Transcriptomics Analysis of Maize (Zea mays L.) in Response to the Infection by Setosphaeria turcica
Abstract
1. Introduction
2. Materials and Methods
2.1. Strains, Plant Materials and Culture Conditions
2.2. RNA Extraction and Quality Assessment
2.3. Library Construction and Sequencing
2.4. Sequencing Data Analysis
2.5. Functional Analysis of Maize Genes
2.6. Real-Time Quantitative PCR (qRT-PCR) Analysis
3. Results
3.1. Quality Control of Transcriptome Sequencing Data and Alignment to the Reference Genome
3.2. Gene Expression Analysis
3.3. DEGs Identification
3.4. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) Pathway Enrichment Analysis
3.5. Transcription Factors Associated with the Response of Maize Leaves to S. turcica Infection
3.6. Validation of DEGs
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Mishra, M.; Sushma; Sharma, R. Corn (Zea mays) as a nutrient source and diet: A review. Br. J. Pharm. Res. 2021, 149, 299–303. [Google Scholar] [CrossRef]
- Li, P.; Shen, S.; Jia, J.; Sun, H.; Zhu, H.; Wei, N.; Yu, B.; Sohail, A.; Wu, D.; Zeng, F.; et al. The catalytic subunit of type 2A protein phosphatase negatively regulates conidiation and melanin biosynthesis in Setosphaeria turcica. Int. J. Biol. Macromol. 2024, 266, 131149. [Google Scholar] [CrossRef] [PubMed]
- Niehl, A.; Wyrsch, I.; Boller, T.; Heinlein, M. Double-stranded RNAs induce a pattern-triggered immune signaling pathway in plants. New Phytol. 2016, 211, 1008–1019. [Google Scholar] [CrossRef]
- Tsuda, K.; Somssich, I.E. Transcriptional networks in plant immunity. New Phytol. 2015, 206, 932–947. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Gao, Z.; Zheng, X.; Zhang, Z. The role of G-proteins in plant immunity. Plant Signal. Behav. 2012, 7, 1284–1288. [Google Scholar] [CrossRef]
- Trümper, C.; Paffenholz, K.; Smit, I.; Kössler, P.; Karlovsky, P.; Braun, H.P.; Pawelzik, E. Identification of regulated proteins in naked barley grains (Hordeum vulgare nudum) after Fusarium graminearum infection at different grain ripening stages. J. Proteom. 2016, 133, 86–92. [Google Scholar] [CrossRef]
- Batalia, M.A.; Monzingo, A.F.; Ernst, S.; Roberts, W.; Robertus, J.D. The crystal structure of the antifungal protein zeamatin, a member of the thaumatin-like, PR-5 protein family. Nat. Struct. Biol. 1996, 3, 19–23. [Google Scholar] [CrossRef] [PubMed]
- Chang, C.; Yu, D.; Jiao, J.; Jing, S.; Schulze-Lefert, P.; Shen, Q.H. Barley MLA immune receptors directly interfere with antagonistically acting transcription factors to initiate disease resistance signaling. Plant Cell 2013, 25, 1158–1173. [Google Scholar] [CrossRef]
- Lozano-Durán, R.; Macho, A.P.; Boutrot, F.; Segonzac, C.; Somssich, I.E.; Zipfel, C. The transcriptional regulator BZR1 mediates trade-off between plant innate immunity and growth. eLife 2013, 2, e00983. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Gerstein, M.; Snyder, M. RNA-Seq: A revolutionary tool for transcriptomics. Nat. Rev. Genet. 2009, 10, 57–63. [Google Scholar] [CrossRef]
- Trapnell, C.; Williams, B.A.; Pertea, G.; Mortazavi, A.; Kwan, G.; van Baren, M.J.; Salzberg, S.L.; Wold, B.J.; Pachter, L. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat. Biotechnol. 2010, 28, 511–515. [Google Scholar] [CrossRef]
- Zhang, J.; Chen, L.; Fu, C.; Wang, L.; Liu, H.; Cheng, Y.; Li, S.; Deng, Q.; Wang, S.; Zhu, J.; et al. Comparative transcriptome analyses of gene expression changes triggered by Rhizoctonia solani AG1 IA infection in resistant and susceptible rice varieties. Front. Plant Sci. 2017, 8, 1422. [Google Scholar] [CrossRef]
- Zrenner, R.; Verwaaijen, B.; Genzel, F.; Flemer, B.; Grosch, R. Transcriptional changes in potato sprouts upon interaction with Rhizoctonia solani indicate pathogen-induced interference in the defence pathways of potato. Int. J. Mol. Sci. 2021, 22, 3094. [Google Scholar] [CrossRef] [PubMed]
- Li, P.; Zhu, H.; Wang, C.; Zeng, F.; Jia, J.; Feng, S.; Han, X.; Shen, S.; Wang, Y.; Hao, Z.; et al. StRAB4 gene is required for filamentous growth, conidial development, and pathogenicity in Setosphaeria turcica. Front. Microbiol. 2024, 14, 1302081. [Google Scholar] [CrossRef] [PubMed]
- Meng, Y.; Zeng, F.; Hu, J.; Li, P.; Xiao, S.; Zhou, L.; Gong, J.; Liu, Y.; Hao, Z.; Cao, Z.; et al. Novel factors contributing to fungal pathogenicity at early stages of Setosphaeria turcica infection. Mol. Plant Pathol. 2022, 23, 2–44. [Google Scholar] [CrossRef] [PubMed]
- Rowland, B.E.; Henriquez, M.A.; Nilsen, K.T.; Subramaniam, R.; Walkowiak, S. Unraveling plant-pathogen interactions in cereals using RNA-seq. Methods Mol. Biol. 2023, 2659, 103–118. [Google Scholar]
- Chu, N.; Zhou, J.R.; Fu, H.Y.; Huang, M.T.; Zhang, H.L.; Gao, S.J. Global gene responses of resistant and susceptible sugarcane cultivars to Acidovorax avenae subsp. avenae identified using comparative transcriptome analysis. Microorganisms 2020, 8, 10. [Google Scholar] [CrossRef]
- Meng, J.Y.; Ntambo, M.S.; Rott, P.C. Identification of differentially expressed proteins in sugarcane in response to infection by Xanthomonas albilineans using iTRAQ quantitative proteomics. Microorganisms 2020, 8, 76. [Google Scholar] [CrossRef] [PubMed]
- Bilgin, D.D.; Aldea, M.; O’Neill, B.F.; Benitez, M.; Li, M.; Clough, S.J.; DeLucia, E.H. Elevated ozone alters soybean-virus interaction. Mol. Plant-Microbe Interact. 2008, 21, 1297–1308. [Google Scholar] [CrossRef]
- Nabity, P.D.; Zavala, J.A.; DeLucia, E.H. Indirect suppression of photosynthesis on individual leaves by arthropod herbivory. Ann. Bot. 2009, 103, 655–663. [Google Scholar] [CrossRef]
- Bilgin, D.D.; Zavala, J.A.; Zhu, J.; Clough, S.J.; Ort, D.R.; DeLucia, E.H. Biotic stress globally downregulates photosynthesis genes. Plant Cell Environ. 2010, 33, 1597–1613. [Google Scholar] [CrossRef]
- Köhler, A.; Maag, D.; Veyrat, N.; Glauser, G.; Wolfender, J.L.; Turlings, T.C.; Erb, M. Within-plant distribution of 1,4-benzoxazin-3-ones contributes to herbivore niche differentiation in maize. Plant Cell Environ. 2015, 38, 1081–1093. [Google Scholar] [CrossRef] [PubMed]
- Niemeyer, H.M. Hydroxamic acids derived from 2-hydroxy-2H-1,4-benzoxazin-3(4H)-one: Key defense chemicals of cereals. J. Agric. Food Chem. 2009, 57, 1677–1696. [Google Scholar] [CrossRef]
- Ahmad, S.; Veyrat, N.; Gordon-Weeks, R.; Zhang, Y.; Martin, J.; Smart, L.; Glauser, G.; Erb, M.; Flors, V.; Frey, M.; et al. Benzoxazinoid metabolites regulate innate immunity against aphids and fungi in maize. Plant Physiol. 2011, 157, 317–327. [Google Scholar] [CrossRef] [PubMed]
- Yang, P.; Praz, C.; Li, B.; Singla, J.; Robert, C.A.M.; Kessel, B.; Scheuermann, D.; Lüthi, L.; Ouzunova, M.; Erb, M.; et al. Fungal resistance mediated by maize wall-associated kinase ZmWAK-RLK1 correlates with reduced benzoxazinoid content. New Phytol. 2019, 221, 976–987. [Google Scholar] [CrossRef] [PubMed]
- Pandey, S.P.; Somssich, I.E. The role of WRKY transcription factors in plant immunity. Plant Physiol. 2009, 150, 1648–1655. [Google Scholar] [CrossRef]
- Asai, T.; Tena, G.; Plotnikova, J.; Willmann, M.R.; Chiu, W.L.; Gomez-Gomez, L.; Boller, T.; Ausubel, F.M.; Sheen, J. MAP kinase signalling cascade in Arabidopsis innate immunity. Nature 2002, 415, 977–983. [Google Scholar] [CrossRef]
- Qiu, D.; Xiao, J.; Ding, X.; Xiong, M.; Cai, M.; Cao, Y.; Li, X.; Xu, C.; Wang, S. OsWRKY13 mediates rice disease resistance by regulating defense-related genes in salicylate- and jasmonate-dependent signaling. Mol. Plant-Microbe Interact. 2007, 20, 492–499. [Google Scholar] [CrossRef]
- Choi, C.; Hwang, S.H.; Fang, I.R.; Kwon, S.I.; Park, S.R.; Ahn, I.; Kim, J.B.; Hwang, D.J. Molecular characterization of Oryza sativa WRKY6, which binds to W-box-like element 1 of the Oryza sativa pathogenesis-related (PR) 10a promoter and confers reduced susceptibility to pathogens. New Phytol. 2015, 208, 846–859. [Google Scholar] [CrossRef] [PubMed]
- Hwang, S.H.; Kwon, S.I.; Jang, J.Y.; Fang, I.L.; Lee, H.; Choi, C.; Park, S.; Ahn, I.; Bae, S.C.; Hwang, D.J. OsWRKY51, a rice transcription factor, functions as a positive regulator in defense response against Xanthomonas oryzae pv. Oryzae. Plant Cell Rep. 2016, 35, 1975–1985. [Google Scholar] [CrossRef] [PubMed]
- Chujo, T.; Miyamoto, K.; Shimogawa, T.; Shimizu, T.; Otake, Y.; Yokotani, N.; Nishizawa, Y.; Shibuya, N.; Nojiri, H.; Yamane, H.; et al. OsWRKY28, a PAMP-responsive transrepressor, negatively regulates innate immune responses in rice against rice blast fungus. Plant Mol Biol. 2013, 82, 23–37. [Google Scholar] [CrossRef]
- Zhang, H.; Kang, H.; Su, C.; Qi, Y.; Liu, X.; Pu, J. Genome-wide identification and expression profile analysis of the NAC transcription factor family during abiotic and biotic stress in woodland strawberry. PLoS ONE 2018, 13, e0197892. [Google Scholar] [CrossRef]
- Sun, D.; Zhang, X.; Zhang, Q.; Ji, X.; Jia, Y.; Wang, H.; Niu, L.; Zhang, Y. Comparative transcriptome profiling uncovers a Lilium regale NAC transcription factor, LrNAC35, contributing to defence response against cucumber mosaic virus and tobacco mosaic virus. Mol. Plant Pathol. 2019, 20, 1662–1681. [Google Scholar] [CrossRef]
- Feng, H.; Duan, X.; Zhang, Q.; Li, X.; Wang, B.; Huang, L.; Wang, X.; Kang, Z. The target gene of tae-miR164, a novel NAC transcription factor from the NAM subfamily, negatively regulates resistance of wheat to stripe rust. Mol. Plant Pathol. 2014, 15, 284–296. [Google Scholar] [CrossRef]
- Na, C.; Shuanghua, W.; Jinglong, F.; Bihao, C.; Jianjun, L.; Changming, C.; Jin, J. Overexpression of the eggplant (Solanum melongena) NAC family transcription factor SmNAC suppresses resistance to bacterial wilt. Sci. Rep. 2016, 6, 31568. [Google Scholar] [CrossRef] [PubMed]
- Biswas, D.; Gain, H.; Mandal, A. MYB transcription factor: A new weapon for biotic stress tolerance in plants. Plant Stress 2023, 10, 100252. [Google Scholar] [CrossRef]
- Hu, Q.; Wu, D.; Hong, T.; Wang, L.; Wang, S.; Ren, Q. GhLBD41, a lateral organ boundaries transcription factor, positively regulates plants resistance to Verticillium dahliae via the jasmonic acid signaling pathway. Ind. Crops Prod. 2024, 222, 119939. [Google Scholar] [CrossRef]
- Khan, Y.; Xiong, Z.; Zhang, H.; Yaseen, T.; Hui, T. Expression and roles of GRAS gene family in plant growth, signal transduction, biotic and abiotic stress resistance and symbiosis formation—A review. Plant Biol. 2022, 24, 404–416. [Google Scholar] [CrossRef]
- Qu, L.; Chen, J.; Liu, M.; Pan, N.; Okamoto, H.; Lin, Z.; Li, C.; Li, D.; Wang, J.; Zhu, G.; et al. Molecular cloning and functional analysis of a novel type of Bowman-Birk inhibitor gene family in rice. Plant Physiol. 2003, 133, 560–570. [Google Scholar] [CrossRef]
- Wel, H.V.D.; Loeve, K. Isolation and characterization of thaumatin I and II, the sweet-tasting proteins from Thaumatococcus daniellii Benth. Eur. J. Biochem. 1972, 31, 221–225. [Google Scholar] [PubMed]
- Sinha, M.; Singh, R.P.; Kushwaha, G.S.; Iqbal, N.; Singh, A.; Kaushik, S.; Kaur, P.; Sharma, S.; Singh, T.P. Current overview of allergens of plant pathogenesis related protein families. Sci. World J. 2014, 16, 543195. [Google Scholar] [CrossRef]
- Abada, L.R.; D’Urzo, M.P.; Liua, D.; Narasimhan, M.L.; Reuveni, M.; Zhua, J.K.; Niua, X.; Singhb, N.K.; Hasegawaa, P.M.; Bressan, R.A. Antifungal activity of tobacco osmotin has specificity and involves plasma membrane permeabilization. Plant Sci. 1996, 118, 11–23. [Google Scholar] [CrossRef]
- Roberts, W.K.; Selitrennikoff, C.P. Zeamatin, an antifungal protein from maize with membrane-permeabilizing activity. J. Gen. Microbiol. 1990, 136, 1771–1778. [Google Scholar] [CrossRef]
- Javed, T.; Gao, S. WRKY transcription factors in plant defense. Trends Genet. 2023, 39, 787–801. [Google Scholar] [CrossRef] [PubMed]
- Shen, Z.; Dong, X.; Gao, Z.; Chao, Q.; Wang, B. Phylogenic and phosphorylation regulation difference of phosphoenolpyruvate carboxykinase of C3 and C4 plants. J. Plant Physiol. 2017, 213, 16–22. [Google Scholar] [CrossRef]
Gene ID | Forward Primer Sequence (5′-3′) | Revers Primer Sequence(3′-5′) |
---|---|---|
Actin | CTCGACTCTGGTGATGGTGTG | TCGTACTCCGCCTTGGAGAT |
Zm00001d007329 | CTACCGCTGGAGGAAGTACG | GACTTCTCGATGGGGTGTGT |
Zm00001d 008548 | AGCAAGGCCATCGACATCAA | CGGTGCACCTGAACTTGTTG |
Zm00001d 028400 | CCCTGTGTGTGTGTGTGTCT | TAGCCGCAGTTGTTGGTCAT |
Zm00001d 028816 | CAACTTCACCTCAGCCATGC | TCGGCAGCCTTGAAGATGTT |
Zm00001d 028471 | ATCATCGACGCCATCCACTC | AGGATCTCGTCAGTCAGGCT |
Zm00001d 044228 | ATGAAGGCGCTCGACATGAA | CCTTCTGGCCGGAGATCATC |
ZmPRP4 | GACTGCCAGCTGATCCACTC | GGGTTGTAGCTGCAGATGATGA |
ZmPRP5 | TGCTCCTTCAACGGCAACA | ATGGGTCTTCATGTCGGGG |
Sample | Raw Reads | Clean Reads | Error Rate (%) | Q20 (%) | Q30 (%) | GC Content (%) |
---|---|---|---|---|---|---|
CK_1 | 81,110,142 | 80,277,572 | 0.0243 | 98.33 | 94.84 | 58.88 |
CK_2 | 82,395,920 | 81,583,838 | 0.0239 | 98.47 | 95.22 | 58.67 |
CK_3 | 76,626,050 | 76,025,318 | 0.0257 | 97.81 | 93.33 | 58.82 |
24 hpi_1 | 80,029,714 | 79,359,542 | 0.0242 | 98.38 | 94.96 | 57.64 |
24 hpi_2 | 72,852,030 | 72,220,534 | 0.0242 | 98.34 | 94.89 | 57.94 |
24 hpi_3 | 70,194,858 | 69,503,116 | 0.0242 | 98.37 | 94.94 | 57.93 |
72 hpi_1 | 73,677,814 | 72,927,250 | 0.0244 | 98.29 | 94.75 | 59.04 |
72 hpi_2 | 71,306,370 | 70,702,224 | 0.024 | 98.46 | 95.19 | 59.46 |
72 hpi_3 | 80,319,754 | 79,733,048 | 0.024 | 98.45 | 95.16 | 59.08 |
Sample | Clean Reads | Total Mapped | Multiple Mapped | Uniquely Mapped |
---|---|---|---|---|
CK_1 | 80,277,572 | 77,494,595 (96.53%) | 2,622,080 (3.27%) | 74,872,515 (93.27%) |
CK_2 | 81,583,838 | 78,728,575 (96.5%) | 2,649,425 (3.25%) | 76,079,150 (93.25%) |
CK_3 | 76,025,318 | 73,396,315 (96.54%) | 2,463,607 (3.24%) | 70,932,708 (93.3%) |
24 hpi_1 | 79,359,542 | 76,814,670 (96.79%) | 3,138,785 (3.96%) | 73,675,885 (92.84%) |
24 hpi_2 | 72,220,534 | 69,708,082 (96.52%) | 2,775,393 (3.84%) | 66,932,689 (92.68%) |
24 hpi_3 | 69,503,116 | 67,061,517 (96.49%) | 2,725,240 (3.92%) | 64,336,277 (92.57%) |
72 hpi_1 | 72,927,250 | 70,248,542 (96.33%) | 2,426,555 (3.33%) | 67,821,987 (93.0%) |
72 hpi_2 | 70,702,224 | 68,274,476 (96.57%) | 2,459,032 (3.48%) | 65,815,444 (93.09%) |
72 hpi_3 | 79,733,048 | 77,049,838 (96.63%) | 2,657,470 (3.33%) | 74,392,368 (93.3%) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jia, H.; Li, P.; Tao, B.; Liu, Y.; Liu, Z.; Zhu, M.; Zhou, H.; Wang, M.; Dong, J.; Gu, S.; et al. Transcriptomics Analysis of Maize (Zea mays L.) in Response to the Infection by Setosphaeria turcica. Agronomy 2025, 15, 69. https://doi.org/10.3390/agronomy15010069
Jia H, Li P, Tao B, Liu Y, Liu Z, Zhu M, Zhou H, Wang M, Dong J, Gu S, et al. Transcriptomics Analysis of Maize (Zea mays L.) in Response to the Infection by Setosphaeria turcica. Agronomy. 2025; 15(1):69. https://doi.org/10.3390/agronomy15010069
Chicago/Turabian StyleJia, Hui, Pan Li, Bu Tao, Yuwei Liu, Zhihang Liu, Mengfang Zhu, He Zhou, Maocun Wang, Jingao Dong, Shouqin Gu, and et al. 2025. "Transcriptomics Analysis of Maize (Zea mays L.) in Response to the Infection by Setosphaeria turcica" Agronomy 15, no. 1: 69. https://doi.org/10.3390/agronomy15010069
APA StyleJia, H., Li, P., Tao, B., Liu, Y., Liu, Z., Zhu, M., Zhou, H., Wang, M., Dong, J., Gu, S., & Gong, X. (2025). Transcriptomics Analysis of Maize (Zea mays L.) in Response to the Infection by Setosphaeria turcica. Agronomy, 15(1), 69. https://doi.org/10.3390/agronomy15010069