Cytoplasmic Interactions between the Glucocorticoid Receptor and HDAC2 Regulate Osteocalcin Expression in VPA-Treated MSCs
Abstract
:1. Introduction
2. Materials and Methods
2.1. Human Dental Pulp Extraction and Cell Culture
2.2. Chemicals and Reagents
2.3. MTT Analysis
2.4. RNA Extraction and qRT-PCR
2.5. In Vivo Grafting
2.6. Ethics Statement
2.7. Cryostat Sectioning
2.8. Immunohistochemistry/Immunofluorescence Analysis
2.9. Transfection (shRNA Construct, Transfection, and Stable Selection)
2.10. Gene Expression Analysis
2.11. Protein Extraction and Co-Immunoprecipitation
2.12. Chromatin Immunoprecipitation
2.13. Bioinformatic Analysis
2.14. Flow Cytometry
2.15. Statistical Analysis
3. Results
3.1. HDAC Inhibitors Enhance the Expression of Osteogenic Markers
3.2. Bone Formation In Vivo
3.3. HDAC2 and Glucocorticoid Receptor Involvement in VPA-Treated DPSCs
3.4. GR Binding on the nGRE Sequence at the Osteocalcin Promoter
3.5. GR Inhibition by RU-486-Recovered OC Expression in DPSCs Treated with VPA
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Feng, X.; McDonald, J.M. Disorders of bone remodeling. Annu. Rev. Pathol. 2011, 6, 121–145. [Google Scholar] [CrossRef] [PubMed]
- Graves, D.T.; Oates, T.; Garlet, G.P. Review of osteoimmunology and the host response in endodontic and periodontal lesions. J. Oral. Microbiol. 2011. [Google Scholar] [CrossRef] [PubMed]
- Clarke, B. Normal bone anatomy and physiology. CJASN 2008, 3, S131–S139. [Google Scholar] [CrossRef] [PubMed]
- Rogers, G.F.; Greene, A.K. Autogenous bone graft: Basic science and clinical implications. J. Craniofac. Surg. 2012, 23, 323–327. [Google Scholar] [CrossRef] [PubMed]
- Roukis, T.S.; Zgonis, T.; Tiernan, B. Autologous platelet-rich plasma for wound and osseous healing: A review of the literature and commercially available products. Adv. Ther. 2006, 23, 218–237. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Giannoudis, P.V.; Dinopoulos, H.; Tsiridis, E. Bone substitutes: An update. Injury 2005, 36, S20–S27. [Google Scholar] [CrossRef] [PubMed]
- Caplan, A.I. Adult mesenchymal stem cells for tissue engineering versus regenerative medicine. J. Cell. Physiol. 2007, 213, 341–347. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Forbes, S.J.; Vig, P.; Poulsom, R.; Wright, N.A.; Alison, M.R. Adult stem cell plasticity: New pathways of tissue regeneration become visible. Clin. Sci. 2002, 103, 355–369. [Google Scholar] [CrossRef] [PubMed]
- Paino, F.; La Noce, M.; Giuliani, A.; De Rosa, A.; Mazzoni, S.; Laino, L.; Amler, E.; Papaccio, G.; Desiderio, V.; Tirino, V. Human DPSCs fabricate vascularized woven bone tissue: A new tool in bone tissue engineering. Clin. Sci. 2017, 131, 699–713. [Google Scholar] [CrossRef] [PubMed]
- Gronthos, S.; Mankani, M.; Brahim, J.; Robey, P.G.; Shi, S. Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo. Proc. Natl. Acad. Sci. USA 2000, 97, 13625–13630. [Google Scholar] [CrossRef] [PubMed]
- Mangano, C.; De Rosa, A.; Desiderio, V.; d’Aquino, R.; Piattelli, A.; De Francesco, F.; Tirino, V.; Mangano, F.; Papaccio, G. The osteoblastic differentiation of dental pulp stem cells and bone formation on different titanium surface textures. Biomaterials 2010, 31, 3543–3551. [Google Scholar] [CrossRef] [PubMed]
- Laino, G.; d’Aquino, R.; Graziano, A.; Lanza, V.; Carinci, F.; Naro, F.; Pirozzi, G.; Papaccio, G. A new population of human adult dental pulp stem cells: A useful source of living autologous fibrous bone tissue (LAB). J. Bone Min. Res. 2005, 20, 1394–1402. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Walboomers, X.F.; Van Kuppevelt, T.H.; Daamen, W.F.; Van Damme, P.A.; Bian, Z.; Jansen, J.A. In vivo evaluation of human dental pulp stem cells differentiated towards multiple lineages. J. Tissue Eng. Regen. Med. 2008, 2, 117–125. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Walboomers, X.F.; Shi, S.; Fan, M.; Jansen, J.A. Multilineage differentiation potential of stem cells derived from human dental pulp after cryopreservation. Tissue Eng. 2006, 12, 2813–2823. [Google Scholar] [CrossRef] [PubMed]
- D’Aquino, R.; Graziano, A.; Sampaolesi, M.; Laino, G.; Pirozzi, G.; De Rosa, A.; Papaccio, G. Human postnatal dental pulp cells co-differentiate into osteoblasts and endotheliocytes: A pivotal synergy leading to adult bone tissue formation. Cell Death Differ. 2007, 14, 1162–1171. [Google Scholar] [CrossRef] [PubMed]
- Giuliani, A.; Manescu, A.; Langer, M.; Rustichelli, F.; Desiderio, V.; Paino, F.; De Rosa, A.; Laino, L.; d’Aquino, R.; Tirino, V.; et al. Three years after transplants in human mandibles, histological and in-line holotomography revealed that stem cells regenerated a compact rather than a spongy bone: Biological and clinical implications. Stem Cells Transl. Med. 2013, 2, 316–324. [Google Scholar] [CrossRef] [PubMed]
- Franceschi, R.T.; Xiao, G. Regulation of the osteoblast-specific transcription factor, Runx2: Responsiveness to multiple signal transduction pathways. J. Cell Biochem. 2003, 88, 446–454. [Google Scholar] [CrossRef] [PubMed]
- Green, E.; Todd, B.; Heath, D. Mechanism of glucocorticoid regulation of alkaline phosphatase gene expression in osteoblast-like cells. Eur. J. Biochem. 1990, 188, 147–153. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, T.M.; Lee, E.H. Transcriptional Regulatory Cascades in Runx2-Dependent Bone Development. Tissue Eng. 2013, 19, 254–263. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Legube, G.; Legube, D. Regulating histone acetyltransferases and deacetylases. EMBO Rep. 2003, 4, 944–947. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kuo, M.H.; Allis, C.D. Roles of histone acetyltransferases and deacetylases in gene regulation. Bioessays 1998, 20, 615–626. [Google Scholar] [CrossRef]
- Haberland, M.; Montgomery, R.L.; Olson, E.N. The many roles of histone deacetylases in development and physiology: Implications for disease and therapy. Nat. Rev. Genet. 2009, 10, 32–42. [Google Scholar] [CrossRef] [PubMed]
- Ware, C.B.; Wang, L.; Mecham, B.H.; Shen, L.; Nelson, A.M.; Bar, M.; Lamba, D.A.; Dauphin, D.S.; Buckingham, B.; Askari, B.; et al. Histone deacetylase inhibition elicits an evolutionarily conserved self-renewal program in embryonic stem cells. Cell Stem Cell 2009, 4, 359–369. [Google Scholar] [CrossRef] [PubMed]
- Hayashi, K.; Lopes, S.M.C.D.S.; Tang, F.; Surani, M.A. Dynamic equilibrium and heterogeneity of mouse pluripotent stem cells with distinct functional and epigenetic states. Cell Stem Cell 2008, 3, 391–401. [Google Scholar] [CrossRef] [PubMed]
- McCool, K.W.; Xu, X.; Singer, D.B.; Murdoch, F.E.; Fritsch, M.K. The role of histone acetylation in regulating early gene expression patterns during early embryonic stem cell differentiation. J. Biol. Chem. 2007, 282, 6696–6706. [Google Scholar] [CrossRef] [PubMed]
- Karantzali, E.; Schulz, H.; Hummel, O.; Hubner, N.; Hatzopoulos, A.K.; Kretsovali, A. Histone deacetylase inhibition accelerates the early events of stem cell differentiation: Transcriptomic and epigenetic analysis. Genome Biol. 2008. [Google Scholar] [CrossRef] [PubMed]
- Kretsovali, A.; Hadjimichael, C.; Charmpilas, N. Histone deacetylase inhibitors in cell pluripotency, differentiation, and reprogramming. Stem Cells Int. 2012, 2012, 184154. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.; Park, J.R.; Seo, M.S.; Roh, K.H.; Park, S.B.; Hwang, J.W.; Sun, B.; Seo, K.; Lee, Y.S.; Kang, S.K.; et al. Histone deacetylase inhibitors decrease proliferation potential and multilineage differentiation capability of human mesenchymal stem cells. Cell Prolif. 2009, 42, 711–720. [Google Scholar] [CrossRef] [PubMed]
- Schroeder, T.M.; Westendorf, J.J. Histone deacetylase inhibitors promote osteoblast maturation. J. Bone Min. Res. 2005, 20, 2254–2263. [Google Scholar] [CrossRef] [PubMed]
- De Boer, J.; Licht, R.; Bongers, M.; van der Klundert, T.; Arends, R.; van Blitterswijk, C. Inhibition of histone acetylation as a tool in bone tissue engineering. Tissue Eng. 2006, 12, 2927–2937. [Google Scholar] [CrossRef] [PubMed]
- Cho, H.H.; Park, H.T.; Kim, Y.J.; Bae, Y.C.; Suh, K.T.; Jung, J.S. Induction of osteogenic differentiation of human mesenchymal stem cells by histone deacetylase inhibitors. J. Cell Biochem. 2005, 96, 533–542. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.W.; Suh, J.H.; Kim, A.Y.; Lee, Y.S.; Park, S.Y.; Kim, J.B. Histone deacetylase 1-mediated histone modification regulates osteoblast differentiation. Mol. Endocrinol. 2006, 20, 2432–2443. [Google Scholar] [CrossRef] [PubMed]
- Paino, F.; La Noce, M.; Tirino, V.; Naddeo, P.; Desiderio, V.; Pirozzi, G.; De Rosa, A.; Laino, L.; Altucci, L.; Papaccio, G. Histone deacetylase inhibition with valproic acid downregulates osteocalcin gene expression in human dental pulp stem cells and osteoblasts: Evidence for HDAC2 involvement. Stem Cells 2014, 32, 279–289. [Google Scholar] [CrossRef] [PubMed]
- Oakley, R.H.; Cidlowski, J.A. The biology of the glucocorticoid receptor: New signaling mechanisms in health and disease. J. Allergy Clin. Immunol. 2013, 132, 1033–1044. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nicolaides, N.C.; Galata, Z.; Kino, T.; Chrousos, G.P.; Charmandari, E. The human glucocorticoid receptor: Molecular basis of biologic function. Steroids 2010, 75, 1–12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vandevyver, S.; Dejager, L.; Libert, C. On the trail of the glucocorticoid receptor: Into the nucleus and back. Traffic 2012, 13, 364–374. [Google Scholar] [CrossRef] [PubMed]
- Morrison, N.; Eisman, J. Role of the negative glucocorticoid regulatory element in glucocorticoid repression of the human osteocalcin promoter. J. Bone Min. Res. 1993, 8, 969–975. [Google Scholar] [CrossRef] [PubMed]
- La Noce, M.; Paino, F.; Spina, A.; Naddeo, P.; Montella, R.; Desiderio, V.; De Rosa, A.; Papaccio, G.; Tirino, V.; Laino, L. Dental pulp stem cells: State of the art and suggestions for a true translation of research into therapy. J. Dent. 2014, 42, 761–768. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lajeunesse, D.; Kiebzak, G.M.; Frondoza, C.; Sacktor, B. Regulation of osteocalcin secretion by human primary bone cells and by the human osteosarcoma cell line MG-63. Bone Min. 1991, 14, 237–250. [Google Scholar] [CrossRef]
- Leclerc, N.; Noh, T.; Khokhar, A.; Smith, E.; Frenkel, B. Glucocorticoids inhibit osteocalcin transcription in osteoblasts by suppressing Egr2/Krox20-binding enhancer. Arthritis Rheum 2005, 52, 929–939. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ogata, Y.; Yamauchi, M.; Kim, R.H.; Li, J.J.; Freedman, L.P.; Sodek, J. Glucocorticoid regulation of bone sialoprotein (BSP) gene expression. Identification of a glucocorticoid response element in the bone sialoprotein gene promoter. Eur. J. Biochem. 1995, 230, 183–192. [Google Scholar] [CrossRef] [PubMed]
- Nakashima, K.; de Crombrugghe, B. Transcriptional mechanisms in osteoblast differentiation and bone formation. Trends Genet. 2003, 19, 458–466. [Google Scholar] [CrossRef]
- Zoch, M.L.; Clemens, T.L.; Riddle, R.C. New insights into the biology of osteocalcin. Bone 2016, 82, 42–49. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Strömstedt, P.E.; Poellinger, L.; Gustafsson, J.A.; Carlstedt-Duke, J. The glucocorticoid receptor binds to a sequence overlapping the TATA box of the human osteocalcin promoter: A potential mechanism for negative regulation. Mol. Cell. Biol. 1991, 11, 3379–3383. [Google Scholar] [CrossRef] [PubMed]
- Moutsatsou, P.; Kassi, E.; Papavassiliou, A.G. Glucocorticoid receptor signaling in bone cells. Trends Mol. Med. 2012, 18, 348–359. [Google Scholar] [CrossRef] [PubMed]
- Young, R.A. Control of the embryonic stem cell state. Cell 2011, 144, 940–954. [Google Scholar] [CrossRef] [PubMed]
- Hu, E.; Dul, E.; Sung, C.M.; Chen, Z.; Kirkpatrick, R.; Zhang, G.F.; Johanson, K.; Liu, R.; Lago, A.; Hofmann, G.; et al. Identification of novel isoform-selective inhibitors within class I histone deacetylases. J. Pharm. Exp. Ther. 2003, 307, 720–728. [Google Scholar] [CrossRef] [PubMed]
- Khan, N.; Jeffers, M.; Kumar, S.; Hackett, C.; Boldog, F.; Khramtsov, N.; Qian, X.; Mills, E.; Berghs, S.C.; Carey, N.; et al. Determination of the class and isoform selectivity of small-molecule histone deacetylase inhibitors. Biochem. J. 2008, 409, 581–589. [Google Scholar] [CrossRef] [PubMed]
- Loscher, W. Basic pharmacology of valproate: A review after 35 years of clinical use for the treatment of epilepsy. CNS Drugs. 2002, 16, 669–694. [Google Scholar] [CrossRef] [PubMed]
- Göttlicher, M.; Minucci, S.; Zhu, P.; Krämer, O.H.; Schimpf, A.; Giavara, S.; Sleeman, J.P.; Lo Coco, F.; Nervi, C.; Pelicci, P.G.; et al. Valproic acid defines a novel class of HDAC inhibitors inducing differentiation of transformed cells. EMBO J. 2001, 20, 6969–6978. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, S.C.; Sprung, R.; Chen, Y.; Xu, Y.; Ball, H.; Pei, J.; Cheng, T.; Kho, Y.; Xiao, H.; Xiao, L.; et al. Substrate and functional diversity of lysine acetylation revealed by a proteomics survey. Mol. Cell 2006, 23, 607–618. [Google Scholar] [CrossRef] [PubMed]
- Ocker, M. Deacetylase inhibitors—focus on non-histone targets and effects. World J. Biol. Chem. 2010, 1, 55–61. [Google Scholar] [CrossRef] [PubMed]
- Miyoshi, N.; Ishii, H.; Nagano, H.; Haraguchi, N.; Dewi, D.L.; Kano, Y.; Nishikawa, S.; Tanemura, M.; Mimori, K.; Tanaka, F.; et al. Reprogramming of mouse and human cells to pluripotency using mature microRNAs. Cell Stem Cell 2011, 8, 633–638. [Google Scholar] [CrossRef] [PubMed]
- Watari, S.; Hayashi, K.; Wood, J.A.; Russell, P.; Nealey, P.F.; Murphy, C.J.; Genetos, D.C. Modulation of osteogenic differentiation in hMSCs cells by submicron topographically-patterned ridges and grooves. Biomaterials 2010, 31, 3244–3252. [Google Scholar] [CrossRef] [PubMed]
- Ehnert, S.; Zhao, J.; Pscherer, S.; Freude, T.; Dooley, S.; Kolk, A.; Stöckle, U.; Nussler, A.K.; Hube, R. Transforming growth factor β1 inhibits bone morphogenic protein (BMP)-2 and BMP-7 signaling via upregulation of Ski-related novel protein N (SnoN): Possible mechanism for the failure of BMP therapy? BMC Med. 2012, 10, 101. [Google Scholar] [CrossRef] [PubMed]
- Triantafyllou, N.; Lambrinoudaki, I.; Armeni, E.; Evangelopoulos, E.M.; Boufidou, F.; Antoniou, A.; Tsivgoulis, G. Effect of long-term valproate monotherapy on bone mineral density in adults with epilepsy. J. Neurol. Sci. 2010, 290, 131–134. [Google Scholar] [CrossRef] [PubMed]
- Naddeo, P.; Laino, L.; La Noce, M.; Piattelli, A.; De Rosa, A.; Iezzi, G.; Laino, G.; Paino, F.; Papaccio, G.; Tirino, V. Surface biocompatibility of differently textured titanium implants with mesenchymal stem cells. Dent. Mater. 2015, 31, 235–243. [Google Scholar] [CrossRef] [PubMed]
- Maroni, P.; Brini, A.T.; Arrigoni, E.; de Girolamo, L.; Niada, S.; Matteucci, E.; Bendinelli, P.; Desiderio, M.A. Chemical and genetic blockade of HDACs enhances osteogenic differentiation of human adipose tissue-derived stem cells by oppositely affecting osteogenic and adipogenic transcription factors. Biochem. Biophys. Res. Commun. 2012, 428, 271–277. [Google Scholar] [CrossRef] [PubMed]
- Pico, M.J.; Hashemi, S.; Xu, F.; Nguyen, H.K.; Donnelly, R.; Moran, E.; Flowers, S. Glucocorticoid receptor-mediated cis-repression of osteogenic genes requires BRM-SWI/SNF. Bone Rep. 2016, 222–227. [Google Scholar] [CrossRef] [PubMed]
- Ducy, P.; Desbois, C.; Boyce, B.; Pinero, G.; Story, B.; Dunstan, C.; Smith, E.; Bonadio, J.; Goldstein, S.; Gundberg, C.; et al. Increased bone formation in osteocalcin-deficient mice. Nature 1996, 382, 448–452. [Google Scholar] [CrossRef] [PubMed]
- Chrousos, G.P. Stress and disorders of the stress system. Nat. Rev. Endocrinol. 2009, 5, 374–381. [Google Scholar] [CrossRef] [PubMed]
- Rose, A.J.; Vegiopoulos, A.; Herzig, S. Role of glucocorticoids and the glucocorticoid receptor in metabolism: Insights from genetic manipulations. J. Steroid Biochem. 2010, 122, 10–20. [Google Scholar] [CrossRef] [PubMed]
- Pratt, W.B.; Silverstein, A.M.; Galigniana, M.D. A model for the cytoplasmic trafficking of signalling proteins involving the hsp90-binding immunophilins and p50cdc37. Cell Signal. 1999, 11, 839–851. [Google Scholar] [CrossRef]
- Itoh, M.; Adachi, M.; Yasui, H.; Takekawa, M.; Tanaka, H.; Imai, K. Nuclear export of glucocorticoid receptor is enhanced by c-Jun N-terminal kinase-mediated phosphorylation. Mol. Endocrinol. 2002, 16, 2382–2392. [Google Scholar] [CrossRef] [PubMed]
- Ito, K.; Yamamura, S.; Essilfie-Quaye, S.; Cosio, B.; Ito, M.; Barnes, P.J.; Adcock, I.M. Histone deacetylase 2-mediated deacetylation of the glucocorticoid receptor enables NF-kappaB suppression. J. Exp. Med. 2006, 23, 7–13. [Google Scholar] [CrossRef] [PubMed]
- Heinrichs, A.A.; Bortell, R.; Rahman, S.; Stein, J.L.; Alnemri, E.S.; Litwack, G.; Lian, J.B.; Stein, G.S. Identification of multiple glucocorticoid receptor binding sites in the rat osteocalcin gene promoter. Biochemistry 1993, 32, 11436–11444. [Google Scholar] [CrossRef] [PubMed]
- Gustafsson, J.A.; Carlstedt-Duke, J. Glucocorticoid-dependent transcriptional repression of the osteocalcin gene by competitive binding at the TATA box. DNA Cell Biol. 1997, 16, 919–927. [Google Scholar]
GENE | Accession Number | Sequence | Amplicon Size (bp) | Tm (°C) | Ta (°C) |
---|---|---|---|---|---|
GAPDH | NM_002046.7 | FW: ggagtcaacggatttggtcg REV: cttcccgttctcagccttga | 180 | 81.7 | 60 |
OC | NM_199173.6 | FW: ctcacactcctcgccctattg REV: cttggacacaaaggctgcac | 108 | 87.51 | 60 |
OPN | NM_001040058.2 | FW: gccgaggtgatagtgtggtt REV: tgaggtgatgtcctcgtctg | 101 | 79.33 | 58 |
BSP | NM_004967.4 | FW: ctggcacagggtatacagggttag REV: actggtgccgtttatgccttg | 182 | 79.46 | 60 |
GR | NM_000176.3 | FW: ggagaggggagatgtgatgg REV: agggtgaagacgcagaaacc | 72 | 79.16 | 60 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
La Noce, M.; Mele, L.; Laino, L.; Iolascon, G.; Pieretti, G.; Papaccio, G.; Desiderio, V.; Tirino, V.; Paino, F. Cytoplasmic Interactions between the Glucocorticoid Receptor and HDAC2 Regulate Osteocalcin Expression in VPA-Treated MSCs. Cells 2019, 8, 217. https://doi.org/10.3390/cells8030217
La Noce M, Mele L, Laino L, Iolascon G, Pieretti G, Papaccio G, Desiderio V, Tirino V, Paino F. Cytoplasmic Interactions between the Glucocorticoid Receptor and HDAC2 Regulate Osteocalcin Expression in VPA-Treated MSCs. Cells. 2019; 8(3):217. https://doi.org/10.3390/cells8030217
Chicago/Turabian StyleLa Noce, Marcella, Luigi Mele, Luigi Laino, Giovanni Iolascon, Gorizio Pieretti, Gianpaolo Papaccio, Vincenzo Desiderio, Virginia Tirino, and Francesca Paino. 2019. "Cytoplasmic Interactions between the Glucocorticoid Receptor and HDAC2 Regulate Osteocalcin Expression in VPA-Treated MSCs" Cells 8, no. 3: 217. https://doi.org/10.3390/cells8030217