Nutritional, Functional, and Morphological Insights into a Heritage Durum Wheat of Campania

Abstract

Ancient wheat cultivars play a crucial role in human and animal nutrition and health, serving as rich sources of bioactive compounds, essential nutrients, and functional metabolites. This study investigated Triticum turgidum subsp. durum (cv. Saragolla), an ancient wheat variety from the Campania region of Southern Italy, to comprehensively characterize its morphological, functional, and nutritional attributes in support of germplasm conservation and valorization. Standard AOAC methods, including HPLC profiling, antioxidant assays, and quantification of total polyphenols and flavonoids, were applied to characterize the grain’s composition. The results revealed a balanced distribution of proteins, lipids, dietary fibers, and carbohydrates, that defines the nutritional and functional quality of Saragolla grains. Microscopic investigation through SEM coupled with EDX analysis provided high-resolution visualization of caryopsis morphology, ultrastructure, and mineral distribution, confirming its distinct varietal characteristics. Additionally, SSR marker analysis revealed notable genetic diversity within the Saragolla germplasm, identifying loci associated with key agronomic traits, including kernel weight, grain number, and stress tolerance parameters essential for future breeding programs. Overall, this integrated assessment highlights Saragolla as a valuable heritage wheat and a strategic genetic resource for breeding durum cultivars with enhanced nutritional quality, technological performance, and resilience to environmental stress.

1. Introduction

Durum wheat (Triticum turgidum L. subsp. durum) is one of the most widely cultivated cereal crops worldwide, with production predominantly concentrated in the Mediterranean region. It represents a fundamental pillar of the Mediterranean diet, providing the primary raw material for staple foods such as pasta, couscous, and a variety of traditional leavened and unleavened breads [1]. As a major component of the human diet, wheat and its derived products supply essential macronutrients, including carbohydrates and proteins, as well as dietary fiber and a broad spectrum of bioactive compounds with recognized health-promoting effects [2]. Epidemiological evidence has linked regular wheat consumption to a reduced risk of chronic diseases, including type 2 diabetes, cardiovascular disorders, and certain types of cancer [3,4,5].

Since the advent of the Green Revolution in the 1960s, the widespread adoption of modern, high-yielding durum wheat cultivars has largely replaced traditional and ancient varieties, owing to their enhanced productivity and agronomic uniformity. While this transition has contributed significantly to global food security, it has also led to a progressive erosion of genetic diversity and, in some cases, to a reduction in nutritional and qualitative traits. These concerns have renewed scientific interest in autochthonous and traditional wheat genotypes as valuable reservoirs of genetic variation and potential sources of improved nutritional and functional properties.

Recent research highlights the growing relevance of ancient grains due to their superior nutritional profiles, high genetic diversity, and strong adaptation to low-input and stress-prone environments. Studies on species such as einkorn, emmer, spelt, kamut, and traditional durum landraces show enhanced levels of bioactive compounds, valuable technological properties, and alleles associated with resilience and quality traits. As a result, ancient grains have gained renewed scientific and commercial interest as sustainable alternatives to modern cultivars and as important reservoirs of genetic resources for future wheat improvement. These traditional varieties often exhibit enhanced tolerance to biotic and abiotic stresses, such as drought, salinity, pests, diseases, and nutrient-poor soils, and contain higher levels of unsaturated fatty acids, proteins, soluble fibers, vitamins, minerals, and phytochemicals compared to modern cultivars [6,7,8]. For example, einkorn (T. monococcum) and spelt (T. aestivum subsp. spelta) are particularly rich in fat-soluble vitamins (A, D, E, B complex) and bioavailable microelements such as Fe, P, Zn, Ca, and Mn [9,10].

Recent research highlights the growing relevance of ancient grains due to their superior nutritional profiles, high genetic diversity, and strong adaptation to low-input and stress-prone environments. Studies on species such as einkorn, emmer, spelt, kamut, and traditional durum landraces show enhanced levels of bioactive compounds, valuable technological properties, and alleles associated with resilience and quality traits. As a result, ancient grains have gained renewed scientific and commercial interest as sustainable alternatives to modern cultivars and as important reservoirs of genetic resources for future wheat improvement.

Among the ancient wheat landraces endemic to Southern Italy, Triticum turgidum subsp. durum cv. Saragolla holds exceptional agronomic and cultural significance. Alongside Romanella and Risciola, Saragolla is regarded as a “historic grain” of the Sannio area, traditionally cultivated in the Campania region [11]. These landraces have never undergone modern breeding programs, thereby maintaining high genetic integrity and strong adaptation to local agroecological conditions. Saragolla is especially valued for producing semolina of excellent quality, although it is less suited to intensive farming systems. Durum wheat, however, is generally more susceptible to fungal diseases than common wheat (T. aestivum), particularly to Fusarium spp., which cause Fusarium Head Blight (FHB) and lead to mycotoxin contamination [12]. Despite this, the Southern Italian environment provides favorable conditions for durum wheat cultivation, yielding grains with high technological quality and relatively low Fusarium toxin content [12,13]. The renewed interest in Saragolla thus arises not only from its historical and nutritional value but also from its robustness, rusticity, and suitability for sustainable and organic agricultural systems [14,15,16].

Scientific data on Saragolla remain limited, particularly regarding its chemical composition, bioactive compound profile, and grain morphology. High-performance liquid chromatography (HPLC) has been extensively applied to quantify bioactives in modern wheat, but comparable data for ancient Southern Italian durum varieties are scarce. Similarly, Scanning Electron Microscopy (SEM) provides ultrastructural insights into the organization of starch granules and protein matrices within the endosperm [17]. Such microstructural features are directly linked to key technological and nutritional traits, including milling efficiency, dough rheology, cooking quality, and digestibility, making SEM an essential tool for evaluating both functional and industrial performance. Integrating biochemical profiling with ultrastructural analysis therefore offers a holistic understanding of grain functionality and potential quality improvement.

The distinctive morphological, functional, and nutritional characteristics of Saragolla may also reflect underlying genetic adaptations associated with yield stability, physiological efficiency, and stress tolerance. Recent advances in quantitative genetics and association mapping have identified genomic loci governing yield, stress resilience, and grain quality in durum wheat [18]. Correlating Saragolla’s phenotypic traits with these loci may elucidate the genetic basis of its superior performance and support its utilization as a germplasm resource in breeding programs that aim to integrate nutritional quality with agronomic resilience. As a locally adapted landrace, Saragolla represents a reservoir of stable alleles and potentially novel stress-response mechanisms. Its characterization through Simple Sequence Repeat (SSR) markers provides valuable insights into its genetic diversity, population structure, and marker–trait associations relevant for breeding programs focused on resilience and end-use quality.

This study offers the first in-depth characterization of Saragolla wheat cultivated in Campania (Southern Italy), combining nutritional, biochemical, morphological, and molecular analyses into a unified framework. Specifically, the objectives were to: (i) characterize its chemical and nutritional composition, with particular attention to bioactive compounds; (ii) evaluate its functional and antioxidant properties; (iii) conduct morphometric and ultrastructural analyses to define grain quality traits; and (iv) assess genetic diversity and potential marker–trait associations related to yield and stress adaptation. We hypothesize that the autochthonous Saragolla variety expresses a distinctive combination of nutritional, functional, morphological, and genetic traits that reflect long-term evolutionary adaptation to Mediterranean agro-environmental conditions. Such traits may represent valuable allelic resources for the genetic improvement of modern durum wheat. Accordingly, through a multidisciplinary analytical framework, this study aims to deliver an integrated characterization of the biochemical, ultrastructural, and phenotypic attributes of Saragolla, assess its agronomic potential and suitability for sustainable and resilient cultivation systems, and evaluate its contribution to enhancing the nutritional and technological performance of durum wheat for both human and animal consumption.

2. Materials and Methods

2.1. Plant Materials

The autochthonous Saragolla durum wheat was supplied by the farm “La Rufesa”, located in Montefalcone di Val Fortore (Campania region, Southern Italy; Province of Benevento; coordinates: 41°19′2″ N, 15°00′3″ E, at 893 m above sea level), covering a total area of approximately 93.66 hectares. The field soil is characterized by a clay–loam texture, with a slightly neutral to mildly alkaline pH (6.8–7.5), a moderate organic matter content (about 1.5–2.5%), and macronutrient levels (N, P, and K) typical of rainfed Mediterranean cereal-growing soils. The crop was grown during the 2023–2024 growing season, under organic management, without synthetic fertilizers or pesticides. The experimental field design involved randomized blocks with N = 6 independent biological replicates. The crop was cultivated under organic farming conditions, without the use of chemical treatments or fertilizers. Sowing was carried out in autumn, and manual harvesting took place over two consecutive days in June, to ensure uniform ripening across all cultivated plots. After harvesting, the grains (caryopses) were immediately placed in labeled paper bags and stored at room temperature, protected from light and humidity, until further analysis.

2.2. Sample Preparation

Durum wheat samples were immediately transported to the laboratory, where they were homogenized and ground using a Turmix T-25 Basic homogenizer (IKA, Staufen im Breisgau, Germany) to prepare them for chemical, nutritional, and functional analyses. Moisture content was determined before chemical analyses by weighing 2 g of ground sample and drying it at 65 °C for 5 min using a moisture analyzer (CrystalTherm, Gibertini Elettronica, Novate Milanese, MI, Italy). To limit random variability in seed traits, the following quantitative analyses were all based on 100 seeds collected from randomly selected plants. All determinations were performed in triplicate.

2.3. Mycotoxin Analysis

To assess the levels of mycotoxins in the raw material, the RIDASCREEN^® FAST test kit was employed. Commercial ELISA kits (RIDASCREEN^® FAST, R-Biopharm, Darmstadt, Germany) were used for the quantitative determination of aflatoxin B1, ochratoxin A, and deoxynivalenol (DON), according to the manufacturer’s instructions. This method is based on a competitive enzyme-linked immunosorbent assay (ELISA) and was used for the quantitative analysis of aflatoxin B1, ochratoxin A, and deoxynivalenol (DON). The results were evaluated for compliance with the maximum levels established by Commission Recommendation 2006/576/EC. The regulatory limits for durum wheat are: Aflatoxin B1: 2 ppb (µg/kg), DON: approximately 1750 ppb, Ochratoxin A: 5 ppb. The samples for analysis were prepared from six (N = 6) distinct biological replicates of wheat. Each extract was analyzed with three consecutive analytical replicates, and the final result was calculated as the average.

2.4. Nutritional Analysis

The proximate composition of durum wheat was determined in triplicate using standard AOAC methods (Association of Official Analytical Chemists, 2000) in combination with near-infrared spectroscopy (NIRS), performed with a NIR Systems 6500 instrument (Foss, Hillerød, Denmark). For analysis, 35 g of grains from each cultivar were ground into a fine powder using a Knifetec™ 1095 mill (Foss, Hillerød, Denmark). Moisture content, crude protein (Kjeldahl method), crude fat (solvent extraction), crude fiber, starch and ash were determined using standard methods (AOAC). The carbohydrate content was calculated by difference, by subtracting the sum of moisture, protein, fat, ash, and crude fiber contents from 100%.

2.5. Functional Analysis

2.5.1. MAE Extraction of Phenolic Compound

Durum wheat powder was extracted using the Microwave-Assisted Extraction (MAE) method, using a domestic microwave oven system (Samsung GE872T) [19,20], with slight modifications. Specifically, 1 g of feed was placed in contact with water as a solvent (leaching) for five minutes before irradiation and extraction was performed at 180,300, 600 W, respectively, for 4, 2, 1 min. The extract was centrifuged at 4500× g at 20 °C for 20 min and was filtered through a 0.22 µm membrane filter and stored at −20 °C until analysis [20]. The MAE parameters (power, time, and solvent) were optimized to maximize the release of polyphenols from the Triticum durum matrix (cell lysis), balancing high yield with the thermal stability of the compounds and reduced extraction times. The total phenolic compound was measured from three independent experiments and the final value reported represents the average of the analytical replicates.

2.5.2. Total Polyphenols Content

The total phenolic content (TPC) of the forage extract was determined using the Folin–Ciocalteu method, as described by Singleton and Rossi [21]. The assay was performed in duplicate, mixing 2000 µL of distilled water, 50 µL of diluted Folin–Ciocalteu reagent (1:2), 50 µL of filtered sample, and 100 µL of 20% sodium carbonate (Na₂CO₃). After incubation for 90 min at room temperature in the dark, absorbance was measured in duplicate at 760 nm using a Biomate 3 spectrophotometer. Total phenolic content was quantified based on a calibration curve constructed with gallic acid, one of the most abundant natural phenolic compounds. Standard solutions of gallic acid were prepared at concentrations ranging from 25 to 150 mg/L, and the curve was generated using six calibration points. Results were expressed as milligrams of gallic acid equivalents (GAE) per gram of dry extract (mg GAE/g DW), based on interpolation of sample absorbance values on the standard curve. Total phenolic content was quantified using gallic acid (≥98%, Sigma-Aldrich, St. Louis, MO, USA) as an external standard. The total polyphenol content was measured from three independent experiments and the final value reported represents the average of the analytical replicates.

2.5.3. Total Flavonoid Content

The total flavonoid content (TFC) was determined using the Dowd method, as dapted by Arvouet-Grand et al. [22]. Briefly, 2 mL of 2% aluminum chloride (AlCl₃) solution in methanol was mixed with 2 mL of the plant extract. After 10 min of incubation at room temperature, the absorbance was measured at 415 nm using a spectrophotometer. Readings were performed in duplicate, and a blank sample, consisting of 2 mL of the extract and 2 mL of methanol (without AlCl₃), was used as a reference. Quercetin (≥95% purity, Merck, Darmstadt, Germany) was used as the reference standard for flavonoid quantification. Absorbance values for each sample were interpolated against a five-point calibration curve (10–50 mg/L) prepared with quercetin. Results were expressed as milligrams of quercetin equivalents (QE) per gram of dry weight (mg QE/g DW) and were obtained from three independent experiments. The final value reported represents the average of the analytical replicates.

2.5.4. HPLC Analysis

The identification and quantification of phenolic compounds were performed using reversed-phase high-performance liquid chromatography (RP-HPLC) with an LC-4000 series system (JASCO, Tokyo, Japan) [23]. Analytical standards of phenolic compounds (gallic acid, catechin, ellagic acid, ferulic acid, syringic acid, vanillic acid, caffeic acid, and rutin; purity ≥ 95%) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Methanol and formic acid (HPLC grade) were obtained from Merck (Darmstadt, Germany). The system was equipped with a column oven (model CO-2060 Plus) set at 30 °C, a UV/Vis photo-diode array detector (model MD-2018 Plus), an intelligent fluorescence detector (model PF-2020 Plus), a liquid chromatography pump (model PU-2089 Plus), an auto-sampler (model AS-2059 Plus), and managed using the ChromNAV software 2.0 (JASCO, Tokyo, Japan). Chromatographic separation was achieved using a C18 Luna column (5 µm, 250 mm × 3.0 mm I.D., Phenomenex, Torrance, CA, USA), equipped with a matching guard cartridge. All solvents were filtered through a 0.45 µm membrane filter (Millipore Co., Bedford, MA, USA) before use. The mobile phase consisted of: Solvent A-0.5% formic acid in water (v/v = 99.5:0.5); Solvent B-methanol. The column temperature was maintained at 30 °C, with a flow rate of 0.8 mL/min. The injection volume was 20 µL for each sample. The gradient elution program was as follows: 0–6 min: 35% B; 6–9 min: 35–60% B; 9–14 min: 60–80% B. Each run was preceded by a 5 min column wash with 100% B, followed by a 10 min re-equilibration at the initial mobile phase composition. All samples were analyzed in duplicate to ensure reproducibility. UV detection was performed across the 200–380 nm range, with primary monitoring at 280 nm.

2.5.5. Antioxidant Activity

Antioxidant power of the wheat extract was determined using the DPPH method as reported in [24]. 2,2-Diphenyl-1-picrylhydrazyl (DPPH, ≥95% purity) was purchased from Sigma-Aldrich (St. Louis, MO, USA). 50 μL of wheat extract was added to the 2.45 mL radical solution (DPPH diluted in methanol to 0.004%). An equal solvent volume (50 μL) was used as a control. The solution was incubated in the dark for 30 min, and the absorbance was measured at 517 nm with a Biomate 3 spectrophotometer (Thermo Fisher Scientific Inc., Waltham, Massachusetts, USA). The antiradical activity was expressed as a percentage of inhibition (I%) of the sample (As) compared with the initial concentration of DPPH (Ac) according to the equation: I% = [(Ac − As)/Ac] × 100, where Ac is the absorbance of the control reaction (containing all reagents except the tested compound) and As is the absorbance of the compound. Antioxidant activity, expressed as a percentage of inhibition, was measured from three independent experiments, and the final value reported represents the average of the analytical replicates.

2.6. Observation of Wheat Pericarp Structure

2.6.1. Scanning Electron Microscopy Coupled with Energy-Dispersive X-Ray Spectroscopy (SEM-EDS)

Mature grains were manually de-husked to take out the caryopsis. Approximately one-quarter of both ends of each caryopsis was removed, and slight pressure was applied at the center with a razor blade to fracture it and obtain a solid circular cross-section exposing the entire inner surface (in situ condition) of the grain. The fractured caryopses, with the exposed ring facing upward, were mounted on aluminum stubs and coated with a thin gold film using a Q150R ES putter coater (Quorum Technologies, Kent, UK). The microstructure was then examined at various magnifications with a Zeiss EVO 15 HD VPSEM (Carl Zeiss AG, Oberkochen, Baden-Württemberg, Germany) operating at 15 kV accelerating voltage, equipped with an X-max 80 EDS detector (Oxford Instruments, Abingdon, Oxfordshire, UK) for qualitative microchemical analysis by energy-dispersive X-ray spectroscopy (EDS) (Oxford Instruments, Abingdon, UK).

2.6.2. Morphometric Analysis of Wheat Caryopses

To assess the morphometric traits of Saragolla durum wheat caryopses, high-resolution digital microscopy was utilized. Observations were conducted with a Dino-Lite digital microscope (AnMo Electronics Corporation, New Taipei City, Taiwan) featuring adjustable magnification from 20× to 220×, coaxial illumination, Flexible LED Control (FLC), and a 5.0-megapixel color CMOS sensor. Images were captured using DinoCapture 2.0 software, while quantitative morphometric measurements were obtained through subsequent image processing and analysis in ImageJ, version 1.54p.

2.7. Genetic Analysis

2.7.1. DNA Extraction

DNA extraction from wheat was initiated with a preliminary seed germination step. Seeds were placed in transparent plastic containers on a moist substrate (e.g., cotton) to promote uniform germination. Moisture levels were maintained consistently, and the containers were kept in a dark, warm environment at 20–25 °C. After 3–5 days, germination was evident with the emergence of young sprouts, indicating readiness for DNA isolation. The youngest tissues were carefully harvested, particularly the rootlets, which are rich in actively dividing cells and therefore provide high-quality genomic DNA. Approximately 1–2 g of fresh plant material was collected under conditions minimizing external contamination. The harvested tissue was transferred to test tubes and combined with a lysis buffer to initiate cell disruption and DNA release.

2.7.2. Amplification of Wheat DNA with PCR

The extracted DNA samples were amplified using polymerase chain reaction (PCR). Each reaction was carried out in a total volume of 25 µL, consisting of 12.5 µL of AccuPrime SuperMix, 1 µL of forward primer (200 nM), 1 µL of reverse primer (200 nM), and 4 µL of DNA (160 ng). The PCR products were analyzed by electrophoresis on a 1% agarose gel and visualized using a transilluminator. Positive PCR products were purified using the OMEGA E.Z.N.A. Gel Extraction Kit, designed to extract DNA from agarose gels and purify PCR products for sequencing. The primers used (

Table 1. Primers sequences used for quantitative real-time PCR analysis of SSR loci in wheat.

Primers	Forward	Reverse
Taglut_1A	GCAGACCTGTGTCATTGGTC	GATATAGTGGCAGCAGGATACG
Gwm268_1B	AGGGGATATGTTGTCACTCCA	TTATGTGATTGCGTASCGTACCC
Gwm369_3A	CTGCAGGCCATGATGATG	ACCGTGGGTGTTGTGAGC
Barc178_6B	GCGTATTAGCAAAACAGAAGTGAG	GCGACTAGTACGAACACCACAAAA
Gwm297_7B	ATCGTCACGTATTTTGCAATG	TGCGTAAGTCTAGCATTTTCTG

) for the amplification of SSR loci were as follows:

2.8. Statistical Analysis

Statistical analysis was carried out using GraphPad Prism version 8.0 for Windows and R Studio version 2025.08.0+356, subjecting the results obtained to a one-way analysis of variance (ANOVA) with Bonferroni’s post hoc test for the analysis of normally distributed data. The Kruskal−Wallis ANOVA nonparametric test followed by Dunn’s post hoc test, was adopted for the analysis of non-normally distributed data. Data are expressed as mean ± SEM from three independent experiments and a p-value < 0.05 was considered significant.

3. Results and Discussion

3.1. Nutritional Analysis

The nutritional quality of cereal grains is largely determined by their chemical composition, including moisture, protein, lipids, fiber, ash, and carbohydrates. In this study, the proximate composition of Saragolla, an ancient variety of durum wheat, was assessed. Parameters measured included moisture, dry matter, crude protein, crude fat, total dietary fiber, ash, starch, and carbohydrates. Results are reported in

Table 2. Chemical composition of Saragolla durum wheat on dry matter (DM%). Values are expressed as means.

Parameters	DM%
Moisture	11.59
Dry matter	88.41
Proteins	16.33
Lipids	2.04
Fibers	2.77
Ash	2.22
Starch	62.7
Carbohydrate	76.64

.

Protein is a crucial macronutrient for human and animal nutrition and a key determinant of grain quality. In this context, Saragolla grains exhibited a high protein content of 16.33%, which falls within the upper range typically reported for wheat grains (10–18% dry weight) and aligns with findings from previous studies on ancient wheats such as einkorn and spelt [25,26]. The ash content, an indicator of total mineral content, was also elevated (~2%), which is consistent with values observed in ancient wheat species and generally higher than in modern common wheat [27]. The higher ash and protein levels in Saragolla reflect its nutrient-rich profile. The starch content of Saragolla was measured at 62.7%, which is within the typical range for wheat (60–75%, according to Šramková et al. [28], though slightly lower than in modern cultivars. This lower starch concentration can be attributed to the higher accumulation of proteins and minerals, as also noted in other ancient grains. Total lipid content was relatively low (~2%), which is characteristic of cereal grains. Although lipids represent a minor component (typically 1–3%), they play a significant role in determining flour functionality and product texture. Due to their amphipathic nature, lipids can interact with both proteins and starch, influencing dough properties and digestibility. While research on lipid manipulation in crops like maize and soybean has been explored [29,30], similar studies in wheat remain limited. Furthermore, the Saragolla sample exhibited a total dietary fiber content of 2.77%, which falls within the expected range for durum wheat [31]. This value underscores the variety’s nutritional contribution, as dietary fiber plays a key role in supporting gastrointestinal function and reducing the risk of chronic metabolic and cardiovascular disorders [32,33].

Compared to modern wheat varieties, Saragolla and other ancient grains such as einkorn and spelt tend to exhibit higher levels of protein, ash, fat, and fiber, and lower carbohydrate and starch content [25,26,34]. Among these ancient wheats, and relative to the typical compositional ranges reported for durum wheat, Saragolla exhibits particularly favorable nutritional characteristics, suggesting a superior profile and supporting its potential application in functional foods and nutritionally optimized diets.

3.2. Functional Quality of the Caryopsis

3.2.1. Antioxidant Activity

To evaluate the efficiency of solvent systems in extracting antioxidant compounds from Saragolla, different solvents were tested, namely ethanol/water, methanol/water, and water alone. Hydroalcoholic solutions are commonly used in phytochemical extraction due to their ability to dissolve a wide polarity range of bioactive molecules, including both hydrophilic and lipophilic compounds [35,36]. The choice of solvent had a significant impact on both the qualitative profile and quantitative yield of antioxidant compounds extracted, as illustrated in Figure 1 and Supplementary Table S1). Among the tested conditions, ethanol/water (80:20 v/v) yielded the highest antioxidant activity, reaching a maximum radical scavenging capacity of 59.83 ± 0.32% (p < 0.05) in the dried Saragolla extract. In contrast, extraction with water alone resulted in the lowest activity, underscoring the limited efficiency of aqueous solvents in solubilizing polyphenolic antioxidants.

These results align with previous findings [37,38], which demonstrated the superior performance of methanol and ethanol in extracting phenolic compounds from various plant matrices. The high extractability of antioxidants in alcoholic solvents may be attributed to their ability to disrupt cell walls and solubilize low molecular weight phenolics and flavonoids. From an application standpoint, the elevated antioxidant capacity of Saragolla extracts, particularly in hydroalcoholic systems, highlights their potential use in the food and nutraceutical industries as natural alternatives to synthetic antioxidants. This is especially relevant given increasing concerns regarding the toxicological and carcinogenic effects of synthetic additives, promoting the demand for plant-derived bioactives with health-promoting properties.

3.2.2. Total Phenolic Content (TPC) and Total Flavonoid Content (TFC)

In addition to being a significant source of calories and proteins, Saragolla wheat is also rich in phenolic compounds, which are recognized for their antioxidant properties and protective roles against chronic diseases linked to oxidative stress. These bioactive compounds contribute to the prevention of cardiovascular disorders and certain cancers [39,40]. The total phenolic content (TPC) of Saragolla wheat extracts was quantified using the Folin–Ciocalteu method. As reported in Figure 2 and Table S2 (Supplementary Material), TPC values were determined for the native Saragolla variety following extraction with different solvent systems—methanol/water (80:20), ethanol/water (70:30), and distilled water—under varying extraction times (1, 2, and 4 min) and ultrasonic power levels (600, 300, and 180 W). When assessing the influence of extraction time and power on TPC yield from fresh and dry seeds, a consistent trend was observed: ethanol- and methanol-based solvents extracted approximately 28% more phenolics than distilled water, regardless of processing conditions. Across treatments, TPC values in dry seed extracts ranged from 19.82 to 30.63 mg GAE/g (p < 0.05), with the maximum yield obtained using ethanol at 600 W for 1 min. In contrast, distilled water consistently produced the lowest TPC values across nearly all experimental conditions. These findings are consistent with previous studies [41,42], which also reported ethanol-based solvents as the most effective medium for maximizing phenolic recovery from plant seeds, likely due to their optimal polarity for solubilizing a broad range of phenolic compounds.

The superior efficiency of ethanol–water mixtures in extracting phenolic compounds has been attributed to several physicochemical mechanisms. According to Mustafa and Turner [43], these solvents enhance phenolic solubility and diffusivity, particularly at elevated temperatures, while simultaneously reducing viscosity and surface tension. Moreover, they facilitate the disruption of intermolecular interactions such as Van der Waals forces, hydrogen bonding, and dipole–dipole interactions, thereby improving the release of bound phenolics and resulting in higher extraction yields.

The total phenolic content (TPC) of cereal grains is not only a marker of their nutritional and antioxidant potential but may also provide insights into grain physiology. TPC levels often reflect both environmental influences and physiological processes during grain maturation, and they have been proposed as indicators of a seed’s germination potential, whether for agricultural propagation or for malting applications. Varieties naturally enriched in phenolics frequently exhibit superior germination performance, as also reported by Zhang et al. [44]. This aligns with observations by Rocco et al. [45], who found that the ancient Saragolla cultivar displays a higher germination rate than the modern Svevo variety, suggesting that elevated TPC may contribute to enhanced germination efficiency.

The physiological basis for this relationship lies in the functional role of phenolic compounds in seed biology. As shown by Rodríguez et al. [46], phenolics modulate oxygen availability to the embryo through oxidative fixation mechanisms, thereby influencing seed dormancy release and germination, particularly under stress conditions. Beyond their involvement in germination, phenolic compounds act as key antioxidants that protect plant tissues from oxidative damage. Alongside other secondary metabolites, such as terpenoids and alkaloids, phenolics play an essential role in plant defense and adaptive responses to environmental stress [14,15,16].

In line with these findings, Figure 3 and Table S3 (Supplementary Material) present the results for the total flavonoid content (TFC) of the autochthonous Saragolla variety. The TFC values are consistent with both the antioxidant activity and total phenolic levels observed in this study. Notably, the Saragolla variety exhibited a high flavonoid concentration in hydroalcoholic extracts, reaching 0.321 mg QE/g, thereby confirming its richness in bioactive compounds and its potential as a source of natural antioxidants.

3.2.3. HPLC Results

The chromatographic profiling of Saragolla provided insights into the distribution and diversity of phenolic compounds present in both whole grains and processed flours. The analysis was performed using high-performance liquid chromatography coupled with diode array detection and HPLC-DAD-ESI-MS on seed extracts obtained with different solvent systems. A total of seven phenolic compounds were identified and classified into three main categories: phenolic acids (e.g., gallic acid, syringic acid, ferulic acid), flavones, and flavonols (e.g., rutin). The solvent-dependent variability in both qualitative and quantitative composition is reported in

Table 3. Phenolic acid contents (mg/g of dry weight) of durum wheat Saragolla with retention time (RT), standard curve and R² (coefficient of determination). Results from three independent experiments are reported; values are expressed as the mean ± SD.

No.	Compounds	Λ (NM)	RT (Min)	Standard Curve	R2	Phenolic Compounds Concentration (mg/g)
1	Gallic acid	280	3	Y = 4E + 06x	0.97	0.933 ± 0.35
2	Catechins	280	9	Y = 7E + 07x	0.99	0.126 ± 0.04
3	Ellagic acid	280	12	Y = 7E + 07x	0.99	0.153 ± 0.08
4	Ferulic acid	280	15	Y = 4E + 06x	0.97	0.415 ± 0.12
5	Syringic acid	280	19	Y = 7E + 07x	0.99	0.307 ± 0.10
6	Vanillic acid	280	23	Y = 7E + 07x	0.99	0.011 ± 0.02
7	Caffeic acid	280	26	Y = 7E + 07x	0.99	0.130 ± 0.09
8	Rutin	280	34	Y = 7E + 07x	0.99	0.228 ± 0.06

and Figure 4. Among the solvents tested, hydroalcoholic solutions (methanol/water and ethanol/water mixtures) showed higher extraction efficiency, particularly for polar phenolics such as gallic and ferulic acids.

Notably, ferulic acid was the most abundant phenolic acid detected, consistent with its prevalence in cereal grains, where it is often bound to cell wall arabinoxylans [47]. Rutin, a quercetin glycoside, also appeared in substantial amounts, particularly in the ethanol-based extracts, highlighting Saragolla’s potential as a source of bioavailable flavonols. These compounds are well-documented for their multifunctional bioactivities, including antioxidant, anti-inflammatory, antithrombotic, antimicrobial, and anticarcinogenic effects [48,49]. Their presence reinforces the nutraceutical relevance of Saragolla wheat, especially in the context of functional food development. The relatively high concentrations of gallic acid and rutin further suggest potential applications in disease prevention, particularly through mechanisms related to oxidative stress modulation [50]. The observed phenolic profile distinguishes Saragolla from many modern wheat cultivars, where selective breeding has often prioritized yield over phytochemical richness. These findings support the growing interest in ancient grains as reservoirs of health-promoting secondary metabolites, and provide a scientific rationale for their inclusion in health-conscious diets and sustainable food systems.

3.3. Mycotoxin Analysis

Comprehensive microbiological assessments were conducted to evaluate the presence of mycotoxins, specifically aflatoxin B1, total aflatoxins, ochratoxin A, deoxynivalenol (DON), and zearalenone in caryopses of Saragolla wheat cultivated under vertical tillage systems, as well as in the corresponding semolina and flour products (Figure 5). Quantification was performed using competitive enzyme-linked immunosorbent assays (ELISA), a validated method widely adopted for routine monitoring of mycotoxin contamination in cereals due to its high sensitivity and specificity. The obtained values were compared against the maximum limits established by EU (European Union) regulations [51] and national guidelines provided by MASAF (Ministero dell’Agricoltura, della Sovranità Alimentare e delle Foreste).

The results showed that all tested samples were well within the legal safety thresholds, suggesting excellent microbiological quality of Saragolla wheat across all matrices analyzed. Specifically: Aflatoxin B1, the most toxicologically relevant mycotoxin due to its hepatocarcinogenic potential, was detected at a concentration of 0.37 ± 0.0034 ppb, significantly below the EU limit of 2.0 ppb for unprocessed durum wheat; Ochratoxin A was present at 2.98 ± 0.0359 ppb, within the legal maximum of 5.0 ppb; Deoxynivalenol (DON) was found at 149.5 ± 0.4505 ppb, a value substantially lower than the 1750 ppb threshold for processed cereal products; Zearalenone, a mycotoxin of estrogenic activity, was not detected in any of the tested samples. The results indicate that the Saragolla cultivar presents a minimal risk of mycotoxin contamination, supporting its suitability for use in food production from a food safety perspective. It should be emphasized that the presence of mycotoxins at trace levels, particularly when detected using advanced high-sensitivity analytical techniques, does not inherently imply a meaningful toxicological concern. The improved sensitivity of contemporary methods such as ELISA and LC–MS/MS has substantially reduced limits of quantification (LOQs), resulting in more frequent detection of low-level residues that are often well below thresholds of toxicological relevance. Furthermore, the occurrence and accumulation of mycotoxins are strongly influenced by environmental factors, which govern fungal growth and secondary metabolite production. The agro-climatic characteristics of the Sannio region (Southern Italy) [52], marked by moderate temperatures and relatively low humidity during grain ripening and post-harvest stages, are generally unfavorable to the proliferation of mycotoxigenic fungi such as Aspergillus, Fusarium, and Penicillium species.

Collectively, these results confirm that traditional cultivation practices, combined with favorable pedoclimatic conditions, can contribute significantly to reducing mycotoxin risk, thus enhancing the quality and safety profile of ancient grains like Saragolla in modern food systems.

3.4. Morphometric, Morphological and Ultrastructural Analysis Through Scanning Electron Microscopy (SEM)

A detailed evaluation of caryopsis morphology, including morphometric, structural, and ultrastructural features, was carried out using digital microscopy in combination with scanning electron microscopy (SEM). Representative SEM images of caryopses from the autochthonous durum wheat variety Saragolla are shown in Figure 6. Quantitative morphometric measurements were obtained using ImageJ software, enabling accurate assessment of grain size parameters. The caryopses exhibited a mean length of 10.6 ± 0.15 mm and a mean width of 4.8 ± 0.12 mm. These measurements provide critical descriptors of grain architecture, which are closely associated with functional attributes such as kernel weight, milling efficiency, and overall yield potential [53]. Moreover, the integration of morphometric and ultrastructural data with molecular marker analyses offers a comprehensive framework for elucidating the factors underlying grain quality. This approach not only enhances breeding efficiency but also provides a framework for selecting genotypes with superior technological and nutritional qualities.

Furthermore, we performed an imaging study based on SEM to describe the main structural layers of the wheat caryopsis. Figure 6 presents the microstructures of mature grains from the autochthonous durum wheat variety Saragolla, analyzed in cross-section. The SEM analysis allowed the identification of key ultrastructural features of the caryopsis, namely the pericarp, seed coat, aleurone layer, and starch endosperm, which can serve as direct phenotypic markers for monitoring the inheritance of grain traits.

According to the scanning electron micrographs presented in Figure 7, three morphologically distinct tissues were clearly identified within the wheat caryopsis: the pericarp (P) fused with the seed coat (SC), the aleurone layer (A), and the starchy endosperm (SE). A fourth major component, the embryo, was not visible in these images, as it is located on the dorsal side of the grain.

The SEM images were quantitatively analyzed using ImageJ software (National Institutes of Health, Bethesda, MD, USA) following careful calibration to ensure reliable morphometric measurements. The outermost pericarp (P) appeared as a dense, lignified, non-living tissue, with an average thickness of approximately 10 ± 0.13 µm. Immediately beneath it, the seed coat (SC), a tightly adherent, protective layer that fully encloses the seed displayed an average thickness of 6.2 ± 0.69 µm. Underlying the seed coat is the aleurone layer (A), which forms the peripheral region of the endosperm. This layer, measuring roughly 35 ± 1.03 µm in thickness, was readily discernible in the micrographs. Unlike the pericarp and seed coat, aleurone cells remain metabolically active at seed maturity. They are characterized by the presence of protein storage bodies (globoids, G) and lipid droplets, visible in the SEM images as spherical, bright inclusions ranging from 1.8 ± 0.07 to 4.8 ± 0.32 µm in diameter. The distribution and morphology of these globoids are modulated by the lipid fraction associated with starch granules, as reported by Panato et al. [54]. These structural features reaffirm the role of the aleurone as a reservoir of lipids, minerals, and proteins [55].

As illustrated in Figure 8, starch granules appeared homogeneously distributed throughout the starchy endosperm. Quantitative image analysis performed using ImageJ software (National Institutes of Health, Bethesda, MD, USA) revealed the presence of two distinct granule size populations: type A granules with diameters ranging from 9.8 ± 0.47 to 22.8 ± 1.02 µm, and type B granules ranging from 2.5 ± 0.37 to 7.9 ± 0.51 µm. It is important to note that these dimensional ranges may vary among studies [56,57], largely due to differences in wheat genotype, environmental conditions, and starch extraction protocols. The size and morphology of starch granules represent critical parameters influencing their digestibility and functional behavior [58]. In particular, cereal grains containing smaller starch granules and thinner endosperm cell walls tend to exhibit enhanced enzymatic accessibility, leading to higher digestibility and greater nutrient bioavailability [59]. This improvement is attributed to the increased permeability of the endosperm matrix, which facilitates more efficient enzyme penetration, diffusion, and substrate hydrolysis. Consequently, such structural features promote faster starch degradation and accelerated nutrient release during digestion [53].

Durum wheat is a recognized source of micronutrients [60], although the genotype, climatic conditions, and soil characteristics strongly influence its mineral composition. These factors, together with agronomic practices and harvest year, account for the wide variability reported in the mineral content of different wheat varieties [61]. Chemical elemental analysis of Saragolla caryopses revealed statistically significant variations in both major and trace elements, as confirmed by spectroscopic quantification and elemental mapping [62]. The SEM–EDX spectra (Figure 9a) showed that C (carbon), O (oxygen), P (phosphorus), K (potassium), and Mg (magnesium) were the predominant elements, while Na (sodium), Al (aluminum), S (sulfur), Ca (calcium), and Cl (chlorine) were present in lower concentrations. The spatial mapping revealed that minerals such as P, K, and Mg were notably concentrated in the aleurone layer, particularly within the protein/lipid body globoids. In contrast, Ca was scarcely detected in either layer, as illustrated in Figure 9b, whereas the other minerals showed more homogeneous localization patterns.

The aleurone layer (AL) exhibited higher concentrations of all the estimated minerals compared to the starchy endosperm (SE), in agreement with previous studies [63,64,65,66]. This enrichment confirms the nutrient-storage function of the aleurone, which contains spherosomes and aleurone grains, organelles specialized in lipid and mineral accumulation. Mature aleurone cells, characterized by thickened walls, large nuclei, and active metabolism, remain viable at maturity, whereas endosperm cells, composed mainly of starch and protein, are non-viable [67]. During germination, the aleurone layer acquires a digestive role, secreting hydrolytic enzymes that degrade the starch and protein reserves in the endosperm. This process coincides with programmed cell death (PCD) of the endosperm, facilitating nutrient mobilization [68,69]. Minor preparation artifacts, such as empty spaces between cell walls and cytoplasmic contents, resulted from dehydration and sectioning [70]. Nonetheless, SEM analysis provided detailed ultrastructural evidence of the aleurone’s central role in mineral storage and remobilization, highlighting its importance for both grain physiology and nutritional quality.

3.5. Genetic Polymorphisms

Given the growing demand for drought- and heat-tolerant crops, Saragolla wheat represents a promising alternative feed and energy source for sustainable livestock production in Mediterranean environments [14]. To investigate its genetic basis for stress resilience and agronomic potential, we analyzed two genotypes: the autochthonous Triticum durum Saragolla from Sannio and the commercial Saragolla “Syngenta”, widely cultivated for its high productivity. This study also explores how the distinctive morphological, functional, and nutritional traits of the traditional landrace may reflect underlying genetic adaptations related to yield stability, physiological efficiency, and stress tolerance. SSR markers linked to agronomic performance, including loci associated with protein quality and grain size, support these genotype–phenotype associations.

The inclusion of the traditional Saragolla wheat is particularly warranted given its lack of prior genetic characterization, coupled with the recognized high genetic diversity and local adaptation inherent to Mediterranean durum wheat landraces. The commercial cultivar was selected as a reference due to its genetic uniformity and representation of modern breeding objectives focused on productivity. Restricting the analysis to these two genotypes minimizes potential confounding effects from multiple cultivars, allowing a focused evaluation of whether the historical landrace retains unique alleles or functional traits absent in its modern counterpart, thereby providing a robust framework for conservation and breeding applications.

SSR marker analysis was employed to evaluate polymorphisms across the wheat genome, as reported in

Table 4. Development of SSR markers analysis across the wheat genome.

Locus	Saragolla Autochthonous	Saragolla Syngenta
Gwm268_1B	(CT) 2 AT (CT) > 26–25	(CT) 2 AT (CT) > 19–35–40
Gwm369_3°		(CT) > 39–73
Taglut_1°	(CAG) 2 (CAA) 18–19	(CAG) 2 (CAA) 18–19
Gwm297_7B	(GA) 16	(GA) 18
Barc178_6B	(TAA) 14–18	(TAA) 18

. Primers were selected from well-established loci evenly distributed across chromosomes to ensure broad genomic coverage. PCR amplification consistently produced fragments of the expected size, as confirmed by 1% agarose gel electrophoresis, which revealed sharp and distinct bands. Purified PCR products were sequenced using the Sanger method and analyzed with the NOVOPROLAB bioinformatics tool, enabling precise identification and quantification of SSRs. The sequences were aligned against a reference genome of Triticum durum using BWA alignment tool. We applied strict criteria for repeat calling, focusing on regions with high repeatability and sequence consistency. Only highly reliable repeats, identified by NOVOPROLAB, were considered for downstream analysis. Moreover, a quality score > 25 calculated with SnapGene was set for base calling, and sequences with low confidence or below this threshold were excluded from the analysis. This approach aimed to provide a detailed overview of allelic diversity and highlighted differences in adaptive traits between the two Saragolla varieties, the autochthonous from Sannio and the commercial one.

Particular attention was given to the GWM268_1B and GWM369_3A loci, both associated with stress response. The GWM268_1B marker, located on chromosome 1B, has been linked to quantitative trait loci (QTLs) controlling yield-related traits such as kernel number per square meter (KN) and thousand-kernel weight (TKW) [71]. It also interacts with environmental stressors, including water deficit and cumulative temperature, making it relevant for evaluating the heat susceptibility index (HSI) through kernel weight and spike temperature depression. In the autochthonous Saragolla, a single allelic variant was identified at this locus, with 25 AT repeats, a result that points to strong genetic fixation. This stability may reflect centuries of local adaptation to Mediterranean conditions, suggesting that the autochthonous germplasm harbors a resilient genetic background optimized for environments characterized by recurrent drought and heat stress. In contrast, Saragolla Syngenta displayed greater allelic diversity, with variants carrying 19, 25, 35, and 40 repeats, suggesting a broader adaptive potential under fluctuating environmental conditions.

Analysis of the GWM369_3A marker, mapped on chromosome 3A and considered highly polymorphic [72], revealed further divergence between the two varieties. While absent in autochthonous Saragolla, Saragolla Syngenta exhibited alleles with CT repeats of 39 and 73, highlighting the potential of this locus as a diagnostic marker to distinguish breeding lines and evaluate adaptive strategies. Since this locus is polymorphic in Syngenta, its absence in the traditional variety may indicate that the autochthonous line relies on alternative physiological or genetic mechanisms to cope with environmental stress. This divergence highlights the importance of maintaining such landraces in germplasm collections, as they may contain unique alleles or regulatory pathways not present in modern high-yielding cultivars.

Additional loci provided complementary insights. The BARC178_6B marker (chromosome 6BL), previously associated with TKW and grain quality [73], showed comparable repeat lengths in both varieties. Similarly, the GWM297_7B marker (chromosome 7BL), widely used in diversity and breeding studies [72], revealed consistent repeat patterns across samples, reinforcing genetic similarities. Furthermore, the TAGLUT_1A locus, associated with wheat protein quality [74], exhibited polymorphisms in both Saragolla varieties. Markers associated with agronomic performance, such as BARC178_6B (linked to thousand-kernel weight) and TAGLUT_1A (linked to protein quality), showed consistent or favorable patterns in the autochthonous variety. These results suggest that despite lower allelic polymorphism overall, Saragolla autochthonous retains key genetic determinants of grain yield and nutritional value. Combined with the previously observed high phenolic and flavonoid content in this landrace, the findings reinforce its dual importance: (i) as a source of bioactive compounds supporting nutritional and functional food applications, and (ii) as a reservoir of stable alleles valuable for sustainable breeding.

In summary, the autochthonous Saragolla variety emerges not only as a genetic reference point for understanding wheat domestication and adaptation but also as a strategic genetic resource. Its stability at loci associated with yield and stress tolerance, coupled with its high content of antioxidant compounds, makes it a promising candidate for integrated breeding programs targeting both resilience and grain quality. Preserving and valorizing such traditional varieties is therefore crucial for broadening the genetic base of modern durum wheat and ensuring long-term adaptability to climate change.

While these findings provide valuable genetic insights into the two cultivars examined, it is important to acknowledge a key limitation of the study: the small sample size. The analysis is based on only two varieties, which restricts the generalizability of the results to the wider genetic diversity present in Triticum durum. A more comprehensive investigation that includes a broader range of cultivars from diverse geographic origins and breeding programs would be necessary to draw more robust conclusions regarding genetic diversity, allelic fixation, and the adaptive significance of SSR loci in durum wheat.

4. Conclusions

This study provides the first comprehensive characterization of the autochthonous durum wheat variety Saragolla from Campania, integrating nutritional, antioxidant, morphological, and genetic analyses into a unified assessment. The results reveal that Saragolla is a nutritionally dense grain, rich in proteins, dietary fiber, and bioactive compounds such as phenolic acids and flavonoids, which collectively contribute to its strong antioxidant potential. These features underscore the superior nutritional profile of this heritage landrace and its value as a functional ingredient within the Mediterranean diet.

SEM analysis further supports the classification of Saragolla as a high-quality durum wheat and identifies ultrastructural traits—particularly within the aleurone layer and starch endosperm—that serve as reliable phenotypic markers for varietal differentiation, technological performance, and potential digestibility. When coupled with SSR-based genotyping, these morphological and biochemical traits reflect a coherent genotype–phenotype relationship, offering a holistic perspective on the determinants of grain quality.

At the genetic level, the detection of polymorphisms and QTLs associated with traits such as protein quality and kernel weight suggests that Saragolla retains alleles linked to physiological efficiency and yield stability. The presence of loci associated with heat-stress adaptation further highlights its potential as a reservoir of resilience traits, which are increasingly relevant under Mediterranean climate conditions and global warming scenarios. As a preliminary investigation into the genetic diversity of Saragolla, this study underscores the importance of conserving traditional landraces as repositories of stable alleles that may contribute to sustainable breeding strategies aimed at enhancing both resilience and grain quality.

All together, these findings position Saragolla as a nutritionally valuable heritage cereal with promising potential for durum wheat improvement. Its distinctive profile encompassing rich bioactive compounds, favorable morphological traits, and adaptive genetic markers, makes it a possible candidate for breeding programs focused on enhancing technological performance and tolerance to abiotic stresses. Supporting the cultivation and conservation of such traditional varieties not only promotes agrobiodiversity but also strengthens regional agri-food heritage and contributes to long-term food security under changing climatic conditions.

Overall, this integrated characterization highlights Saragolla as a crop that effectively unites the desirable attributes of ancient grains with the demands of modern agriculture. Its unique combination of quality traits and adaptive capacity underscores its relevance to sustainable food systems and reinforces the value of preserving heritage germplasm as a strategic resource for future crop innovation.