cultivars. In the present study, genotypes collected from the Erzurum-Ispir region, located in the Northeastern Anatolia region of Türkiye, were evaluated at the molecular level. Our results showed a high level of genetic diversity within the population. It is important to collect local varieties and determine their genetic diversity in order to protect bean genetic resources and use them in breeding studies. An acquaintance of the genetic diversity and population structure of these genotypes may assist in the efficient management of these natural germplasms of beans. The results of this research have shown that the SSR marker system can be used successfully in determining genetic diversity among Ispir bean genotypes. These results are anticipated to guide the selection of appropriate markers in genetic diversity studies in beans.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/genes13081410/s1, Table S1: Nei’s genetic distance based on SSR marker for 45 common bean genotypes.

Author Contributions

K.H. and A.T. concept; K.H. and A.T. design; K.H., E.E. and P.P. resources; E.E. Materials; A.T., H.I.Ö. and G.Ö. data collection and/or processing; P.P. data validation; A.T. analysis and/or interpretation; A.T. and H.I.Ö. literature search; A.T. writing; K.H. and P.P. critical reviews; P.P. project administration and funding acquisition. All authors have read and agreed to the published version of the manuscript.

Funding

P.P. expresses his gratitude for the support of the iASK Research Grant. The authors thank the Helsinki University Library for supporting open-access publication.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data is contained within the article.

Acknowledgments

Open access funding provided by University of Helsinki as well as we are very grateful to The Scientific and Technological Research Council of Türkiye (TÜBITAK) for generous financial support (Project no 115O260).

Conflicts of Interest

The authors have no conflict of interest to declare.

References

  1. Gioia, T.; Logozzo, G.; Attene, G.; Bellucci, E.; Benedettelli, S.; Negri, V.; Papa, R.; Spagnoletti Zeuli, P. Evidence for introduction bottleneck and extensive intergene pool (Mesoamerican x Andean) hybridization in the European common bean (Phaseolus vulgaris L.) germplasm. PLoS ONE 2013, 8, e75974. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Öztürk, H.İ.; Dursun, A.; Hosseinpour, A.; Haliloğlu, K. Genetic diversity of pinto and fresh bean (Phaseolus vulgaris L.) germplasm collected from Erzincan province of Turkey by inter-primer binding site (iPBS) retrotransposon markers. Turk. J. Agric. For. 2020, 44, 417–427. [Google Scholar] [CrossRef] [Scilit]
  3. Rodríguez, L.; Mendez, D.; Montecino, H.; Carrasco, B.; Arevalo, B.; Palomo, I.; Fuentes, E. Role of Phaseolus vulgaris L. in the prevention of cardiovascular diseases—cardioprotective potential of bioactive compounds. Plants 2022, 11, 186. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Savić, A.; Pipan, B.; Vasić, M.; Meglič, V. Genetic diversity of common bean (Phaseolus vulgaris L.) germplasm from Serbia, as revealed by single sequence repeats (SSR). Sci. Hortic. 2021, 288, 110405. [Google Scholar] [CrossRef] [Scilit]
  5. Bitocchi, E.; Rau, D.; Bellucci, E.; Rodriguez, M.; Murgia, M.L.; Gioia, T.; Santo, D.; Nanni, L.; Attene, G.; Papa, R. Beans (Phaseolus ssp.) as a model for understanding crop evolution. Front. Plant. Sci. 2017, 8, 722. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Singh, S.P.; Gepts, P.; Debouck, D.G. Races of common bean (Phaseolus vulgaris, Fabaceae). Econ. Bot. 1991, 45, 379–396. [Google Scholar] [CrossRef] [Scilit]
  7. Mamidi, S.; Rossi, M.; Moghaddam, S.; Annam, D.; Lee, R.; Papa, R.; McClean, P. Demographic factors shaped diversity in the two gene pools of wild common bean Phaseolus vulgaris L. Heredity 2013, 110, 267–276. [Google Scholar] [CrossRef] [Scilit]
  8. Gepts, P.; Bliss, F. Phaseolin variability among wild and cultivated common beans (Phaseolus vulgaris) from Colombia. Eco. Bot. 1986, 40, 469–478. [Google Scholar] [CrossRef] [Scilit]
  9. Aydin, M.F.; Baloch, F.S. Exploring the genetic diversity and population structure of Turkish common bean germplasm by the iPBS-retrotransposons markers. Legum. Res. 2019, 42, 18–24. [Google Scholar] [CrossRef] [Scilit]
  10. Pereira, H.S.; Mota, A.P.S.; Rodrigues, L.A.; de Souza, T.L.P.O.; Melo, L.C. Genetic diversity among common bean cultivars based on agronomic traits and molecular markers and application to recommendation of parent lines. Euphytica 2019, 215, 1–16. [Google Scholar] [CrossRef] [Scilit]
  11. Ewing, P.M.; Runck, B.C.; Kono, T.Y.; Kantar, M.B. The home field advantage of modern plant breeding. PLoS ONE 2019, 14, e0227079. [Google Scholar] [CrossRef] [Scilit]
  12. Almeida, C.P.D.; Paulino, J.F.D.C.; Morais Carbonell, S.A.; Chiorato, A.F.; Song, Q.; Di Vittori, V.; Rodriguez, M.; Papa, R.; Benchimol-Reis, L.L. Genetic diversity, population structure, and andean introgression in Brazilian common bean cultivars after half a century of genetic breeding. Genes 2020, 11, 1298. [Google Scholar] [CrossRef] [Scilit]
  13. Gioia, T.; Logozzo, G.; Marzario, S.; Spagnoletti Zeuli, P.; Gepts, P. Evolution of SSR diversity from wild types to US advanced cultivars in the Andean and Mesoamerican domestications of common bean (Phaseolus vulgaris). PLoS ONE 2019, 14, e0211342. [Google Scholar] [CrossRef] [Scilit]
  14. Akbulut, B.; Karakurt, Y.; Tonguc, M. Molecular characterization of common bean (Phaseolus vulgaris L.) genotypes. Akdeniz Univ. J. Fac. Agric. 2013, 26, 105–108. [Google Scholar]
  15. Cheng, J.; Qin, C.; Tang, X.; Zhou, H.; Hu, Y.; Zhao, Z.; Cui, J.; Li, B.; Wu, Z.; Yu, J. Development of a SNP array and its application to genetic mapping and diversity assessment in pepper (Capsicum spp.). Sci. Rep. 2016, 6, 1–11. [Google Scholar] [CrossRef] [Scilit]
  16. Delfini, J.; Moda-Cirino, V.; dos Santos Neto, J.; Ruas, P.M.; Sant’Ana, G.C.; Gepts, P.; Gonçalves, L.S.A. Population structure, genetic diversity and genomic selection signatures among a Brazilian common bean germplasm. Sci. Rep. 2021, 11, 1–12. [Google Scholar] [CrossRef] [Scilit]
  17. Scarano, D.; Rubio, F.; Ruiz, J.J.; Rao, R.; Corrado, G. Morphological and genetic diversity among and within common bean (Phaseolus vulgaris L.) landraces from the Campania region (Southern Italy). Sci. Hortic. 2014, 180, 72–78. [Google Scholar] [CrossRef] [Scilit]
  18. Shi, C.; Navabi, A.; Yu, K. Association mapping of common bacterial blight resistance QTL in Ontario bean breeding populations. BMC Plant. Biol. 2011, 11, 1–11. [Google Scholar] [CrossRef] [Scilit]
  19. Ceylan, A.; Öcal, N.; Akbulut, M. Genetic diversity among the Turkish common bean cultivars (Phaseolus vulgaris L.) as assessed by SRAP, POGP and cpSSR markers. Biochem. Syst. Ecol. 2014, 54, 219–229. [Google Scholar] [CrossRef] [Scilit]
  20. Bukhari, A.; Bhat, M.; Ahmad, M.; Saleem, N. Examination of genetic diversity in common bean (Phaseolus vulgaris L.) using random amplified polymorphic DNA (RAPD) markers. Afr. J. Biotechnol. 2015, 14, 451–458. [Google Scholar]
  21. Cabral, P.D.S.; Souza, L.D.; Costa, G.D.; Silva, F.H.L.; Soare, T.C.B. Investigation of the genetic diversity of common bean (Phaseolus vulgaris.) cultivars using molecular markers. Genet. Mol. Res. 2018, 17, 1–11. [Google Scholar] [CrossRef] [Scilit]
  22. Beebe, S.; Skroch, P.W.; Tohme, J.; Duque, M.; Pedraza, F.; Nienhuis, J. Structure of genetic diversity among common bean landraces of Middle American origin based on correspondence analysis of RAPD. Crop. Sci. 2000, 40, 264–273. [Google Scholar] [CrossRef] [Scilit]
  23. Nemli, S.; Kianoosh, T.; Tanyolac, M.B. Genetic diversity and population structure of common bean (Phaseolus vulgaris L.) accessions through retrotransposon-based interprimer binding sites (iPBSs) markers. Turk. J. Agric. For. 2015, 39, 940–948. [Google Scholar] [CrossRef] [Scilit]
  24. Yeken, M.Z.; Emiralioğlu, O.; Çiftçi, V.; Bayraktar, H.; Palacioğlu, G.; Özer, G. Analysis of genetic diversity among common bean germplasm by start codon targeted (SCoT) markers. Mol. Biol. Rep. 2022, 49, 1–9. [Google Scholar] [CrossRef] [Scilit]
  25. Perseguini, J.M.K.C.; Chioratto, A.F.; Zucchi, M.I.; Colombo, C.A.; Carbonell, S.A.M.; Mondego, J.M.C.; Gazaffi, R.; Garcia, A.A.F.; Campos Td Souza, A.P.d. Genetic diversity in cultivated carioca common beans based on molecular marker analysis. Genet. Mol. Biol. 2011, 34, 88–102. [Google Scholar] [CrossRef] [Scilit]
  26. Chin, E.; Shu, H.; Smith, J.; Senior, M. Maize simple repetitive DNA sequences: Abundance and allele variation. Genome 1996, 39, 866–873. [Google Scholar] [CrossRef] [Scilit]
  27. Pipan, B.; Meglič, V. Diversification and genetic structure of the western-to-eastern progression of European Phaseolus vulgaris L. germplasm. BMC Plant. Biol. 2019, 19, 1–16. [Google Scholar] [CrossRef] [Scilit]
  28. Carvalho, M.S.; de Oliveira Moulin Carias, C.M.; Silva, M.A.; da Silva Ferreira, M.F.; de Souza, T.L.P.O.; Posse, S.C.P.; Ferreira, A. Genetic diversity and structure of landrace accessions, elite lineages and cultivars of common bean estimated with SSR and SNP markers. Mol. Biol. Rep. 2020, 47, 6705–6715. [Google Scholar] [CrossRef] [Scilit]
  29. Fisseha, Z.; Tesfaye, K.; Dagne, K.; Blair, M.W.; Harvey, J.; Kyallo, M.; Gepts, P. Genetic diversity and population structure of common bean (Phaseolus vulgaris L) germplasm of Ethiopia as revealed by microsatellite markers. Afr. J. Biotechnol. 2016, 15, 2824–2847. [Google Scholar]
  30. Müller, B.S.; Pappas, G.J.; Valdisser, P.A.; Coelho, G.R.; de Menezes, I.P.; Abreu, A.G.; Borba, T.C.; Sakamoto, T.; Brondani, C.; Barros, E.G. An operational SNP panel integrated to SSR marker for the assessment of genetic diversity and population structure of the common bean. Plant. Mol. Biol. Rep. 2015, 33, 1697–1711. [Google Scholar] [CrossRef] [Scilit]
  31. Zeinalzadehtabrizi, H.; Hosseinpour, A.; Aydin, M.; Haliloglu, K. A modified genomic DNA extraction method from leaves of sunflower for PCR based analyzes. J. Bio. Env. Sci 2015, 7, 222–225. [Google Scholar]
  32. Hosseinpour, A.; Karahan, F.; İlhan, E.; İlçim, A.; Haliloğlu, K. Genetic structure and diversity of Adonis L.(Ranunculaceae) populations collected from Turkey by inter-primer binding site (iPBS) retrotransposon markers. Turk. J. Bot. 2019, 43, 585–596. [Google Scholar] [CrossRef] [Scilit]
  33. Blair, M.W.; Buendía, H.F.; Giraldo, M.C.; Métais, I.; Peltier, D. Characterization of AT-rich microsatellites in common bean (Phaseolus vulgaris L.). Theor. Appl. Genet. 2008, 118, 91–103. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Gaitán-Solís, E.; Duque, M.; Edwards, K.; Tohme, J. Microsatellite Repeats in Common Bean (Phaseolus vulgaris) Isolation, Characterization, and Cross-Species Amplification in Phaseolus ssp. Crop. Sci. 2002, 42, 2128–2136. [Google Scholar] [CrossRef] [Scilit]
  35. Yu, K.; Park, S.; Poysa, V.; Gepts, P. Integration of simple sequence repeat (SSR) markers into a molecular linkage map of common bean (Phaseolus vulgaris L.). J. Hered. 2000, 91, 429–434. [Google Scholar] [CrossRef] [Scilit]
  36. Buso, G.; Amaral, Z.; Brondani, R.; Ferreira, M. Microsatellite markers for the common bean Phaseolus vulgaris. Mol. Ecol. Notes 2006, 6, 252–254. [Google Scholar] [CrossRef] [Scilit]
  37. Mall, N.; Chawla, H. Suitability of SSR marker for establishing distinctiveness in French bean varieties (Phaseolus vulgaris L.). Legume 2014, 37, 353–358. [Google Scholar]
  38. Rohlf, F.J. NTSYS-pc: Microcomputer programs for numerical taxonomy and multivariate analysis. Am. Stat. 1987, 41, 330. [Google Scholar] [CrossRef] [Scilit]
  39. Anderson, J.A.; Churchill, G.; Autrique, J.; Tanksley, S.; Sorrells, M. Optimizing parental selection for genetic linkage maps. Genome 1993, 36, 181–186. [Google Scholar] [CrossRef] [Scilit]
  40. Yeh, F.C.; Yang, R.; Boyle, T.B.; Ye, Z.; Mao, J.X. POPGENE, the user-friendly shareware for population genetic analysis. Mol. Biol. Biotechnol. Cent. Univ. Alta. Can. 1997, 10, 295–301. [Google Scholar]
  41. Nei, M.; Tajima, F.; Tateno, Y. Accuracy of estimated phylogenetic trees from molecular data. J. Mol. Evol. 1983, 19, 153–170. [Google Scholar] [CrossRef] [Scilit]
  42. Francis, C.; Yang, R. Popgene version 1.32. 2000. Available online: https://sites.ualberta.ca/~fyeh/popgene.html.
  43. Pritchard, J.K.; Stephens, M.; Rosenberg, N.A.; Donnelly, P. Association mapping in structured populations. Am. J. Hum. Genet. 2000, 67, 170–181. [Google Scholar] [CrossRef] [Scilit]
  44. Blair, M.W.; Galeano, C.H.; Tovar, E.; Muñoz Torres, M.C.; Castrillón, A.V.; Beebe, S.E.; Rao, I.M. Development of a Mesoamerican intra-genepool genetic map for quantitative trait loci detection in a drought tolerant× susceptible common bean (Phaseolus vulgaris L.) cross. Mol. Breed. 2012, 29, 71–88. [Google Scholar] [CrossRef] [Scilit]
  45. Hegay, S.; Geleta, M.; Bryngelsson, T.; Gustavsson, L.; Persson-Hovmalm, H.; Ortiz, R. Comparing genetic diversity and population structure of common beans grown in Kyrgyzstan using microsatellites. Sci. J. Crop. Sci. 2012, 1, 63–75. [Google Scholar]
  46. Zargar, S.M.; Farhat, S.; Mahajan, R.; Bhakhri, A.; Sharma, A. Unraveling the efficiency of RAPD and SSR markers in diversity analysis and population structure estimation in common bean. Saudi. J. Biol. Sci. 2016, 23, 139–149. [Google Scholar] [CrossRef] [Scilit]
  47. Peakall, R.; Smouse, P.E. GENALEX 6: Genetic analysis in Excel. Population genetic software for teaching and research. Mol. Ecol. Notes 2006, 6, 288–295. [Google Scholar] [CrossRef] [Scilit]
  48. Bird, K.A.; An, H.; Gazave, E.; Gore, M.A.; Pires, J.C.; Robertson, L.D.; Labate, J.A. Population structure and phylogenetic relationships in a diverse panel of Brassica rapa L. Front. Plant. Sci. 2017, 8, 321. [Google Scholar] [CrossRef] [Scilit]
  49. Toro, M.; Caballero, A. Characterization and conservation of genetic diversity in subdivided populations. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2005, 360, 1367–1378. [Google Scholar] [CrossRef] [Scilit]
  50. Dutta, S.K.; Singh, S.; Chatterjee, D.; Boopathi, T.; Singh, A.; Saha, S. Morphological and genetic diversity of pole type common bean (Phaseolus vulgaris L.) landraces of Mizoram (India). Indian J. Biotechnol. 2016, 15, 550–559. [Google Scholar]
  51. Zhang, X.; Blair, M.W.; Wang, S. Genetic diversity of Chinese common bean (Phaseolus vulgaris L.) landraces assessed with simple sequence repeat markers. Theor. Appl. Genet. 2008, 117, 629–640. [Google Scholar] [CrossRef] [Scilit]
  52. Matondo, N.; Yao, K.; Kyalo, M.; Skilton, R.; Nkongolo, K.; Mumba, D.; Tshilenge, D.; Lubobo, A. Assessment of the genetic diversity and the relationship among common bean (Phaseolus vulgaris L.) accessions from DR-Congo germplasm using SSR molecular markers. Int. J. Curr. Res. 2017, 9, 47814–47821. [Google Scholar]
  53. Kwak, M.; Gepts, P. Structure of genetic diversity in the two major gene pools of common bean (Phaseolus vulgaris L., Fabaceae). Theor. Appl. Genet. 2009, 118, 979–992. [Google Scholar] [CrossRef] [Scilit]
  54. Sharma, P.; Diaz, L.; Blair, M. Genetic diversity of two Indian common bean germplasm collections based on morphological and microsatellite markers. Plant. Genet. Res. 2013, 11, 121–130. [Google Scholar] [CrossRef] [Scilit]
  55. Rebaa, F.; Abid, G.; Aouida, M.; Abdelkarim, S.; Aroua, I.; Muhovski, Y.; Baudoin, J.-P.; M’hamdi, M.; Sassi, K.; Jebara, M. Genetic variability in Tunisian populations of faba bean (Vicia faba L. var. major) assessed by morphological and SSR markers. Physiol. Mol. Biol. Plant. 2017, 23, 397–409. [Google Scholar] [CrossRef] [Scilit]
  56. Iangrai, B.; Pattanayak, A.; Khongwir, D.E.A.; Pale, G.; Gatphoh, E.M.; Das, A.; Chrungoo, N.K. Development and characterization of a new set of genomic microsatellite markers in rice bean (Vigna umbellata (Thunb.) Ohwi and Ohashi) and their utilization in genetic diversity analysis of collections from North East India. PLoS ONE 2017, 12, e0179801. [Google Scholar] [CrossRef] [Scilit]
  57. Khaidizar, M.I.; Haliloglu, K.; Elkoca, E.; Aydin, M.; Kantar, F. Genetic diversity of common bean (Phaseolus vulgaris L.) landraces grown in northeast Anatolia of Turkey assessed with simple sequence repeat markers. Turk. J. Field Crop. 2012, 17, 145–150. [Google Scholar]
  58. Haliloğlu, K.; Türkoğlu, A.; Öztürk, H.I.; Özkan, G.; Elkoca, E.; Poczai, P. iPBS-Retrotransposon Markers in the Analysis of Genetic Diversity among Common Bean (Phaseolus vulgaris L.) Germplasm from Türkiye. Genes 2022, 13, 1147. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  59. Mohammadi, S.A.; Prasanna, B. Analysis of genetic diversity in crop plants—salient statistical tools and considerations. Crop. Sci. 2003, 43, 1235–1248. [Google Scholar] [CrossRef] [Scilit]
  60. Klaedtke, S.M.; Caproni, L.; Klauck, J.; De la Grandville, P.; Dutartre, M.; Stassart, P.M.; Chable, V.; Negri, V.; Raggi, L. Short-term local adaptation of historical common bean (Phaseolus vulgaris L.) varieties and implications for in situ management of bean diversity. Int. J. Mol. Sci. 2017, 18, 493. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  61. Zhang, Q.; Li, J.; Zhao, Y.; Korban, S.S.; Han, Y. Evaluation of genetic diversity in Chinese wild apple species along with apple cultivars using SSR markers. Plant. Mol. Biol. Rep. 2012, 30, 539–546. [Google Scholar] [CrossRef] [Scilit]
  62. Rauscher, G.; Simko, I. Development of genomic SSR markers for fingerprinting lettuce (Lactuca sativa L.) cultivars and mapping genes. BMC Plant. Biol. 2013, 13, 1–11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  63. Zecca, G.; Abbott, J.R.; Sun, W.-B.; Spada, A.; Sala, F.; Grassi, F. The timing and the mode of evolution of wild grapes (Vitis). Mol. Phylogenet. Evol. 2012, 62, 736–747. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Geographic distribution of common bean landraces collected from different geographical provinces of Ispir, Türkiye (Table 1; 1: Öztoprak, 2: Ispir Center Gaziler Neighborhood, 3: Yeşilyurt Village, 4: Maden Village, 5: Elmalı District Ağıldere Village, 6: Ulubel Village, 7: Kirazlı Village, 8: Maden Köprübaşı District Akbağ Neighborhood, 9: Commercial varieties. Commercial varieties are shown off the map as they are not local genotypes).
Figure 1. Geographic distribution of common bean landraces collected from different geographical provinces of Ispir, Türkiye (Table 1; 1: Öztoprak, 2: Ispir Center Gaziler Neighborhood, 3: Yeşilyurt Village, 4: Maden Village, 5: Elmalı District Ağıldere Village, 6: Ulubel Village, 7: Kirazlı Village, 8: Maden Köprübaşı District Akbağ Neighborhood, 9: Commercial varieties. Commercial varieties are shown off the map as they are not local genotypes).
Genes 13 01410 g001
Figure 2. Dendrogram showing the genetic relationship between 45 bean genotypes generated by the neighbor-joining method of the MEGA software with the maximum composite likelihood substitution model using 27 SSR markers.
Figure 2. Dendrogram showing the genetic relationship between 45 bean genotypes generated by the neighbor-joining method of the MEGA software with the maximum composite likelihood substitution model using 27 SSR markers.
Genes 13 01410 g002
Figure 3. Principal coordinate analysis using SSR primer and separation on a two-dimensional diagram. The numbers in this figure represent the code numbers of the bean accessions presented in Table 1.
Figure 3. Principal coordinate analysis using SSR primer and separation on a two-dimensional diagram. The numbers in this figure represent the code numbers of the bean accessions presented in Table 1.
Genes 13 01410 g003
Figure 4. Graphic representation of population structure according to SSR data [For each bean genotype, subgroup 1 (red), subgroup 2 (green), and subgroup 3 (blue) are indicated by a vertical line representing the genotypes (K = 3)].
Figure 4. Graphic representation of population structure according to SSR data [For each bean genotype, subgroup 1 (red), subgroup 2 (green), and subgroup 3 (blue) are indicated by a vertical line representing the genotypes (K = 3)].
Genes 13 01410 g004
Figure 5. Geographical distribution of 45 bean genotypes identified by the STRUCTURE program using 27 SSR markers by region (1: Öztoprak, 2: Ispir Center Gaziler Neighborhood, 3: Yeşilyurt Village, 4: Maden Village, 5: Elmalı District Ağıldere Village, 6: Ulubel Village, 7: Kirazlı Village, 8: Maden Köprübaşı District Akbağ Neighborhood, 9: Commercial varieties. Commercial varieties are shown off the map as they are not local genotypes).
Figure 5. Geographical distribution of 45 bean genotypes identified by the STRUCTURE program using 27 SSR markers by region (1: Öztoprak, 2: Ispir Center Gaziler Neighborhood, 3: Yeşilyurt Village, 4: Maden Village, 5: Elmalı District Ağıldere Village, 6: Ulubel Village, 7: Kirazlı Village, 8: Maden Köprübaşı District Akbağ Neighborhood, 9: Commercial varieties. Commercial varieties are shown off the map as they are not local genotypes).
Genes 13 01410 g005
Table 1. List of bean accession by information, coordinates, and some seed characteristics of the gathering place (Figure 1).
Table 1. List of bean accession by information, coordinates, and some seed characteristics of the gathering place (Figure 1).
CN 1ACNSite-LocationLatitudeLongitudeAltitude (m)SW (g)SCSS
1Line-21-Öztoprak Village40.51841.052143157.3WhiteCircular
2Line-340.51841.052143157.3WhiteOval
3Line-440.51841.052143163.3WhiteCircular
4Line-540.51841.052143160.0WhiteOval
5Line-640.51841.052143157.2WhiteCircular
6Line-1040.51841.052143158.2WhiteCircular
7Line-1240.51841.052143155.1WhiteOval
8Line-1440.51841.052143159.1WhiteCircular
9Line-1540.51841.052143158.3WhiteCircular
10Line-1640.51841.052143162.0WhiteCircular
11Line-1740.51841.052143163.5WhiteCircular
12Line-1940.51841.052143162.1WhiteCircular
13Line-2040.51841.052143158.9WhiteOval
14Line-2140.51841.052143161.9WhiteCircular
15Line-262-Ispir Center Gaziler Neighborhood40.48541.002126460.2WhiteCircular
16Line-2740.46840.983116856.2WhiteCircular
17Line-2840.46840.983116859.8WhiteCircular
18Line-323-Yeşilyurt Village40.51841.069154957.0WhiteCircular
19Line-3340.51841.069154957.7WhiteCircular
20Line-3540.51841.069154958.1WhiteCircular
21Line-394-Maden Village40.43540.851122654.5WhiteOval
22Line-4040.43540.851122654.1WhiteOval
23Line-4140.43540.851122655.9WhiteOval
24Line-4240.43540.851122656.6WhiteCircular
25Line-455-Elmalı District Ağıldere Village40.40140.834147059.2WhiteCircular
26Line-4740.40140.834147059.2WhiteCircular
27Line-4940.40140.834147055.2WhiteCircular
28Line-5040.40140.834147058.4WhiteCircular
29Line-5340.40140.834147056.2WhiteCircular
30Line-5440.40140.834147061.4WhiteCircular
31Line-576-Ulubel Village40.41840.868142454.5WhiteCircular
32Line-5940.41840.868142456.5WhiteCircular
33Line-6040.41840.868142459.3WhiteCircular
34Line-6140.41840.868142457.9WhiteCircular
35Line-6240.41840.868142455.3WhiteCircular
36Line-6340.41840.868142457.4WhiteCircular
37Line-647-Kirazlı Village40.43640.887122058.2WhiteOval
38Line-6540.43640.887122054.8WhiteCircular
39Line-678-Maden Köprübaşı District Akbağ Neighborhood40.43440.819128659.7WhiteCircular
40Line-6940.43440.819128655.6WhiteCircular
41Aras-989-Eastern Anatolia Agricultural Research Institute Directorate/Erzurum45.4WhiteCylindrical
42Elkoca-05Ataturk University Faculty of Agriculture/Erzurum49.6WhiteCylindrical
43Göynük-98Gateway Agricultural Research Institute Directorate/Eskişehir53.5WhiteCylindrical
44Karacaşehir-90Gateway Agricultural Research Institute Directorate/Eskişehir18.0WhiteOval
45Yakutiye-98Eastern Anatolia Agricultural Research Institute Directorate/Erzurum43.9WhiteCylindrical
1 CN: Code number; ACN: Accession number; SW: 100-seed weight (g); SC: Seed color SS: Seed shape.
Table 2. SSR primers and sequence information used for genetic diversity analysis among bean accessions.
Table 2. SSR primers and sequence information used for genetic diversity analysis among bean accessions.
Marker NameGenBank CodeSize (bp)Linkage GroupMotifsForward (5′–3′)Reverse (5′–3′)References
BMd1X96999165Pv03(AT)9CAAATCGCAACACCTCACAAGTCGGAGCCATCATCTGTTT[33]
BMd15K03288166Pv04(ATGC)4TTGCCATCGTTGCTTAATTGTTGGAGGAAGCCATGTATGC[33]
BMd18X59469216Pv02(GAAT)3AAAGTTGGACGCACTGTGATTTCGTGAGGTAGGAGTTTGGTG[33]
BM053AF324244105Pv01(CT)21(CA)19(TA)9TGCTGACCAAGGAAATTCAGGGAGGAGGCTTAAGCACAAA[33]
BM114AF483854234Pv09(TA)8(GT)10AGCCTGGTGAAATGCTCATAGCATGCTTGTTGCCTAACTCTCT[34]
BM137AF483855155Pv06(CT)33CGCTTACTCACTGTACGCACGCCGTATCCGAGCACCGTAAC[34]
BM141AF483859218Pv09(GA)29TGAGGAGGAACAATGGTGGC CTCACAAACCACAACGCACC[34]
BM143AF483861143Pv02(GA)35GGGAAATGAACAGAGGAAA ATGTTGGGAACTTTTAGTGTG[34]
BM152AF483868127Pv02(GA)31AAGAGGAGGTCGAAACCTTAAATCGCCGGGACTTGCCAGAAGAAC[34]
BM153AF483869226Pv08(CA)5(TG)(CA)3CG(CA)10(TA)4CCGTTAGGGAGTTGTTGAGG TGACAAACCATGAATATGCTAAGA[34]
BM154AF483870218Pv09(CT)17TCTTGCGACCGAGCTTCTCC CTGAATCTGAGGAACGATGACCAG[34]
BM156AF483872267Pv02(CT)32CTTGTTCCACCTCCCATCATAGC TGCTTGCATCTCAGCCAGAATC[34]
BM160AF483876211Pv09(GA)15(GAA)5CGTGCTTGGCGAATAGCTTTG CGCGGTTCTGATCGTGACTTC[34]
BM161AF483877185Pv04(GA)7(GA)8TGCAAAGGGTTGAAAGTTGAGAG TTCCAATGCACCAGACATTCC[34]
BM167AF483881165Pv08(GA)19TCCTCAATACTACATCGTGTGACC CCTGGTGTAACCCTCGTAACAG[34]
BM175AF483886170Pv05(AT)5(GA)19CAACAGTTAAAGGTCGTCAAATT CCACTCTTAGCATCAACTGGA[34]
PVAT001U18791239Pv04(AT)22GGGAGGGTAGGGAAGCAGTG GCGAACCACGTTCATGAATGA[35]
PVAG004X04660201Pv04(AG)8TTGATGACGTGGATGCATTGCAAAGGGCTAGGGAGAGTAAGTTGG[35]
PVBR14DQ185881196Pv06(AG)23TGAGAAAGTTGATGGGATTGACGCTGTTGAAGGCTCTAC[36]
BM183AF483888149Pv07(TC)14CTCAAATCTATTCACTGGTCAGCTCTTACAGCCTTGCAGACATC[34]
BM188AF483892177Pv09(CA)18(TA)7TCGCCTTGAAACTTCTTGTATCCCCTTCCAGTTAAATCAGTCG[34]
BM199AF483896304Pv04(GA)15AAGGAGAATCAGAGAAGCCAAAAGTGAGGAATGGATGTAGCTCAGG[34]
BM200AF483897221Pv01(AG)10TGGTGGTTGTTATGGGAGAAGATTTGTCTCTGTCTATTCCTTCCAC[34]
BM210AF483902166Pv07(CT)15ACCACTGCAATCCTCATCTTTGCCCTCATCCTCCATTCTTATCG[34]
BM211AF483903186Pv08(CT)16ATACCCACATGCACAAGTTTGGCCACCATGTGCTCATGAAGAT[34]
GATS91AF483842229Pv02(GA)17GAGTGCGGAAGCGAGTGAGTCCGTGTTCCTCTGTCTGTG[37]
PVTTTC01X53603163Pv07(GAAT)5TGGACTCATAGAGGCGCAGAAAGAAGGATGGGTTCCGTGCTTG[35]
Table 3. Summary information obtained with twenty-seven 27 SSR primer pairs used in bean accessions collected from İspir location.
Table 3. Summary information obtained with twenty-seven 27 SSR primer pairs used in bean accessions collected from İspir location.
LocusAllele NumberNumber of Polymorphic BandsPolymorphism Percentage (%)Allele FrequencyGene DiversityObserved HeterozygosityPIC *
BM053331000.780.370.000.33
BM114661000.360.740.930.69
BM137661000.290.780.000.75
BM141771000.220.830.980.81
BM14311111000.290.780.960.75
BM152661000.330.751.000.71
BM15312121000.200.870.510.86
BM154441000.670.480.000.42
BM156551000.300.771.000.73
BM160771000.320.770.960.73
BM161331000.490.570.000.48
BM167661000.280.800.000.77
BM175331000.380.660.000.59
BM183331000.590.500.000.40
BM188551000.440.670.000.61
BM199331000.420.640.000.56
BM200441000.420.680.870.62
BM210661000.470.710.000.67
BM211661000.310.790.000.76
BMd1771000.220.831.000.81
BMd15441000.360.730.000.68
BMd18331000.580.560.000.49
GATS91221000.620.470.000.36
PVAG004661000.490.690.000.65
PVAT001881000.240.830.000.81
PVBR14441000.310.740.000.69
PVTT001221000.600.480.000.36
Mean5.265.261000.410.690.300.63
* PIC: polymorphism information content.
Table 4. Effective number of alleles (Ne), expected heterozygosity (He) and Shannon information index (I) based on 27 SSR loci bean accessions.
Table 4. Effective number of alleles (Ne), expected heterozygosity (He) and Shannon information index (I) based on 27 SSR loci bean accessions.
MarkerNe *He **I ***MarkerNe *He **I ***
BM0531.5780.3700.665BM1883.0170.6761.223
BM1143.8240.7461.472BM1992.7700.6461.054
BM1374.6330.7931.614BM2003.1290.6881.243
BM1415.9210.841.832BM2103.4030.7141.450
BM1434.5810.7901.752BM2114.8560.8031.668
BM1524.0740.7631.515BMd16.0260.8431.841
BM1537.8640.8822.202BMd153.7080.7381.349
BM1541.9300.4870.846BMd182.2980.5710.944
BM1564.3360.7781.529GATS911.8870.4750.663
BM1604.2810.7751.619PVAG0043.1990.6951.420
BM1612.3510.5810.9291PVAT0015.9730.8411.895
BM1674.9300.8061.6542PVBR143.7850.7441.356
BM1752.9390.6671.088PVTT0011.9160.4830.671
BM1832.0040.5060.764Mean3.7490.6931.343
* Ne: effective number of alleles, ** He: expected heterozygosity and *** I: Shannon’s information index, respectively.
Table 5. Groups and subgroups of P. vulgaris accessions determined as a result of Neighbor Joining (NJ) cluster analysis.
Table 5. Groups and subgroups of P. vulgaris accessions determined as a result of Neighbor Joining (NJ) cluster analysis.
GroupSubgroupGenotypeTotal Genotype Number
I12, 3, 4, 5, 6, 10, 12, 14, 15, 16, 17, 19, 20, 21, 26, 27, 28, 32, 33, 35, 39, 40, 4123
242, 45, 47, 494
II-50, 53, 54, 57, 59, 60, 61, 628
III163, 64, 65, 67, 695
2Aras-98, Elkoca-05, Göynük-98, Yakutiye-98, Karacaşehir-905
Table 6. Analysis of molecular variance (AMOVA) among and within the bean genotypes, using SSR marker.
Table 6. Analysis of molecular variance (AMOVA) among and within the bean genotypes, using SSR marker.
SourceDegree of
Freedom (DF)
Sum of
Squares (SS)
Variance
Component
% of Total
Variance
p-Value
Among Population8410.4087.87634%0.339
Within Population36537.77415.36566%0.001
Total44948.18223.241100%
Table 7. Estimates of genetic diversity and distribution of gene diversity between the populations of P. vulgaris L. assessed with twenty-seven SSR primers.
Table 7. Estimates of genetic diversity and distribution of gene diversity between the populations of P. vulgaris L. assessed with twenty-seven SSR primers.
PopulationNNaNeIHeuHePPL (%)
Ov141.2891.3110.2900.1890.19664.08%
Ic30.3871.0650.0550.0380.0519.15%
Yv30.6971.1970.1680.1140.13729.58%
Mv40.8311.2120.1930.1270.14537.32%
Eav60.8801.2420.2150.1430.15640.85%
Uv60.8451.2280.2020.1340.14738.73%
Kv20.5001.1200.1020.0700.09316.90%
Mka20.4721.1100.0940.0640.08615.49%
Com51.0141.2590.2380.1560.17348.59%
Mean 0.7681.1940.1730.1150.13133.41%
N: number of sample size, Na: number of distinct alleles, Ne: effective number of alleles, I: Shannon’s information index, He: expected heterozygosity, uHe: unbiased expected heterozygosity, PPL: percentage of polymorphic loci; Ov: Oztoprak Village; Ic: Ispir Center, Yv: Yesilyurt Village, Mv: Maden Village, Eav: Elmali Town Agildere Village, Uv: Ulubel Village, Kv: Kirazli Village; Mka: Maden Koprubasi Town Akbag District, Com: Commercial.
Table 8. Pairwise population matrix of Nei genetic (h) distance for nine groups of beans (P. vulgaris L.) genotypes.
Table 8. Pairwise population matrix of Nei genetic (h) distance for nine groups of beans (P. vulgaris L.) genotypes.
OvIcYvMvEvUvKvMkaCom
Ov0.000
Ic0.1700.000
Yv0.1240.1340.000
Mv0.1290.1530.0890.000
Ev0.1180.1960.1550.0870.000
Uv0.0980.2450.2010.1770.1110.000
Kv0.1950.3090.2780.2340.2130.1130.000
Mka0.1950.3410.2580.2250.2370.1720.1110.000
Com0.1250.2830.1900.1660.1810.1540.1780.1280.000
Ov: Oztoprak Village; Ic: Ispir Center, Yv: Yesilyurt Village, Mv: Maden Village, Eav: Elmali Town Agildere Village, Uv: Ulubel Village, Kv: Kirazli Village; Mka: Maden Koprubasi Town Akbag District, Com: Commercial.
Table 9. Membership coefficient of bean genotypes in three subpopulations.
Table 9. Membership coefficient of bean genotypes in three subpopulations.
No.GenotypeSubpopulationNo.GenotypeSubpopulation
IIIIIIIIIIII
1Line-20.0260.551 *0.42224Line-420.987 *0.0070.006
2Line-30.0090.2160.775 *25Line-450.970 *0.0160.015
3Line-40.0080.3490.643 *26Line-470.991 *0.0050.004
4Line-50.010.0270.963 *27Line-490.987 *0.0060.007
5Line-60.0850.0050.910 *28Line-500.951 *0.0290.02
6Line-100.0070.0170.975 *29Line-530.947 *0.0340.019
7Line-120.0060.0060.988 *30Line-540.808 *0.1240.068
8Line-140.0050.0040.99 *31Line-570.826 *0.1610.013
9Line-150.040.010.95 *32Line-590.599 *0.3230.078
10Line-160.1020.0180.88 *33Line-600.4660.488 *0.046
11Line-170.0140.0640.922 *34Line-610.1020.644 *0.254
12Line-190.1670.0250.808 *35Line-620.0350.820 *0.145
13Line-200.2080.0070.785 *36Line-630.0060.970 *0.024
14Line-210.2180.0090.773 *37Line-640.0570.931 *0.013
15Line-260.3870.0060.607 *38Line-650.0060.989 *0.005
16Line-270.880 *0.0050.11539Line-670.010.983 *0.007
17Line-280.885 *0.0060.10840Line-690.020.974 *0.006
18Line-320.853 *0.010.13741Aras-980.0050.990 *0.004
19Line-330.746 *0.0160.23842Elkoca-050.010.984 *0.006
20Line-350.977 *0.010.01343Göynük-980.0120.982 *0.007
21Line-390.971 *0.0180.01244Karacaşehir-900.0690.879 *0.053
22Line-400.969 *0.0150.01645Yakutiye-980.0280.957 *0.015
23Line-410.980 *0.0070.014
* in the table used to highlight which subgroup the participants belong to.
Table 10. Expected heterozygosity and FST values in bean subpopulations.
Table 10. Expected heterozygosity and FST values in bean subpopulations.
Subpopulation (K)Expected HeterozygosityFST
10.2430.34
20.2690.26
30.2280.41
Mean0.2470.34
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Özkan, G.; Haliloğlu, K.; Türkoğlu, A.; Özturk, H.I.; Elkoca, E.; Poczai, P. Determining Genetic Diversity and Population Structure of Common Bean (Phaseolus vulgaris L.) Landraces from Türkiye Using SSR Markers. Genes 2022, 13, 1410. https://doi.org/10.3390/genes13081410

AMA Style

Özkan G, Haliloğlu K, Türkoğlu A, Özturk HI, Elkoca E, Poczai P. Determining Genetic Diversity and Population Structure of Common Bean (Phaseolus vulgaris L.) Landraces from Türkiye Using SSR Markers. Genes. 2022; 13(8):1410. https://doi.org/10.3390/genes13081410

Chicago/Turabian Style

Özkan, Güller, Kamil Haliloğlu, Aras Türkoğlu, Halil Ibrahim Özturk, Erdal Elkoca, and Peter Poczai. 2022. "Determining Genetic Diversity and Population Structure of Common Bean (Phaseolus vulgaris L.) Landraces from Türkiye Using SSR Markers" Genes 13, no. 8: 1410. https://doi.org/10.3390/genes13081410

APA Style

Özkan, G., Haliloğlu, K., Türkoğlu, A., Özturk, H. I., Elkoca, E., & Poczai, P. (2022). Determining Genetic Diversity and Population Structure of Common Bean (Phaseolus vulgaris L.) Landraces from Türkiye Using SSR Markers. Genes, 13(8), 1410. https://doi.org/10.3390/genes13081410

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop