Necrotic Bone Fluid Suppresses Energy Metabolism of Porcine PBMC-Derived Macrophages In Vitro
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Design
2.2. PBMC Isolation and Culture
2.3. Western Blot
2.4. ELISA
2.5. FACS Sample Preparation
2.6. RNA Isolation and RT-qPCR
2.7. Bulk RNA Sequencing and Analysis
2.8. Seahorse Mito Stress Test
2.9. Metabolic Flux Anlysis
2.10. MitoSOXTM Red Live Cell Imaging and Quantification
2.11. Phagocytosis Assay
2.12. Statistical Analysis
3. Results
3.1. Cellular Cytokine Expression and Secretion
3.2. Cell Surface Marker Expression
3.3. Pro- and Anti-Inflammatory Gene Expression
3.4. Transcriptomic Analysis
3.5. Mitochondrial Respiration and Glycolysis Profile
3.6. Metabolic Flux Profile
3.7. Mitochondrial Superoxide (ROS) Production
3.8. Macrophage Phagocytic Activity
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kim, H.K. Legg-Calve-Perthes disease. J. Am. Acad. Orthop. Surg. 2010, 18, 676–686. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.K.; Herring, J.A. Pathophysiology, classifications, and natural history of Perthes disease. Orthop. Clin. N. Am. 2011, 42, 285–295. [Google Scholar] [CrossRef]
- Kamiya, N.; Yamaguchi, R.; Adapala, N.S.; Chen, E.; Neal, D.; Jack, O.; Thoveson, A.; Gudmundsson, P.; Brabham, C.; Aruwajoye, O.; et al. Legg-Calve-Perthes disease produces chronic hip synovitis and elevation of interleukin-6 in the synovial fluid. J. Bone Miner. Res. 2015, 30, 1009–1013. [Google Scholar] [CrossRef]
- Maruyama, M.; Rhee, C.; Utsunomiya, T.; Zhang, N.; Ueno, M.; Yao, Z.; Goodman, S.B. Modulation of the Inflammatory Response and Bone Healing. Front. Endocrinol. 2020, 11, 386. [Google Scholar] [CrossRef]
- Adapala, N.S.; Yamaguchi, R.; Phipps, M.; Aruwajoye, O.; Kim, H.K.W. Necrotic Bone Stimulates Proinflammatory Responses in Macrophages through the Activation of Toll-Like Receptor 4. Am. J. Pathol. 2016, 186, 2987–2999. [Google Scholar] [CrossRef]
- Kim, H.K.W.; Park, M.S.; Alves do Monte, F.; Gokani, V.; Aruwajoye, O.O.; Ren, Y. Minimally Invasive Necrotic Bone Washing Improves Bone Healing After Femoral Head Ischemic Osteonecrosis: An Experimental Investigation in Immature Pigs. J. Bone Jt. Surg. Am. 2021, 103, 1193–1202. [Google Scholar] [CrossRef]
- Deng, Z.; Ren, Y.; Park, M.S.; Kim, H.K.W. Damage associated molecular patterns in necrotic femoral head inhibit osteogenesis and promote fibrogenesis of mesenchymal stem cells. Bone 2022, 154, 116215. [Google Scholar] [CrossRef]
- Zheng, J.; Yao, Z.; Xue, L.; Wang, D.; Tan, Z. The role of immune cells in modulating chronic inflammation and osteonecrosis. Front. Immunol. 2022, 13, 1064245. [Google Scholar] [CrossRef] [PubMed]
- Chen, G.Y.; Nunez, G. Sterile inflammation: Sensing and reacting to damage. Nat. Rev. Immunol. 2010, 10, 826–837. [Google Scholar] [CrossRef] [PubMed]
- Gong, T.; Liu, L.; Jiang, W.; Zhou, R. DAMP-sensing receptors in sterile inflammation and inflammatory diseases. Nat. Rev. Immunol. 2020, 20, 95–112. [Google Scholar] [CrossRef]
- Kono, H.; Rock, K.L. How dying cells alert the immune system to danger. Nat. Rev. Immunol. 2008, 8, 279–289. [Google Scholar] [CrossRef]
- Sinder, B.P.; Pettit, A.R.; McCauley, L.K. Macrophages: Their Emerging Roles in Bone. J. Bone Miner. Res. 2015, 30, 2140–2149. [Google Scholar] [CrossRef] [PubMed]
- Shapouri-Moghaddam, A.; Mohammadian, S.; Vazini, H.; Taghadosi, M.; Esmaeili, S.A.; Mardani, F.; Seifi, B.; Mohammadi, A.; Afshari, J.T.; Sahebkar, A. Macrophage plasticity, polarization, and function in health and disease. J. Cell Physiol. 2018, 233, 6425–6440. [Google Scholar] [CrossRef]
- Wynn, T.A.; Chawla, A.; Pollard, J.W. Macrophage biology in development, homeostasis and disease. Nature 2013, 496, 445–455. [Google Scholar] [CrossRef]
- Franzoni, G.; Bonelli, P.; Graham, S.P.; Anfossi, A.G.; Dei Giudici, S.; Pilo, G.; Pittau, M.; Nicolussi, P.; Oggiano, A. Comparative phenotypic and functional analyses of the effects of autologous plasma and recombinant human macrophage-colony stimulating factor (M-CSF) on porcine monocyte to macrophage differentiation. Vet. Immunol. Immunopathol. 2017, 187, 80–88. [Google Scholar] [CrossRef]
- Franzoni, G.; Mura, L.; Razzuoli, E.; De Ciucis, C.G.; Fruscione, F.; Dell’Anno, F.; Zinellu, S.; Carta, T.; Anfossi, A.G.; Dei Giudici, S.; et al. Heterogeneity of Phenotypic and Functional Changes to Porcine Monocyte-Derived Macrophages Triggered by Diverse Polarizing Factors In Vitro. Int. J. Mol. Sci. 2023, 24, 4671. [Google Scholar] [CrossRef]
- Goodman, S.B.; Maruyama, M. Inflammation, Bone Healing and Osteonecrosis: From Bedside to Bench. J. Inflamm. Res. 2020, 13, 913–923. [Google Scholar] [CrossRef] [PubMed]
- Tan, Z.; Wang, Y.; Chen, Y.; Liu, Y.; Ma, M.; Ma, Z.; Wang, C.; Zeng, H.; Xue, L.; Yue, C.; et al. The Dynamic Feature of Macrophage M1/M2 Imbalance Facilitates the Progression of Non-Traumatic Osteonecrosis of the Femoral Head. Front. Bioeng. Biotechnol. 2022, 10, 912133. [Google Scholar] [CrossRef] [PubMed]
- Claes, L.; Recknagel, S.; Ignatius, A. Fracture healing under healthy and inflammatory conditions. Nat. Rev. Rheumatol. 2012, 8, 133–143. [Google Scholar] [CrossRef]
- Pajarinen, J.; Lin, T.; Gibon, E.; Kohno, Y.; Maruyama, M.; Nathan, K.; Lu, L.; Yao, Z.; Goodman, S.B. Mesenchymal stem cell-macrophage crosstalk and bone healing. Biomaterials 2019, 196, 80–89. [Google Scholar] [CrossRef]
- Schlundt, C.; El Khassawna, T.; Serra, A.; Dienelt, A.; Wendler, S.; Schell, H.; van Rooijen, N.; Radbruch, A.; Lucius, R.; Hartmann, S.; et al. Macrophages in bone fracture healing: Their essential role in endochondral ossification. Bone 2018, 106, 78–89. [Google Scholar] [CrossRef]
- Hu, K.; Shang, Z.; Yang, X.; Zhang, Y.; Cao, L. Macrophage Polarization and the Regulation of Bone Immunity in Bone Homeostasis. J. Inflamm. Res. 2023, 16, 3563–3580. [Google Scholar] [CrossRef] [PubMed]
- Liu, K.; Luo, X.; Lv, Z.Y.; Zhang, Y.J.; Meng, Z.; Li, J.; Meng, C.X.; Qiang, H.F.; Hou, C.Y.; Hou, L.; et al. Macrophage-Derived Exosomes Promote Bone Mesenchymal Stem Cells Towards Osteoblastic Fate Through microRNA-21a-5p. Front. Bioeng. Biotechnol. 2021, 9, 801432. [Google Scholar] [CrossRef] [PubMed]
- O’Neill, L.A.; Pearce, E.J. Immunometabolism governs dendritic cell and macrophage function. J. Exp. Med. 2016, 213, 15–23. [Google Scholar] [CrossRef] [PubMed]
- Van den Bossche, J.; O’Neill, L.A.; Menon, D. Macrophage Immunometabolism: Where Are We (Going)? Trends Immunol. 2017, 38, 395–406. [Google Scholar] [CrossRef]
- Mills, E.L.; Kelly, B.; Logan, A.; Costa, A.S.H.; Varma, M.; Bryant, C.E.; Tourlomousis, P.; Dabritz, J.H.M.; Gottlieb, E.; Latorre, I.; et al. Succinate Dehydrogenase Supports Metabolic Repurposing of Mitochondria to Drive Inflammatory Macrophages. Cell 2016, 167, 457–470.e413. [Google Scholar] [CrossRef]
- Russell, D.G.; Huang, L.; VanderVen, B.C. Immunometabolism at the interface between macrophages and pathogens. Nat. Rev. Immunol. 2019, 19, 291–304. [Google Scholar] [CrossRef]
- Deng, Z.; Kim, H.K.W.; Hernandez, P.A.; Ren, Y. Fat Phagocytosis Promotes Anti-Inflammatory Responses of Macrophages in a Mouse Model of Osteonecrosis. Cells 2024, 13, 1227. [Google Scholar] [CrossRef]
- Ren, Y.; Deng, Z.; Gokani, V.; Kutschke, M.; Mitchell, T.W.; Aruwajoye, O.; Adapala, N.S.; Kamiya, N.; Abu-Amer, Y.; Kim, H.K. Anti-Interleukin-6 Therapy Decreases Hip Synovitis and Bone Resorption and Increases Bone Formation Following Ischemic Osteonecrosis of the Femoral Head. J. Bone Miner. Res. 2021, 36, 357–368. [Google Scholar] [CrossRef]
- Vicas, R.M.; Bodog, F.D.; Fugaru, F.O.; Grosu, F.; Badea, O.; Lazar, L.; Cevei, M.L.; Nistor-Cseppento, C.D.; Beiusanu, G.C.; Holt, G.; et al. Histopathological and immunohistochemical aspects of bone tissue in aseptic necrosis of the femoral head. Rom. J. Morphol. Embryol. 2020, 61, 1249–1258. [Google Scholar] [CrossRef]
- Kim, H.K. Pathophysiology and new strategies for the treatment of Legg-Calve-Perthes disease. J. Bone Jt. Surg. Am. 2012, 94, 659–669. [Google Scholar] [CrossRef]
- Gao, J.; Scheenstra, M.R.; van Dijk, A.; Veldhuizen, E.J.A.; Haagsman, H.P. A new and efficient culture method for porcine bone marrow-derived M1- and M2-polarized macrophages. Vet. Immunol. Immunopathol. 2018, 200, 7–15. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.W.; Chien, M.S.; Chang, N.Y.; Chen, T.H.; Wu, C.M.; Huang, C.; Lee, W.C.; Hsuan, S.L. Mechanisms underlying Actinobacillus pleuropneumoniae exotoxin ApxI induced expression of IL-1beta, IL-8 and TNF-alpha in porcine alveolar macrophages. Vet. Res. 2011, 42, 25. [Google Scholar] [CrossRef]
- Nygard, A.B.; Jorgensen, C.B.; Cirera, S.; Fredholm, M. Selection of reference genes for gene expression studies in pig tissues using SYBR green qPCR. BMC Mol. Biol. 2007, 8, 67. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Zhang, X.; Du, M.; Li, Y.; Pan, H.; Yan, Y.; Yang, Y. Atypical classical swine fever infection changes interleukin Gene expression in pigs. Isr. J. Vet. Med. 2014, 69, 221–227. [Google Scholar]
- Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef]
- Liao, Y.; Wang, J.; Jaehnig, E.J.; Shi, Z.; Zhang, B. WebGestalt 2019: Gene set analysis toolkit with revamped UIs and APIs. Nucleic Acids Res. 2019, 47, W199–W205. [Google Scholar] [CrossRef]
- Zhang, B.; Kirov, S.; Snoddy, J. WebGestalt: An integrated system for exploring gene sets in various biological contexts. Nucleic Acids Res. 2005, 33, W741–W748. [Google Scholar] [CrossRef]
- Zhou, Y.; Zhou, B.; Pache, L.; Chang, M.; Khodabakhshi, A.H.; Tanaseichuk, O.; Benner, C.; Chanda, S.K. Metascape provides a biologist-oriented resource for the analysis of systems-level datasets. Nat. Commun. 2019, 10, 1523. [Google Scholar] [CrossRef]
- Bezwada, D.; Perelli, L.; Lesner, N.P.; Cai, L.; Brooks, B.; Wu, Z.; Vu, H.S.; Sondhi, V.; Cassidy, D.L.; Kasitinon, S.; et al. Mitochondrial complex I promotes kidney cancer metastasis. Nature 2024, 633, 923–931. [Google Scholar] [CrossRef] [PubMed]
- Faubert, B.; Li, K.Y.; Cai, L.; Hensley, C.T.; Kim, J.; Zacharias, L.G.; Yang, C.; Do, Q.N.; Doucette, S.; Burguete, D.; et al. Lactate Metabolism in Human Lung Tumors. Cell 2017, 171, 358–371.e359. [Google Scholar] [CrossRef]
- Alvarez, B.; Revilla, C.; Poderoso, T.; Ezquerra, A.; Dominguez, J. Porcine Macrophage Markers and Populations: An Update. Cells 2023, 12, 2103. [Google Scholar] [CrossRef]
- Piriou-Guzylack, L.; Salmon, H. Membrane markers of the immune cells in swine: An update. Vet. Res. 2008, 39, 54. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Yuan, T.; Zhang, A.; Yang, P.; He, L.; Long, K.; Tang, C.; Chen, L.; Li, M.; Lu, L. Transcriptomic Establishment of Pig Macrophage Polarization Signatures. Curr. Issues Mol. Biol. 2023, 45, 2338–2350. [Google Scholar] [CrossRef]
- Gdynia, G.; Sauer, S.W.; Kopitz, J.; Fuchs, D.; Duglova, K.; Ruppert, T.; Miller, M.; Pahl, J.; Cerwenka, A.; Enders, M.; et al. The HMGB1 protein induces a metabolic type of tumour cell death by blocking aerobic respiration. Nat. Commun. 2016, 7, 10764. [Google Scholar] [CrossRef] [PubMed]
- Serbulea, V.; Upchurch, C.M.; Ahern, K.W.; Bories, G.; Voigt, P.; DeWeese, D.E.; Meher, A.K.; Harris, T.E.; Leitinger, N. Macrophages sensing oxidized DAMPs reprogram their metabolism to support redox homeostasis and inflammation through a TLR2-Syk-ceramide dependent mechanism. Mol. Metab. 2018, 7, 23–34. [Google Scholar] [CrossRef] [PubMed]
- O’Neill, L.A.; Kishton, R.J.; Rathmell, J. A guide to immunometabolism for immunologists. Nat. Rev. Immunol. 2016, 16, 553–565. [Google Scholar] [CrossRef]
- Jha, A.K.; Huang, S.C.; Sergushichev, A.; Lampropoulou, V.; Ivanova, Y.; Loginicheva, E.; Chmielewski, K.; Stewart, K.M.; Ashall, J.; Everts, B.; et al. Network integration of parallel metabolic and transcriptional data reveals metabolic modules that regulate macrophage polarization. Immunity 2015, 42, 419–430. [Google Scholar] [CrossRef]
- Viola, A.; Munari, F.; Sanchez-Rodriguez, R.; Scolaro, T.; Castegna, A. The Metabolic Signature of Macrophage Responses. Front. Immunol. 2019, 10, 1462. [Google Scholar] [CrossRef]
- Ip, W.K.E.; Hoshi, N.; Shouval, D.S.; Snapper, S.; Medzhitov, R. Anti-inflammatory effect of IL-10 mediated by metabolic reprogramming of macrophages. Science 2017, 356, 513–519. [Google Scholar] [CrossRef]
- Van den Bossche, J.; Baardman, J.; Otto, N.A.; van der Velden, S.; Neele, A.E.; van den Berg, S.M.; Luque-Martin, R.; Chen, H.J.; Boshuizen, M.C.; Ahmed, M.; et al. Mitochondrial Dysfunction Prevents Repolarization of Inflammatory Macrophages. Cell Rep. 2016, 17, 684–696. [Google Scholar] [CrossRef]
- Vijayan, V.; Pradhan, P.; Braud, L.; Fuchs, H.R.; Gueler, F.; Motterlini, R.; Foresti, R.; Immenschuh, S. Human and murine macrophages exhibit differential metabolic responses to lipopolysaccharide—A divergent role for glycolysis. Redox Biol. 2019, 22, 101147. [Google Scholar] [CrossRef]
- Izquierdo, E.; Cuevas, V.D.; Fernandez-Arroyo, S.; Riera-Borrull, M.; Orta-Zavalza, E.; Joven, J.; Rial, E.; Corbi, A.L.; Escribese, M.M. Reshaping of Human Macrophage Polarization through Modulation of Glucose Catabolic Pathways. J. Immunol. 2015, 195, 2442–2451. [Google Scholar] [CrossRef] [PubMed]
- Gonzalez, M.A.; Lu, D.R.; Yousefi, M.; Kroll, A.; Lo, C.H.; Briseno, C.G.; Watson, J.E.V.; Novitskiy, S.; Arias, V.; Zhou, H.; et al. Phagocytosis increases an oxidative metabolic and immune suppressive signature in tumor macrophages. J. Exp. Med. 2023, 220, e20221472. [Google Scholar] [CrossRef] [PubMed]
- Loi, F.; Cordova, L.A.; Pajarinen, J.; Lin, T.H.; Yao, Z.; Goodman, S.B. Inflammation, fracture and bone repair. Bone 2016, 86, 119–130. [Google Scholar] [CrossRef] [PubMed]
- Orecchioni, M.; Ghosheh, Y.; Pramod, A.B.; Ley, K. Macrophage Polarization: Different Gene Signatures in M1(LPS+) vs. Classically and M2(LPS-) vs. Alternatively Activated Macrophages. Front. Immunol. 2019, 10, 1084. [Google Scholar] [CrossRef]











| Gene Name | Sequence | |
|---|---|---|
| IL1β | Forward: | ACCAGGGTTACTGACTATGGC |
| Reverse: | GTTGAGGCAGGAAGGAGAT | |
| IL8 | Forward: | AGCCACGGAGAATGGGTTTT |
| Reverse: | TGGGTGCAGAAGAAGGTTGT | |
| TNFα | Forward: | CGCATCGCCGTCTCCTACCA |
| Reverse: | GCCCAGATTCAGCAAAGTCCAGAT | |
| Arg1 | Forward: | AGCCCAGCAAGTTCATACCT |
| Reverse: | ACCAGCCAGCTTTGTCAGAT | |
| CD163 | Forward: | TGCCATGAAGAGGGTAGGGT |
| Reverse: | GTCTTGCCATTCACCAAGCG | |
| CD206 (Mrc1) | Forward: | AGCATCAGGAAAGGACCAGC |
| Reverse: | GGCAACCGGAAGGAAAGAGA | |
| GAPDH | Forward: | ACACTCACTCTTCTACCTTTG |
| Reverse: | CAAATTCATTGTCGTACCAG | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Deng, Z.; Nguyen, C.P.; Liu, Y.; Kim, J.; Mathews, T.P.; Ma, C.; Ren, Y.; Xing, C.; Kim, H.K.W. Necrotic Bone Fluid Suppresses Energy Metabolism of Porcine PBMC-Derived Macrophages In Vitro. Cells 2025, 14, 1258. https://doi.org/10.3390/cells14161258
Deng Z, Nguyen CP, Liu Y, Kim J, Mathews TP, Ma C, Ren Y, Xing C, Kim HKW. Necrotic Bone Fluid Suppresses Energy Metabolism of Porcine PBMC-Derived Macrophages In Vitro. Cells. 2025; 14(16):1258. https://doi.org/10.3390/cells14161258
Chicago/Turabian StyleDeng, Zhuo, Chau P. Nguyen, Yan Liu, Jaehyup Kim, Thomas P. Mathews, Chi Ma, Yinshi Ren, Chao Xing, and Harry K. W. Kim. 2025. "Necrotic Bone Fluid Suppresses Energy Metabolism of Porcine PBMC-Derived Macrophages In Vitro" Cells 14, no. 16: 1258. https://doi.org/10.3390/cells14161258
APA StyleDeng, Z., Nguyen, C. P., Liu, Y., Kim, J., Mathews, T. P., Ma, C., Ren, Y., Xing, C., & Kim, H. K. W. (2025). Necrotic Bone Fluid Suppresses Energy Metabolism of Porcine PBMC-Derived Macrophages In Vitro. Cells, 14(16), 1258. https://doi.org/10.3390/cells14161258

