N-Terminal Tails of Histones H2A and H2B Differentially Affect Transcription by RNA Polymerase II In Vitro
Abstract
1. Introduction
2. Materials and Methods
2.1. DNA Templates and Plasmids
5′-ACCCCAGGGACTTGAAGTAATAAGGACGGAGGGCCTCTTTCAACATCGATGCACGG[T-Cy5]GGTTAG-3′,
2.2. Protein Purification
2.3. Nucleosome Assembly
2.4. In Vitro Transcription Assay
2.5. Hydroxyl Radical Footprinting
2.6. Single-Particle Förster Resonance Energy Transfer Microscopy
2.7. Single-Particle Fluorescence Intensity Analysis
3. Results
3.1. H2A N-Tail Mediates Internucleosomal Interactions
3.2. Histone H2B N-Tail Stabilizes the Nucleosome Structure
3.3. Nucleosomal Pausing at the +(11–15) Region Is Partially Relieved by Deletion of H2B N-Tail
3.4. Deletion of H2B N-Tail Does Not Inhibit hFACT Action during Pol II Transcription through a Nucleosome
3.5. A Model: The Roles of H2B and H2A N-Tails during Pol II Transcription
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Luger, K.; Mader, A.W.; Richmond, R.K.; Sargent, D.F.; Richmond, T.J. Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature 1997, 389, 251–260. [Google Scholar] [CrossRef] [Scilit]
- Hansen, J.C. Conformational dynamics of the chromatin fiber in solution: Determinants, mechanisms, and functions. Annu. Rev. Biophys. Biomol. Struct. 2002, 31, 361–392. [Google Scholar] [CrossRef] [Scilit]
- Belmont, A.S.; Bruce, K. Visualization of G1 chromosomes: A folded, twisted, supercoiled chromonema model of interphase chromatid structure. J. Cell Biol. 1994, 127, 287–302. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kireeva, M.L.; Walter, W.; Tchernajenko, V.; Bondarenko, V.; Kashlev, M.; Studitsky, V.M. Nucleosome remodeling induced by RNA polymerase II: Loss of the H2A/H2B dimer during transcription. Mol. Cell 2002, 9, 541–552. [Google Scholar] [CrossRef] [Scilit]
- Kulaeva, O.I.; Gaykalova, D.A.; Pestov, N.A.; Golovastov, V.V.; Vassylyev, D.G.; Artsimovitch, I.; Studitsky, V.M. Mechanism of chromatin remodeling and recovery during passage of RNA polymerase II. Nat. Struct. Mol. Biol. 2009, 16, 1272–1278. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Teves, S.S.; Weber, C.M.; Henikoff, S. Transcribing through the nucleosome. Trends Biochem. Sci. 2014, 39, 577–586. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Studitsky, V.M.; Nizovtseva, E.V.; Shaytan, A.K.; Luse, D.S. Nucleosomal Barrier to Transcription: Structural Determinants and Changes in Chromatin Structure. Biochem. Mol. Biol. J. 2016, 2, 8. [Google Scholar] [CrossRef] [Scilit]
- Ramachandran, S.; Ahmad, K.; Henikoff, S. Transcription and Remodeling Produce Asymmetrically Unwrapped Nucleosomal Intermediates. Mol. Cell 2017, 68, 1038–1053.e4. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chang, H.W.; Kulaeva, O.I.; Shaytan, A.K.; Kibanov, M.; Kuznedelov, K.; Severinov, K.V.; Kirpichnikov, M.P.; Clark, D.J.; Studitsky, V.M. Analysis of the mechanism of nucleosome survival during transcription. Nucleic Acids Res. 2014, 42, 1619–1627. [Google Scholar] [CrossRef] [Scilit]
- Kulaeva, O.I.; Hsieh, F.K.; Chang, H.W.; Luse, D.S.; Studitsky, V.M. Mechanism of transcription through a nucleosome by RNA polymerase II. Biochim. Biophys. Acta 2013, 1829, 76–83. [Google Scholar] [CrossRef] [Scilit]
- Bondarenko, V.A.; Steele, L.M.; Ujvari, A.; Gaykalova, D.A.; Kulaeva, O.I.; Polikanov, Y.S.; Luse, D.S.; Studitsky, V.M. Nucleosomes can form a polar barrier to transcript elongation by RNA polymerase II. Mol. Cell 2006, 24, 469–479. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hsieh, F.K.; Kulaeva, O.I.; Patel, S.S.; Dyer, P.N.; Luger, K.; Reinberg, D.; Studitsky, V.M. Histone chaperone FACT action during transcription through chromatin by RNA polymerase II. Proc. Natl. Acad. Sci. USA 2013, 110, 7654–7659. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fischle, W.; Wang, Y.; Allis, C.D. Histone and chromatin cross-talk. Curr. Opin. Cell Biol. 2003, 15, 172–183. [Google Scholar] [CrossRef] [Scilit]
- Ujvari, A.; Hsieh, F.K.; Luse, S.W.; Studitsky, V.M.; Luse, D.S. Histone N-terminal tails interfere with nucleosome traversal by RNA polymerase II. J. Biol. Chem. 2008, 283, 32236–32243. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pepenella, S.; Murphy, K.J.; Hayes, J.J. Intra- and inter-nucleosome interactions of the core histone tail domains in higher-order chromatin structure. Chromosoma 2014, 123, 3–13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tessarz, P.; Kouzarides, T. Histone core modifications regulating nucleosome structure and dynamics. Nat. Rev. Mol. Cell Biol. 2014, 15, 703–708. [Google Scholar] [CrossRef] [Scilit]
- Parra, M.A.; Kerr, D.; Fahy, D.; Pouchnik, D.J.; Wyrick, J.J. Deciphering the roles of the histone H2B N-terminal domain in genome-wide transcription. Mol. Cell. Biol. 2006, 26, 3842–3852. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kyriss, M.N.; Jin, Y.; Gallegos, I.J.; Sanford, J.A.; Wyrick, J.J. Novel functional residues in the core domain of histone H2B regulate yeast gene expression and silencing and affect the response to DNA damage. Mol. Cell. Biol. 2010, 30, 3503–3518. [Google Scholar] [CrossRef] [Scilit]
- Rodriguez, Y.; Duan, M.; Wyrick, J.J.; Smerdon, M.J. A cassette of basic amino acids in histone H2B regulates nucleosome dynamics and access to DNA damage. J. Biol. Chem. 2018, 293, 7376–7386. [Google Scholar] [CrossRef] [Scilit]
- Mao, P.; Kyriss, M.N.; Hodges, A.J.; Duan, M.; Morris, R.T.; Lavine, M.D.; Topping, T.B.; Gloss, L.M.; Wyrick, J.J. A basic domain in the histone H2B N-terminal tail is important for nucleosome assembly by FACT. Nucleic Acids Res. 2016, 44, 9142–9152. [Google Scholar] [CrossRef] [Scilit]
- Orphanides, G.; LeRoy, G.; Chang, C.H.; Luse, D.S.; Reinberg, D. FACT, a factor that facilitates transcript elongation through nucleosomes. Cell 1998, 92, 105–116. [Google Scholar] [CrossRef] [Scilit]
- Belotserkovskaya, R.; Oh, S.; Bondarenko, V.A.; Orphanides, G.; Studitsky, V.M.; Reinberg, D. FACT facilitates transcription-dependent nucleosome alteration. Science 2003, 301, 1090–1093. [Google Scholar] [CrossRef] [Scilit]
- Wittmeyer, J.; Formosa, T. The Saccharomyces cerevisiae DNA polymerase alpha catalytic subunit interacts with Cdc68/Spt16 and with Pob3, a protein similar to an HMG1-like protein. Mol. Cell. Biol. 1997, 17, 4178–4190. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kurat, C.F.; Yeeles, J.T.P.; Patel, H.; Early, A.; Diffley, J.F.X. Chromatin Controls DNA Replication Origin Selection, Lagging-Strand Synthesis, and Replication Fork Rates. Mol. Cell 2017, 65, 117–130. [Google Scholar] [CrossRef] [Scilit]
- Gurova, K.; Chang, H.W.; Valieva, M.E.; Sandlesh, P.; Studitsky, V.M. Structure and function of the histone chaperone FACT—Resolving FACTual issues. Biochim. Biophys. Acta 2018, 1861, 892–904. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Charles Richard, J.L.; Shukla, M.S.; Menoni, H.; Ouararhni, K.; Lone, I.N.; Roulland, Y.; Papin, C.; Ben Simon, E.; Kundu, T.; Hamiche, A.; et al. FACT Assists Base Excision Repair by Boosting the Remodeling Activity of RSC. PLoS Genet. 2016, 12, e1006221. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Valieva, M.E.; Armeev, G.A.; Kudryashova, K.S.; Gerasimova, N.S.; Shaytan, A.K.; Kulaeva, O.I.; McCullough, L.L.; Formosa, T.; Georgiev, P.G.; Kirpichnikov, M.P.; et al. Large-scale ATP-independent nucleosome unfolding by a histone chaperone. Nat. Struct. Mol. Biol. 2016, 23, 1111–1116. [Google Scholar] [CrossRef] [Scilit]
- Gasparian, A.V.; Burkhart, C.A.; Purmal, A.A.; Brodsky, L.; Pal, M.; Saranadasa, M.; Bosykh, D.A.; Commane, M.; Guryanova, O.A.; Pal, S.; et al. Curaxins: Anticancer compounds that simultaneously suppress NF-kappaB and activate p53 by targeting FACT. Sci. Transl. Med. 2011, 3, 95ra74. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hsieh, F.K.; Kulaeva, O.I.; Orlovsky, I.V.; Studitsky, V.M. FACT in Cell Differentiation and Carcinogenesis. Oncotarget 2011, 2, 830–832. [Google Scholar] [CrossRef] [Scilit]
- Maluchenko, N.V.; Chang, H.W.; Kozinova, M.T.; Valieva, M.E.; Gerasimova, N.S.; Kitashov, A.V.; Kirpichnikov, M.P.; Georgiev, P.G.; Studitsky, V.M. Inhibiting the pro-tumor and transcription factor FACT: Mechanisms. Molekuliarnaia Biologiia 2016, 50, 599–610. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Formosa, T.; Winston, F. The role of FACT in managing chromatin: Disruption, assembly, or repair? Nucleic Acids Res. 2020, 48, 11929–11941. [Google Scholar] [CrossRef] [Scilit]
- Farnung, L.; Ochmann, M.; Engeholm, M.; Cramer, P. Structural basis of nucleosome transcription mediated by Chd1 and FACT. Nat. Struct. Mol. Biol. 2021, 28, 382–387. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Zhou, K.; Zhang, N.; Wei, H.; Tan, Y.Z.; Zhang, Z.; Carragher, B.; Potter, C.S.; D’Arcy, S.; Luger, K. FACT caught in the act of manipulating the nucleosome. Nature 2020, 577, 426–431. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mayanagi, K.; Saikusa, K.; Miyazaki, N.; Akashi, S.; Iwasaki, K.; Nishimura, Y.; Morikawa, K.; Tsunaka, Y. Structural visualization of key steps in nucleosome reorganization by human FACT. Sci. Rep. 2019, 9, 10183. [Google Scholar] [CrossRef] [Scilit]
- Hondele, M.; Stuwe, T.; Hassler, M.; Halbach, F.; Bowman, A.; Zhang, E.T.; Nijmeijer, B.; Kotthoff, C.; Rybin, V.; Amlacher, S.; et al. Structural basis of histone H2A-H2B recognition by the essential chaperone FACT. Nature 2013, 499, 111–114. [Google Scholar] [CrossRef] [Scilit]
- Kemble, D.J.; McCullough, L.L.; Whitby, F.G.; Formosa, T.; Hill, C.P. FACT Disrupts Nucleosome Structure by Binding H2A-H2B with Conserved Peptide Motifs. Mol. Cell 2015, 60, 294–306. [Google Scholar] [CrossRef] [Scilit]
- Tsunaka, Y.; Fujiwara, Y.; Oyama, T.; Hirose, S.; Morikawa, K. Integrated molecular mechanism directing nucleosome reorganization by human FACT. Genes Dev. 2016, 30, 673–686. [Google Scholar] [CrossRef] [Scilit]
- Winkler, D.D.; Luger, K. The histone chaperone FACT: Structural insights and mechanisms for nucleosome reorganization. J. Biol. Chem. 2011, 286, 18369–18374. [Google Scholar] [CrossRef] [Scilit]
- Winkler, D.D.; Muthurajan, U.M.; Hieb, A.R.; Luger, K. Histone chaperone FACT coordinates nucleosome interaction through multiple synergistic binding events. J. Biol. Chem. 2011, 286, 41883–41892. [Google Scholar] [CrossRef] [Scilit]
- Thastrom, A.; Lowary, P.T.; Widlund, H.R.; Cao, H.; Kubista, M.; Widom, J. Sequence motifs and free energies of selected natural and non-natural nucleosome positioning DNA sequences. J. Mol. Biol. 1999, 288, 213–229. [Google Scholar] [CrossRef] [Scilit]
- Gaykalova, D.A.; Kulaeva, O.I.; Bondarenko, V.A.; Studitsky, V.M. Preparation and analysis of uniquely positioned mononucleosomes. Methods Mol. Biol. 2009, 523, 109–123. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dyer, P.N.; Edayathumangalam, R.S.; White, C.L.; Bao, Y.; Chakravarthy, S.; Muthurajan, U.M.; Luger, K. Reconstitution of nucleosome core particles from recombinant histones and DNA. Methods Enzymol. 2004, 375, 23–44. [Google Scholar] [CrossRef] [Scilit]
- Kireeva, M.L.; Komissarova, N.; Waugh, D.S.; Kashlev, M. The 8-nucleotide-long RNA:DNA hybrid is a primary stability determinant of the RNA polymerase II elongation complex. J. Biol. Chem. 2000, 275, 6530–6536. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Walter, W.; Kireeva, M.L.; Studitsky, V.M.; Kashlev, M. Bacterial polymerase and yeast polymerase II use similar mechanisms for transcription through nucleosomes. J. Biol. Chem. 2003, 278, 36148–36156. [Google Scholar] [CrossRef] [Scilit]
- Simon, R.H.; Felsenfeld, G. A new procedure for purifying histone pairs H2A + H2B and H3 + H4 from chromatin using hydroxylapatite. Nucleic Acids Res. 1979, 6, 689–696. [Google Scholar] [CrossRef] [Scilit]
- von Holt, C.; Brandt, W.F.; Greyling, H.J.; Lindsey, G.G.; Retief, J.D.; Rodrigues, J.D.; Schwager, S.; Sewell, B.T. Isolation and characterization of histones. Methods Enzymol. 1989, 170, 431–523. [Google Scholar] [CrossRef] [Scilit]
- Tullius, T.D.; Dombroski, B.A.; Churchill, M.E.; Kam, L. Hydroxyl radical footprinting: A high-resolution method for mapping protein-DNA contacts. Methods Enzymol. 1987, 155, 537–558. [Google Scholar]
- Feofanov, A.V.; Andreeva, T.V.; Studitsky, V.M.; Kirpichnikov, M.P. Reversibility of Structural Rearrangements in Mononucleosomes Induced by Ionic Strength. Moscow Univ. Biol. Sci. Bull. 2018, 73, 157–161. [Google Scholar] [CrossRef] [Scilit]
- Kudryashova, K.S.; Chertkov, O.V.; Nikitin, D.V.; Pestov, N.A.; Kulaeva, O.I.; Efremenko, A.V.; Solonin, A.S.; Kirpichnikov, M.P.; Studitsky, V.M.; Feofanov, A.V. Preparation of mononucleosomal templates for analysis of transcription with RNA polymerase using spFRET. Methods Mol. Biol. 2015, 1288, 395–412. [Google Scholar] [CrossRef] [Scilit]
- Ingargiola, A.; Lerner, E.; Chung, S.; Weiss, S.; Michalet, X. FRETBursts: An Open Source Toolkit for Analysis of Freely-Diffusing Single-Molecule FRET. PLoS ONE 2016, 11, e0160716. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xin, H.; Takahata, S.; Blanksma, M.; McCullough, L.; Stillman, D.J.; Formosa, T. yFACT induces global accessibility of nucleosomal DNA without H2A-H2B displacement. Mol. Cell 2009, 35, 365–376. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.; Tokuda, J.M.; Topping, T.; Meisburger, S.P.; Pabit, S.A.; Gloss, L.M.; Pollack, L. Asymmetric unwrapping of nucleosomal DNA propagates asymmetric opening and dissociation of the histone core. Proc. Natl. Acad. Sci. USA 2017, 114, 334–339. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gansen, A.; Felekyan, S.; Kuhnemuth, R.; Lehmann, K.; Toth, K.; Seidel, C.A.M.; Langowski, J. High precision FRET studies reveal reversible transitions in nucleosomes between microseconds and minutes. Nat. Commun. 2018, 9, 4628. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hsieh, F.K.; Fisher, M.; Ujvari, A.; Studitsky, V.M.; Luse, D.S. Histone Sin mutations promote nucleosome traversal and histone displacement by RNA polymerase II. EMBO Rep. 2010, 11, 705–710. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chang, H.W.; Valieva, M.E.; Safina, A.; Chereji, R.V.; Wang, J.; Kulaeva, O.I.; Morozov, A.V.; Kirpichnikov, M.P.; Feofanov, A.V.; Gurova, K.V.; et al. Mechanism of FACT removal from transcribed genes by anticancer drugs curaxins. Sci. Adv. 2018, 4, eaav2131. [Google Scholar] [CrossRef] [Scilit]
- Iwasaki, W.; Miya, Y.; Horikoshi, N.; Osakabe, A.; Taguchi, H.; Tachiwana, H.; Shibata, T.; Kagawa, W.; Kurumizaka, H. Contribution of histone N-terminal tails to the structure and stability of nucleosomes. FEBS Open Bio 2013, 3, 363–369. [Google Scholar] [CrossRef] [Scilit]
- Hall, M.A.; Shundrovsky, A.; Bai, L.; Fulbright, R.M.; Lis, J.T.; Wang, M.D. High-resolution dynamic mapping of histone-DNA interactions in a nucleosome. Nat. Struct. Mol. Biol. 2009, 16, 124–129. [Google Scholar] [CrossRef] [Scilit]
- Kireeva, M.L.; Hancock, B.; Cremona, G.H.; Walter, W.; Studitsky, V.M.; Kashlev, M. Nature of the nucleosomal barrier to RNA polymerase II. Mol. Cell 2005, 18, 97–108. [Google Scholar] [CrossRef] [Scilit]
- Gaykalova, D.A.; Kulaeva, O.I.; Volokh, O.; Shaytan, A.K.; Hsieh, F.K.; Kirpichnikov, M.P.; Sokolova, O.S.; Studitsky, V.M. Structural analysis of nucleosomal barrier to transcription. Proc. Natl. Acad. Sci. USA 2015, 112, E5787–E5795. [Google Scholar] [CrossRef] [Scilit]
- Kan, P.Y.; Caterino, T.L.; Hayes, J.J. The H4 tail domain participates in intra- and internucleosome interactions with protein and DNA during folding and oligomerization of nucleosome arrays. Mol. Cell. Biol. 2009, 29, 538–546. [Google Scholar] [CrossRef] [Scilit]
- Bilokapic, S.; Strauss, M.; Halic, M. Cryo-EM of nucleosome core particle interactions in trans. Sci. Rep. 2018, 8, 7046. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zheng, S.; Crickard, J.B.; Srikanth, A.; Reese, J.C. A highly conserved region within H2B is important for FACT to act on nucleosomes. Mol. Cell. Biol. 2014, 34, 303–314. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hondele, M.; Ladurner, A.G. Catch me if you can: How the histone chaperone FACT capitalizes on nucleosome breathing. Nucleus 2013, 4, 443–449. [Google Scholar] [CrossRef] [Scilit]






Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chang, H.-W.; Feofanov, A.V.; Lyubitelev, A.V.; Armeev, G.A.; Kotova, E.Y.; Hsieh, F.-K.; Kirpichnikov, M.P.; Shaytan, A.K.; Studitsky, V.M. N-Terminal Tails of Histones H2A and H2B Differentially Affect Transcription by RNA Polymerase II In Vitro. Cells 2022, 11, 2475. https://doi.org/10.3390/cells11162475
Chang H-W, Feofanov AV, Lyubitelev AV, Armeev GA, Kotova EY, Hsieh F-K, Kirpichnikov MP, Shaytan AK, Studitsky VM. N-Terminal Tails of Histones H2A and H2B Differentially Affect Transcription by RNA Polymerase II In Vitro. Cells. 2022; 11(16):2475. https://doi.org/10.3390/cells11162475
Chicago/Turabian StyleChang, Han-Wen, Alexey V. Feofanov, Alexander V. Lyubitelev, Grigory A. Armeev, Elena Y. Kotova, Fu-Kai Hsieh, Mikhail P. Kirpichnikov, Alexey K. Shaytan, and Vasily M. Studitsky. 2022. "N-Terminal Tails of Histones H2A and H2B Differentially Affect Transcription by RNA Polymerase II In Vitro" Cells 11, no. 16: 2475. https://doi.org/10.3390/cells11162475
APA StyleChang, H.-W., Feofanov, A. V., Lyubitelev, A. V., Armeev, G. A., Kotova, E. Y., Hsieh, F.-K., Kirpichnikov, M. P., Shaytan, A. K., & Studitsky, V. M. (2022). N-Terminal Tails of Histones H2A and H2B Differentially Affect Transcription by RNA Polymerase II In Vitro. Cells, 11(16), 2475. https://doi.org/10.3390/cells11162475

