Glycation Leads to Increased Invasion of Glioblastoma Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Lines and Cultivation
2.2. MGO Treatment
2.3. XTT Assay
2.4. Cell Microscopy
2.5. Glycation and Immunoblotting
2.6. mRNA Isolation and qPCR
2.7. Real-Time Cell Analysis
2.8. Statistical Analysis
3. Results
3.1. High MGO Concentrations Lead to Decreased Cell Vitality
3.2. High MGO Concentration Induce Altered Cell Morphology and Cell Death
3.3. MGO Treatment Increases Glycation in a Concentration-Dependent Manner
3.4. Chemotactic Cell Migration after MGO Treatment
3.5. MGO Increases Invasion of GBM Cell Lines
3.6. MGO Has No Effect on the Adhesion of Glioma Cell Lines or hA
3.7. Glycation Alters the Expression of ECM Components
4. Discussion
Limitations
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Stathis, A. Treatment Overview. Handbook of Lymphoma; Springer: Cham, Switzerland, 2016; Volume 20, pp. 33–44. [Google Scholar] [CrossRef] [Scilit]
- Cuddapah, V.A.; Robel, S.; Watkins, S.; Sontheimer, H. REVIEWS A Neurocentric Perspective on Glioma Invasion. Nat. Rev. Neurosci. 2014, 15, 455–465. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yue, B. Biology of the Extracellular Matrix an Overview. J. Glaucoma 2014, 23, S20–S23. [Google Scholar] [CrossRef] [Scilit]
- So, J.S.; Kim, H.; Han, K.S. Mechanisms of Invasion in Glioblastoma: Extracellular Matrix, Ca2+ Signaling, and Glutamate. Front. Cell. Neurosci. 2021, 15, 663092. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Joester, A.; Faissner, A. The Structure and Function of Tenascins in the Nervous System. Matrix Biol. 2001, 20, 13–22. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Demuth, T.; Berens, M.E. Molecular Mechanisms of Glioma Cell Migration and Invasion. J. Neurooncol. 2004, 70, 217–228. [Google Scholar] [CrossRef] [Scilit]
- Zhang, H.; Kelly, G.; Zeritlo, C.; Jaworski, D.M.; Hockfield, S. Expression of a Cleaved Brain-Specific Extracellular Matrix Protein Mediates Glioma Cell Invasion in Vivo. J. Neurosci. 1998, 18, 2370–2376. [Google Scholar] [CrossRef] [Scilit]
- Mentlein, R.; Hattermann, K.; Held-Feindt, J. Lost in Disruption: Role of Proteases in Glioma Invasion and Progression. Biochim. Biophys. Acta 2012, 1825, 178–185. [Google Scholar] [CrossRef] [Scilit]
- Wolfenson, H.; Lavelin, I.; Geiger, B. Dynamic Regulation of the Structure and Functions of Integrin Adhesions. Dev. Cell 2013, 24, 447–458. [Google Scholar] [CrossRef] [Scilit]
- Dongre, A.; Weinberg, R.A. New Insights into the Mechanisms of Epithelial–Mesenchymal Transition and Implications for Cancer. Nat. Rev. Mol. Cell Biol. 2019, 20, 69–84. [Google Scholar] [CrossRef] [Scilit]
- Iwadate, Y. Epithelial-Mesenchymal Transition in Glioblastoma Progression. Oncol. Lett. 2016, 11, 1615–1620. [Google Scholar] [CrossRef] [Scilit]
- Nguyen, T.T.T.; Shang, E.; Shu, C.; Kim, S.; Mela, A.; Humala, N.; Mahajan, A.; Yang, H.W.; Akman, H.O.; Quinzii, C.M.; et al. Aurora Kinase A Inhibition Reverses the Warburg Effect and Elicits Unique Metabolic Vulnerabilities in Glioblastoma. Nat. Commun. 2021, 12, 5203. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Allaman, I.; Bélanger, M.; Magistretti, P.J. Methylglyoxal, the Dark Side of Glycolysis. Front. Neurosci. 2015, 9, 23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Manuscript, A. Spinothalamic Tract. Encycl. Neurosci. 2008, 324, 3828. [Google Scholar] [CrossRef] [Scilit]
- Schalkwijk, C.G.; Stehouwer, C.D.A. Methylglyoxal, a Highly Reactive Dicarbonyl Compound, in Diabetes, Its Vascular Complications, and Other Age-Related Diseases. Physiol. Rev. 2020, 100, 407–461. [Google Scholar] [CrossRef] [Scilit]
- Verzijl, N.; DeGroot, J. Crosslinking by Advanced Glycation End Products Increases the Stiffness of the Collagen Network in Human Articular Cartilage. Arthritis Rheum. 2002, 46, 114–123. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kass, D.A. Getting Better without Age: New Insights into the Diabetic Heart. Circ. Res. 2003, 92, 704–706. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chaplen, F.W.R. Incidence and Potential Implications of the Toxic Metabolite Methylglyoxal in Cell Culture: A Review. Cytotechnology 1998, 26, 173–183. [Google Scholar] [CrossRef] [Scilit]
- Hanssen, N.M.J.; Westerink, J.; Scheijen, J.L.J.M.; Van Der Graaf, Y.; Stehouwer, C.D.A.; Schalkwijk, C.G. Higher Plasma Methylglyoxal Levels Are Associated with Incident Cardiovascular Disease and Mortality in Individuals with Type 2 Diabetes. Diabetes Care 2018, 41, 1689–1695. [Google Scholar] [CrossRef] [Scilit]
- Dariya, B.; Nagaraju, G.P. Advanced Glycation End Products in Diabetes, Cancer and Phytochemical Therapy. Drug Discov. Today 2020, 25, 1614–1623. [Google Scholar] [CrossRef] [Scilit]
- Muthyalaiah, Y.S.; Jonnalagadda, B.; John, C.M.; Arockiasamy, S. Impact of Advanced Glycation End Products (AGEs) and Its Receptor (RAGE) on Cancer Metabolic Signaling Pathways and Its Progression. Glycoconj. J. 2021, 38, 717–734. [Google Scholar] [CrossRef] [Scilit]
- Chiavarina, B.; Nokin, M.J.; Durieux, F.; Bianchi, E.; Turtoi, A.; Peulen, O.; Peixoto, P.; Irigaray, P.; Uchida, K.; Belpomme, D.; et al. Triple Negative Tumors Accumulate Significantly Less Methylglyoxal Specific Adducts than Other Human Breast Cancer Subtypes. Oncotarget 2014, 5, 5472–5482. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Selke, P.; Rosenstock, P.; Bork, K.; Strauss, C.; Horstkorte, R.; Scheer, M. Glycation of Benign Meningioma Cells Leads to Increased Invasion. Biol. Chem. 2021, 402, 849–859. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Scheer, M.; Bork, K.; Simon, F.; Nagasundaram, M.; Horstkorte, R.; Gnanapragassam, V.S. Glycation Leads to Increased Polysialylation and Promotes the Metastatic Potential of Neuroblastoma Cells. Cells 2020, 9, 868. [Google Scholar] [CrossRef] [Scilit]
- van Heijst, J.W.J.; Niessen, H.W.M.; Musters, R.J.; van Hinsbergh, V.W.M.; Hoekman, K.; Schalkwijk, C.G. Argpyrimidine-Modified Heat Shock Protein 27 in Human Non-Small Cell Lung Cancer: A Possible Mechanism for Evasion of Apoptosis. Cancer Lett. 2006, 241, 309–319. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, J.A.; Wu, C.H.; Yen, G.C. Methylglyoxal Displays Colorectal Cancer-Promoting Properties in the Murine Models of Azoxymethane and CT26 Isografts. Free Radic. Biol. Med. 2018, 115, 436–446. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nokin, M.J.; Durieux, F.; Peixoto, P.; Chiavarina, B.; Peulen, O.; Blomme, A.; Turtoi, A.; Costanza, B.; Smargiasso, N.; Baiwir, D.; et al. Methylglyoxal, a Glycolysis Side-Product, Induces Hsp90 Glycation and YAP- Mediated Tumor Growth and Metastasis. Elife 2016, 5, e19375. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chiavarina, B.; Nokin, M.J.; Bellier, J.; Durieux, F.; Bletard, N.; Sherer, F.; Lovinfosse, P.; Peulen, O.; Verset, L.; Dehon, R.; et al. Methylglyoxal-Mediated Stress Correlates with High Metabolic Activity and Promotes Tumor Growth in Colorectal Cancer. Int. J. Mol. Sci. 2017, 18, 213. [Google Scholar] [CrossRef] [Scilit]
- Sharaf, H.; Matou-Nasri, S.; Wang, Q.; Rabhan, Z.; Al-Eidi, H.; Al Abdulrahman, A.; Ahmed, N. Advanced Glycation Endproducts Increase Proliferation, Migration and Invasion of the Breast Cancer Cell Line MDA-MB-231. Biochim. Biophys. Acta-Mol. Basis Dis. 2015, 1852, 429–441. [Google Scholar] [CrossRef] [Scilit]
- Suh, Y.J.; Hall, M.S.; Huang, Y.L.; Moon, S.Y.; Song, W.; Ma, M.; Bonassar, L.J.; Segall, J.E.; Wu, M. Glycation of Collagen Matrices Promotes Breast Tumor Cell Invasion. Integr. Biol. 2019, 11, 109–117. [Google Scholar] [CrossRef] [Scilit]
- Leone, A.; Nigro, C.; Nicolò, A.; Prevenzano, I.; Formisano, P.; Beguinot, F.; Miele, C. The Dual-Role of Methylglyoxal in Tumor Progression—Novel Therapeutic Approaches. Front. Oncol. 2021, 11, 645686. [Google Scholar] [CrossRef] [Scilit]
- Bellahcène, A.; Nokin, M.J.; Castronovo, V.; Schalkwijk, C. Methylglyoxal-Derived Stress: An Emerging Biological Factor Involved in the Onset and Progression of Cancer. Semin. Cancer Biol. 2018, 49, 64–74. [Google Scholar] [CrossRef] [Scilit]
- Nokin, M.; Durieux, F.; Bellier, J.; Peulen, O.; Uchida, K.; David, A.; Cochrane, J.R.; Hutton, C.A.; Castronovo, V.; Bellahcène, A. Hormetic Potential of Methylglyoxal, a Side-Product of Glycolysis, in Switching Tumours from Growth to Death. Sci. Rep. 2017, 7, 11722. [Google Scholar] [CrossRef] [Scilit]
- Lee, H.K.; Seo, I.A.; Suh, D.J.; Lee, H.J.; Park, H.T. A Novel Mechanism of Methylglyoxal Cytotoxicity in Neuroglial Cells. J. Neurochem. 2009, 108, 273–284. [Google Scholar] [CrossRef] [Scilit]
- Oya-Ito Tomoko, T.; Naito, Y.; Takagi, T.; Handa, O.; Matsui, H.; Yamada, M.; Shima, K.; Yoshikawa, T. Heat-Shock Protein 27 (Hsp27) as a Target of Methylglyoxal in Gastrointestinal Cancer. Biochim. Biophys. Acta-Mol. Basis Dis. 2011, 1812, 769–781. [Google Scholar] [CrossRef] [Scilit]
- Antognelli, C.; Moretti, S.; Frosini, R.; Puxeddu, E.; Sidoni, A.; Talesa, V.N. Methylglyoxal Acts as a Tumor-Promoting Factor in Anaplastic Thyroid Cancer. Cells 2019, 8, 547. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pan, S.; Guan, Y.; Ma, Y.; Cui, Q.; Tang, Z.; Li, J.; Zu, C.; Zhang, Y.; Zhu, L.; Jiang, J.; et al. Advanced Glycation End Products Correlate with Breast Cancer Metastasis by Activating RAGE/TLR4 Signaling. BMJ Open Diabetes Res. Care 2022, 10, e002697. [Google Scholar] [CrossRef] [Scilit]
- Liang, H. Advanced Glycation End Products Induce Proliferation, Invasion and Epithelial-Mesenchymal Transition of Human SW480 Colon Cancer Cells through the PI3K/AKT Signaling Pathway. Oncol. Lett. 2020, 19, 3215–3222. [Google Scholar] [CrossRef] [Scilit]
- Loarca, L.; Sassi-gaha, S.; Artlett, C.M. Two α-Dicarbonyls Downregulate Migration, Invasion, and Adhesion of Liver Cancer Cells in a P53-Dependent Manner. Dig. Liver Dis. 2013, 45, 938–946. [Google Scholar] [CrossRef] [Scilit]
- Their, J.P. Epithelial-Mesenchymal Transitions in Tumor Progression. Nat. Rev. Cancer 2002, 2, 442–454. [Google Scholar] [CrossRef] [Scilit]
- Howng, S.L.; Wu, C.H.; Cheng, T.S.; Sy, W.D.; Lin, P.C.K.; Wang, C.; Hong, Y.R. Differential Expression of Wnt Genes, β-Catenin and E-Cadherin in Human Brain Tumors. Cancer Lett. 2002, 183, 95–101. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lewis-Tuffin, L.J.; Rodriguez, F.; Giannini, C.; Scheithauer, B.; Necela, B.M.; Sarkaria, J.N.; Anastasiadis, P.Z. Misregulated E-Cadherin Expression Associated with an Aggressive Brain Tumor Phenotype. PLoS ONE 2010, 5, e13665. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cao, Z.Q.; Wang, Z.; Leng, P. Aberrant N-Cadherin Expression in Cancer. Biomed. Pharmacother. 2019, 118, 109320. [Google Scholar] [CrossRef] [Scilit]
- Velpula, K.K.; Rehman, A.A.; Chelluboina, B.; Dasari, V.R.; Gondi, C.S.; Rao, J.S.; Veeravalli, K.K. Glioma Stem Cell Invasion through Regulation of the Interconnected ERK, Integrin A6 and N-Cadherin Signaling Pathway. Cell. Signal. 2012, 24, 2076–2084. [Google Scholar] [CrossRef] [Scilit]
- Camand, E.; Peglion, F.; Osmani, N.; Sanson, M.; Etienne-Manneville, S. N-Cadherin Expression Level Modulates Integrin-Mediated Polarity and Strongly Impacts on the Speed and Directionality of Glial Cell Migration. J. Cell Sci. 2012, 125, 844–857. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Senbanjo, L.T.; Chellaiah, M.A. CD44: A Multifunctional Cell Surface Adhesion Receptor Is a Regulator of Progression and Metastasis of Cancer Cells. Front. Cell Dev. Biol. 2017, 5, 18. [Google Scholar] [CrossRef] [Scilit]
- Ivanova, E.L.; Costa, B.; Eisemann, T.; Lohr, S.; Boskovic, P.; Eichwald, V.; Meckler, J.; Jugold, M.; Orian-Rousseau, V.; Peterziel, H.; et al. CD44 Expressed by Myeloid Cells Promotes Glioma Invasion. Front. Oncol. 2022, 12, 3957. [Google Scholar] [CrossRef] [Scilit]
- Lu, R.; Wu, C.; Guo, L.; Liu, Y.; Mo, W.; Wang, H.; Ding, J.; Wong, E.T.; Yu, M. The Role of Brevican in Glioma: Promoting Tumor Cell Motility in Vitro and in Vivo. BMC Cancer 2012, 12, 607. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xia, S.; Lal, B.; Tung, B.; Wang, S.; Goodwin, C.R.; Laterra, J. Tumor Microenvironment Tenascin-C Promotes Glioblastoma Invasion and Negatively Regulates Tumor Proliferation. Neuro-Oncology 2016, 18, 507–517. [Google Scholar] [CrossRef] [Scilit]
- Viapiano, M.S.; Hockfield, S.; Matthews, R.T. BEHAB/Brevican Requires ADAMTS-Mediated Proteolytic Cleavage to Promote Glioma Invasion. J. Neurooncol. 2008, 88, 261–272. [Google Scholar] [CrossRef] [Scilit]
- Sarkar, S.; Zemp, F.J.; Senger, D.; Robbins, S.M.; Yong, V.W. ADAM-9 is a novel mediator of tenascin-C-stimulated invasiveness of brain tumor–initiating cells. Neuro-Oncology 2015, 17, 1095–1105. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vollmann-Zwerenz, A.; Leidgens, V.; Feliciello, G.; Klein, C.A.; Hau, P. Tumor Cell Invasion in Glioblastoma. Int. J. Mol. Sci. 2020, 21, 1932. [Google Scholar] [CrossRef] [Scilit]
- Ang, L.C.; Zhang, Y.; Cao, L.; Yang, B.L.; Young, B.; Kiani, C.; Lee, V.; Allan, K.; Yang, B.B. Versican Enhances Locomotion of Astrocytoma Cells and Reduces Cell Adhesion through Its G1 Domain. J. Neuropathol. Exp. Neurol. 1999, 58, 597–605. [Google Scholar] [CrossRef] [Scilit]
- Joseph, J.V.; Magaut, C.R.; Storevik, S.; Geraldo, L.H.; Mathivet, T.; Latif, A.; Rudewicz, J.; Guyon, J.; Gambaretti, M.; Haukas, F.; et al. TGF-β promotes microtube formation in glioblastoma through Thrombospondin 1. Neuro-Oncology 2022, 24, 541–553. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, Q.; Xue, Y.; Liu, J.; Xi, Z.; Li, Z.; Liu, Y.; Gregory, B.; Oliver, G. Fibronectin Promotes the Malignancy of Glioma Stem-Like Cells Via Modulation of Cell Adhesion, Differentiation, Proliferation and Chemoresistance. Front. Mol. Neurosci. 2018, 11, 130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mohiuddin, E.; Wakimoto, H. Extracellular Matrix in Glioblastoma: Opportunities for Emerging Therapeutic Approaches. Am. J. Cancer Res. 2021, 11, 3742–3754. [Google Scholar] [PubMed]
- Bellier, J.; Nokin, M.; Caprasse, M.; Peulen, O.; Bellier, J.; Nokin, M.; Caprasse, M.; Tiamiou, A.; Blomme, A.; Scheijen, J.L.; et al. Methylglyoxal Scavengers Resensitize KRAS-Mutated Colorectal Tumors to Cetuximab. Cell Rep. 2020, 30, 1400–1416. [Google Scholar] [CrossRef] [Scilit]









| Antibody | Species | Dilution | Dilution Buffer | Manufacture |
|---|---|---|---|---|
| Anti-Carboxymethyl Lysine antibody (ab125145) | Mouse IgG | 1:1000 | 5% MP in TBS-T | Abcam (Cambridge, UK) |
| Anti-E Cadherin antibody Intercellular Junction Marker (ab15148) | Rabbit IgG | 1:1000 | 5% BSA in TBS-T | |
| Recombinant Anti-N Cadherin antibody (ab245117) | Rabbit IgG | 1:1000 | 5% BSA in TBS-T | |
| GAPDH (14C10) (#2118) | Rabbit IgG | 1:1000 | 5% BSA in TBS-T | Cell Signaling Technology Inc. (Danvers, MA, USA) |
| Anti-rabbit IgG, HRP-linked Antibody (#7074) | Goat | 1:1000 | 2% MP in TBS-T | |
| Anti-mouse IgG, HRP-linked Antibody (#7076) | Horse | 1:1000 | 2% MP in TBS-T |
| Gene Name (Protein) | Oligo Sequence 5′ to 3′ (Forward, Reverse) | Annealing Temperature (°C) | Product Length | Reference Sequence | Species |
|---|---|---|---|---|---|
| CD44 | ACGCTTCAGCCTACTGCAAA GGTCCTGCTTTCCTTCGTGT | 60 | 279 | NM_000610.4 | Homo sapiens |
| MMP2 | ATGTCGCCCCCAAAACGG CCGCATGGTCTCGATGGTAT | 60 | 176 | NM_004530.6 | Homo sapiens |
| MMP9 | TCTATGGTCCTCGCCCTGAA CATCGTCCACCGGACTCAAA | 60 | 219 | NM_004994.3 | Homo sapiens |
| MMP14 | GGAGAATTTTGTGCTGCCCG TTGGTTATTCCTCACCCGCC | 60 | 247 | NM_004995.4 | Homo sapiens |
| Versican | GCAGAAACTGCATCACCCAG TCCCAGGGCTTCTTGGTACT | 60 | 227 | NM_004385.5 | Homo sapiens |
| Brevican | ATGGTGGGACATGCTTGGAG GAAGTCCTGTTCCTCGGGTG | 60 | 233 | NM_021948.5 | Homo sapiens |
| Tensacin C | GAAACTGCAGAGACCAGCCT CAGGGGCTTGTTCAGTGGAT | 60 | 244 | NM_001410991.1 | Homo sapiens |
| Fibronectin | GGTCCGGGACTCAATCCAAA GACAGAGTTGCCCACGGTAA | 60 | 279 | NM_212482.4 | Homo sapiens |
| Integrin β1 | AGCAACGGACAGATCTGCAA GCTGGGGTAATTTGTCCCGA | 60 | 241 | NM_002211.4 | Homo sapiens |
| Integrin α3 | GGCCTGCCAAGCTAATGAGA GACTCACCCATCACTGTCCC | 60 | 273 | NM_002204.4 | Homo sapiens |
| Integrin α5 | TCTCAGTGGAGTTTTACCGGC CCGAGAGCCTTTGCTGTCAA | 60 | 173 | NM_002205.5 | Homo sapiens |
| Fibulin 3 | TGTATGTGCCCCCAGGGATA ATTGACTGGGGCAGTTCTCG | 60 | 227 | XM_005264205.5 | Homo sapiens |
| Vimentin | GGAGTCCACTGAGTACCGGA AGGTGACGAGCCATTTCCTC | 60 | 198 | NM_003380.5 | Homo sapiens |
| Snail (SNAI1) | CTCGAAAGGCCTTCAACTGC GACATTCGGGAGAAGGTCCG | 60 | 298 | NM_005985.4 | Homo sapiens |
| Slug (SNAI2) | TTTCAGACCCCCATGCCATT GAAAAAGGCTTCTCCCCCGT | 60 | 292 | NM_003068.5 | Homo sapiens |
| Thrombospondin 1 | ATCCTGGACTCGCTGTAGGT AGAAAGGCCCGAGTATCCCT | 60 | 209 | NM_003246.4 | Homo sapiens |
| GAPDH | TCGTGGAAGGACTCATGACC TTCCCGTTCAGCTCAGGGAT | 60 | 172 | NM_002046.7 | Homo sapiens |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Schildhauer, P.; Selke, P.; Scheller, C.; Strauss, C.; Horstkorte, R.; Leisz, S.; Scheer, M. Glycation Leads to Increased Invasion of Glioblastoma Cells. Cells 2023, 12, 1219. https://doi.org/10.3390/cells12091219
Schildhauer P, Selke P, Scheller C, Strauss C, Horstkorte R, Leisz S, Scheer M. Glycation Leads to Increased Invasion of Glioblastoma Cells. Cells. 2023; 12(9):1219. https://doi.org/10.3390/cells12091219
Chicago/Turabian StyleSchildhauer, Paola, Philipp Selke, Christian Scheller, Christian Strauss, Rüdiger Horstkorte, Sandra Leisz, and Maximilian Scheer. 2023. "Glycation Leads to Increased Invasion of Glioblastoma Cells" Cells 12, no. 9: 1219. https://doi.org/10.3390/cells12091219
APA StyleSchildhauer, P., Selke, P., Scheller, C., Strauss, C., Horstkorte, R., Leisz, S., & Scheer, M. (2023). Glycation Leads to Increased Invasion of Glioblastoma Cells. Cells, 12(9), 1219. https://doi.org/10.3390/cells12091219

