Next Article in Journal
Population Dynamics of Cypripedium macranthos Sw. and Its Interactions with Environmental Factors in the Changbai Mountains
Previous Article in Journal
Winter Expansion and Emergence Time Effects on the Phenology, Growth, and Fecundity of Feathertop Rhodes Grass (Chloris virgata)
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Transcriptomics Analysis of Maize (Zea mays L.) in Response to the Infection by Setosphaeria turcica

1
State Key Laboratory of North China Crop Improvement and Regulation, Hebei Agricultural University, Baoding 071000, China
2
Hebei Bioinformatic Utilization and Technological Innovation Center for Agricultural Microbes, Baoding 071000, China
3
College of Life Sciences, Hebei Agricultural University, Baoding 071000, China
4
College of Plant Protection, Hebei Agricultural University, Baoding 071000, China
5
Collaborative Innovation Center for Wetland Conservation and Green Development of Hebei Province, Hengshui 053000, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to the work.
Agronomy 2025, 15(1), 69; https://doi.org/10.3390/agronomy15010069
Submission received: 16 November 2024 / Revised: 19 December 2024 / Accepted: 26 December 2024 / Published: 30 December 2024
(This article belongs to the Section Pest and Disease Management)

Abstract

:
Northern corn leaf blight (NCLB), caused by Setosphaeria turcica (S. turcica), is one of the devastating foliar diseases of maize (Zea mays) in maize-producing regions globally. Previous research has predominantly centered on elucidating the infection strategy and process of the pathogen, but the molecular mechanism of maize response to the pathogen is still largely unknown. In this study, we employed transcriptomics technology to comprehensively analyze alterations in RNA expression profiles within maize leaves at critical time points (hours post-infestation, 24 hpi, and 72 hpi) during S. turcica infection. Our study identified 7196 differentially expressed genes (DEGs) involved in the maize leaf response to S. turcica infection compared to the control (CK at 0 hpi). Functional analysis revealed that these DEGs were enriched in multiple metabolic pathways. Notably, genes associated with “benzoxazinone biosynthesis”, “tetracyclic pyrrole biosynthesis”, and “photosynthesis” were all down-regulated. In contrast, DEGs related to “phenol metabolism” and “phenylpropanoid metabolism” were significantly upregulated. Moreover, the genes belonging to the NAC, MYB-related, HB, and WRKY transcription factor families were also significantly enriched among the DEGs. The expression levels of six randomly selected DEGs were validated using qRT-PCR, confirming the accuracy of the RNA-Seq findings. This study delves into the functional genes and metabolic pathways closely associated with maize’s response to S. turcica infection, providing foundational data for a deeper understanding of the molecular mechanisms underlying the interaction between S. turcica and maize.

1. Introduction

Maize (Zea mays L.), a member of the Poaceae family, is among the most significant annual cereal crops worldwide [1]. Ensuring the security, yield stability, and sustainable development of maize production is crucial for China’s food security and sustainable agricultural development. However, maize diseases have historically posed significant threats to global maize yields, with northern corn leaf blight (NCLB) recognized as one of the most destructive foliar diseases. In severe cases, NCLB can induce yield losses ranging from 25% to 90% [2]. In recent years, two key factors have exacerbated the occurrence of the disease: firstly, the introduction of temperate-sensitive maize germplasm into tropical environments has compromised quantitative resistance; secondly, the widespread adoption of no-till farming practices and large-scale agricultural machinery has resulted in an increase in overwintering NCLB inoculum in fields. Consequently, the prevalence of NCLB has progressively escalated, becoming a major threat to maize production.
Throughout evolution, plants have developed a two-tiered innate immune system to defend against invading pathogenic microorganisms. The first tier is pattern-triggered immunity (PTI), which is activated when pattern recognition receptors (PRRs) detect conserved molecular structures known as pathogen-associated molecular patterns (PAMPs) [3]. The second tier involves effector-triggered immunity (ETI), which is initiated when plants directly or indirectly recognize pathogen effectors, triggering a stronger immune response. Both PTI and ETI further induce various immune responses in plants, including transcriptional reprogramming mediated by signal transduction pathways and transcription factors [4]. For example, when plants perceive pathogen invasion, PRRs activate several cell signaling pathways, including MAPK and G-protein pathways. Studies have shown that G-proteins play a direct role in plant defense, mediating processes such as programmed cell death and stomatal closure in response to pathogen attacks [5]. In addition, pathogenesis-related (PR) proteins participate in the active defense response following plant pathogen infection. One class of PR proteins, thaumatin-like proteins (TLPs), binds to 1,3-β-D-glucan and exhibits antifungal activity against pathogens such as powdery mildew and Fusarium species in barley [6]. Antifungal PR proteins, such as osmotin in tobacco, zeamatin in maize, hordomatin in barley, and trimatin in wheat, promote the formation of small pores in fungal cell membranes, leading to osmotic disruption and cell death, thereby providing antimicrobial protection [7,8]. Following receptor activation and signal initiation, pathogen invasion signals trigger extensive transcriptional reprogramming in host cells through transcription factors. Extensive research has highlighted the critical role of many WRKY transcription factor family members in plant immunity, including in Arabidopsis, barley, and rice [9]. WRKY transcription factors also interact with other transcription factor families, such as the bHLH transcription factors AtBZR1 and AtBES1/BZR2, to regulate plant hormone signaling [10].
The transcriptome refers to the complete set of transcripts, including messenger RNA (mRNA), ribosomal RNA (rRNA), transfer RNA (tRNA), and non-coding RNA, present in a specific tissue or cell under certain developmental stages or conditions [11]. Transcriptome analysis utilizing high-throughput sequencing enables the study of gene expression at the genome-wide level [12]. High-throughput sequencing technology is widely employed to investigate host–pathogen interactions. For example, comparing the transcriptomes of resistant and susceptible rice (Oryza sativa L.) varieties inoculated with Rhizoctonia solani revealed differentially expressed genes (DEGs) that were enriched in pathways such as photosynthesis and photorespiration, which play key roles in disease resistance [13]. Similarly, studies on potato (Solanum tuberosum L.) inoculated with R. solani identified DEGs that were significantly enriched in hormone-related pathways, including those regulating ethylene, jasmonic acid, and salicylic acid levels [14]. These studies are essential for elucidating the interactions between hosts and pathogens.
Although the infection process of S. turcica in maize has been extensively studied, the molecular mechanisms underlying the interaction between the pathogen and the host remain largely unexplored and necessitate further clarification. In this study, we utilized the susceptible maize variety B73 as the host to systematically analyze transcript-level responses in maize leaves during S. turcica infection. Our objective was to identify relevant genes, functional modules, and metabolic pathways involved in this interaction, thereby providing a theoretical basis for understanding the molecular mechanisms of maize’s response to S. turcica. This research also seeks to provide theoretical and technical support for the early diagnosis, management, and breeding of resistant maize varieties.

2. Materials and Methods

2.1. Strains, Plant Materials and Culture Conditions

The S. turcica wild-type (WT) strain 01-23 used in this research has been deposited at the Hebei Key Laboratory of Plant Physiology and Molecular Pathology. Maize inbred line B73 was cultivated in the greenhouse at Hebei Agricultural University. Maize seeds were sterilized through immersion in 70% ethanol for 3 min, followed by treatment with 2.5% sodium hypochlorite for 10 min and subsequent rinsing three times with sterile water. The sterilized seeds were cultivated on a water agar medium containing 1% agar with a concentration of 10 g/L at 27 °C for the purpose of initiating germination. Three seedlings of equal size were then selected and transferred to a clean pot measuring 11.5 cm in height, 13.6 cm in top diameter, and 9.5 cm in base diameter, which contained 1 kg of growth medium composed of a 1:1 (v/v) mixture of river sand and soil with a particle size of less than 2 mm. The soil was procured from agricultural land in Northern China. The growth medium contained 9.94 mg/g of soil organic carbon (SOC), 16.55 mg/kg of alkaline nitrogen (AN), along with 11.26 mg/kg of accessible phosphorus (AP). The plants were cultivated within a greenhouse under the conditions of a day/night temperature regime of 27 °C/22 °C, a 16 h light/8 h dark photoperiod, 60% relative humidity, 0.03% carbon dioxide concentration, and 20.95% oxygen content [2].
When the plants reached the six-leaf stage, healthy maize plants were selected as hosts for inoculation with S. turcica. The S. turcica wild-type (WT) strain 01-23 was grown on Potato Dextrose Agar (PDA) medium in the dark at 25 °C for 10 days [15]. Conidia were harvested, and a spore suspension was prepared at a concentration of 1 × 105 spores/mL. A 200 μL aliquot of the spore suspension was sprayed onto the maize leaves. Samples of the pathogen-host interaction were collected at 0, 24, and 72 h post-inoculation (hpi) from the top two leaves of maize plants inoculated with the WT strain. The collected leaves are quickly put into liquid nitrogen and then stored at −80 °C. It was used for subsequent transcriptome sequencing and qRT-PCR analysis. Each sample was collected from at least four maize plants.

2.2. RNA Extraction and Quality Assessment

Total RNA was extracted from maize leaf samples involved in the pathogen–host interaction using the TRIzol reagent kit (Omega, Houston, TX, USA) following the manufacturer’s instructions [16]. The purity and integrity of the extracted RNA were assessed via 1% agarose gel electrophoresis. RNA purity was measured using a Nanodrop spectrophotometer (IMPLEN, Munich, Germany), and RNA concentration was determined with a Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA). The RNA integrity was evaluated using the Bioanalyzer 2100 system (Agilent Technologies, Santa Clara, CA, USA). Samples meeting the quality criteria of OD260/280 > 1.8, OD260/230 > 1.0, RNA concentration > 250 ng/μL, and RIN > 8.0 were selected for subsequent sequencing library construction [15].

2.3. Library Construction and Sequencing

The mRNA was enriched using magnetic beads with Oligo (dT) linkers, followed by the addition of fragmentation buffer to cleave the mRNA into short fragments. mRNA was used as a template for the synthesis of a single-stranded cDNA by reverse transcription using a random hexamer as a primer, followed by the addition of buffer, dNTPs, and DNA polymerase to synthesize a double-stranded cDNA, and then purification of double-stranded cDNA using AMPure XP beads (Beckman, Shanghai, China). The purified double-stranded cDNA underwent end repair, the addition of an adenine base, and ligation of sequencing adapters. Size selection of the fragments was performed using AMPure XP beads, and the final cDNA library was enriched through PCR amplification. The constructed library was initially quantified using a Qubit 2.0 (Invitrogen, Shanghai, China), then diluted to 1 ng/µL. The size of the insert fragments was assessed using an Agilent 2100 (Agilent Technologies, Santa Clara, CA, USA), and once the insert sizes met expectations, the effective concentration of the library was accurately quantified by Q-PCR (effective concentration > 2 nM). Sequencing was conducted on the HiSeq 4000 platform (v3.4.0) [15].

2.4. Sequencing Data Analysis

Quality assessment of the raw sequencing data was performed using Fastx_toolkit_0.0.14 software, which included analyses of base quality distribution, base error rate distribution, and A/T/G/C base composition distribution. The raw sequencing data were then filtered to obtain high-quality data using SeqPrep and Sickle software (v1.3.2). Filtered clean reads were aligned to the maize B73 reference genome (AGPv4) using HISAT2 software (v2.2.0). The number of reads mapped to each gene for each sample was calculated using HTSeq (http://htseq.readthedocs.io/en/release_0.9.1, accessed on 26 July 2017). Differential expression analysis was conducted on the read counts using DESeq2 software (v1.24.0), applying the criteria of q ≤ 0.05 and |Log2 fold change| ≥ 1 to identify DEGs between the groups [15].

2.5. Functional Analysis of Maize Genes

Functional annotation of the genes detected in the transcriptome was performed using MaizeGDB (vZm-B73-REFERENCE-NAM-5.0). GO enrichment analysis was conducted using the Goatools software (v1.4.5), employing Fisher’s exact test for statistical significance. The Bonferroni method was applied to adjust the p-values, and GO terms with q ≤ 0.05 were considered significantly enriched. The GO enrichment chord diagram was generated using the GOplot package in R (v1.0.2). For pathway enrichment analysis; the KEGG database was utilized, with Fisher’s method applied for precise testing and the Bonferroni method used to adjust p-values. Significant enrichment of the pathway was considered to exist when q ≤ 0.05. Additionally, transcription factor annotation of maize genes was conducted using PlantTFDB 4.0 (http://planttfdb.cbi.pku.edu.cn/, v5.0), and transcription factor family analysis was performed using HMMER3.1 software with the hmmscan tool [15,16].

2.6. Real-Time Quantitative PCR (qRT-PCR) Analysis

The mRNA was reverse transcribed into complementary DNA (cDNA) using the M5 Super Plus qPCR RT kit with the gDNA remover kit (Mei5 Bioservices Co., Ltd., Beijing, China) [16]. To assess the reliability of the RNA-Seq data, six DEGs were randomly selected for qRT-PCR experiments. Specific primers were designed online using Primer 3.0, and the amplification products ranged from 100 to 250 bp in length and were synthesized by Sangon Biotech (Shanghai, China). The cDNA was used as a template to amplify the internal reference gene Actin. Primers that specifically amplified a single band were selected, and their concentrations were adjusted to approximately 0.2 μM for subsequent experiments. The qRT-PCR analysis was conducted using the TransStart® Top Green qPCR SuperMix kit (Transgen Biotechz, Beijing, China). The specific primers used in this study are listed in Table 1.

3. Results

3.1. Quality Control of Transcriptome Sequencing Data and Alignment to the Reference Genome

The samples were sequenced using the HiSeq 4000 platform, generating raw reads ranging from 70,194,858 to 82,395,920 (Table 2). Following quality control of the raw data, the sequencing error rates for most samples were approximately 0.024%. The analysis of base sequencing error rates revealed that the percentage of Q20 bases ranged from 97.81% to 98.47%, the percentage of Q30 bases ranged from 93.33% to 95.22%, and the GC content ranged from 57.64% to 59.46%. These results suggest that the sequencing data were of high quality. Subsequently, we aligned the reads to the maize B73 reference genome. As shown in Table 3, over 96% of the reads from each sample were successfully aligned to the reference genome, with approximately 93% of these reads mapped to unique positions on the genome.

3.2. Gene Expression Analysis

A total of 20,002, 18,923, and 16,651 gene expressions were detected in the three groups of samples at CK, 24 hpi, and 72 hpi, respectively. Venn diagram analysis (Figure 1A) revealed that 15,401 genes were expressed in all three samples, while 1919 genes were specifically expressed in CK maize leaves, 546 genes were uniquely expressed at 24 hpi, and 412 genes were uniquely expressed at 72 hpi. These findings suggest distinct temporal and spatial variation in gene expression during the maize leaf response to S. turcica infection, with these genes likely playing critical roles in the plant’s response to pathogen invasion. The expression levels of these detected genes were further quantified, and Pearson correlation analysis was performed to assess the pairwise correlation of nine samples across the three groups based on gene expression data. As shown in Figure 1B, the correlation coefficients among the three replicates within each group were all above 0.99, indicating the high reproducibility of the biological replicates and the reliability of the experimental data, validating the experimental design.

3.3. DEGs Identification

To investigate the molecular regulatory mechanisms underlying the response of maize leaves to S. turcica infection, a total of 7169 DEGs were identified at various time points before and after infection. The comparisons between CK, 24 hpi, and 72 hpi yielded 3384, 5769, and 2938 DEGs, respectively. Specifically, in the comparison of 24 hpi vs. CK, 1447 genes were significantly upregulated, and 1937 genes were downregulated. In the 72 hpi vs. CK comparison, 2359 genes were significantly upregulated, while 3410 genes were downregulated. For the comparison of 72 hpi vs. 24 hpi, 1318 genes were significantly upregulated, and 1620 genes were downregulated (Figure 2A). These results indicate that the number of DEGs in maize leaves accumulates over time in response to S. turcica infection, suggesting that the response intensifies as the duration of pathogen invasion increases.
Further Venn analysis of these three groups of DEGs revealed (Figure 2B) that, compared to CK, 553 DEGs were identified at 24 hpi, and 1694 DEGs were identified at 72 hpi. In comparison to 24 hpi, 469 DEGs were identified at 72 hpi. There were 826 common DEGs between the 24 hpi vs. CK and 24 hpi vs. 72 hpi comparisons, 2432 common DEGs between 24 hpi vs. CK and 72 hpi vs. CK, and 2070 common DEGs between 24 hpi vs. CK and 24 hpi vs. 72 hpi. Among all three groups, 427 common DEGs were identified. When examining upregulated and downregulated DEGs separately, the analysis revealed that 461 genes were specifically downregulated at 24 hpi in response to pathogen inoculation, while 554 genes were specifically downregulated at 72 hpi. Additionally, 170 genes were continuously downregulated at both 24 hpi and 72 hpi (Figure 2C). Conversely, 514 genes were specifically upregulated at 24 hpi, 367 genes were specifically upregulated at 72 hpi, and 181 genes were continuously upregulated at both time points (Figure 2D). These results indicate that the response of maize leaves to S. turcica infection is a complex and dynamic process. Some genes are consistently involved throughout the response, while others participate only at specific stages of the infection. Furthermore, the intensity of the response varies among different genes, with some exhibiting strong responses and others demonstrating relatively modest reactions.

3.4. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) Pathway Enrichment Analysis

We further conducted GO and KEGG enrichment analysis to elucidate the functions of DEGs. The GO enrichment analysis revealed that the DEGs at 24 hpi were enriched in 69 GO terms compared to CK, some of which are closely related to the plant response to pathogen invasion (Figure 3A). Notable terms include “L-amino acid catabolic process”, “flavonoid biosynthetic process”, “phenylpropanoid metabolic process”, and “defense response”. All DEGs annotated to the “phenylpropanoid metabolic process” were upregulated, while for the term “defense response”, most of the DEGs were also upregulated. A total of 74 GO terms were enriched for DEGs between 72 hpi and CK, with significant terms related to the plant response to pathogen invasion, including “oxalic acid metabolic process” and “toxin metabolic process”. A higher proportion of genes annotated to these terms were down-regulated (Figure 3B). For the comparison of 72 hpi vs. 24 hpi, the DEGs were enriched with 77 GO terms. Terms such as “phenylpropanoid metabolic process”, “amide biosynthetic process”, and “aromatic amino acid family metabolic process” were notably associated with the plant response to pathogen infection (Figure 3C). Most genes annotated to the “aromatic amino acid family metabolic process” exhibited downregulation at 72 hpi, while a significant number of DEGs related to the “phenylpropanoid metabolic process” were also found to be downregulated.
The KEGG pathway annotation and enrichment analysis indicated that the DEGs at 24 hpi and 72 hpi were enriched in 19 and 13 pathways, respectively, compared to CK (Figure 4A,B). The “biosynthesis of flavonoids, diarylheptanoids, and gingerol”, “phenylpropanoid biosynthesis”, “photosynthesis”, “carbon fixation in photosynthesis”, “biosynthesis of benzoxazinoids”, “starch and sucrose metabolism”, “photosynthesis-antenna proteins”, and “monoterpenoid biosynthesis” were significantly enriched in the DEGs at both 24 hpi and 72 hpi. Additionally, the DEGs at 24 hpi were uniquely enriched in pathways such as “flavonoid biosynthesis” and “plant hormone signal transduction”, while the DEGs at 72 hpi were uniquely enriched in “α-linolenic acid metabolism” and “metabolism of glyoxylic acid and dicarboxylic acids”. Compared to the DEGs from 24 hpi, the DEGs at 72 hpi were enriched in eight pathways (Figure 4C), with uniquely enriched pathways including “biosynthesis of phenylalanine, tyrosine, and tryptophan”, “cysteine and methionine metabolism”, and “glycine, serine, and threonine metabolism”.
Further analysis revealed that a total of 12 genes are annotated in the “biosynthesis of benzoxazinoids” pathway (Figure 5). Among these, 11 genes are differentially expressed. These include the gene ZmBX1 (Zm00001d048709), which encodes indole glycerol phosphate lyase, and its homologs, the tryptophan synthase genes Zm00001d034461 and Zm00001d034453, as well as the indole-3-glycerol phosphate lyase gene ZmIGL (Zm00001d034460). The other differentially expressed genes include the indole-2-monooxygenase genes ZmBX2 (Zm00001d048710) and ZmBX3 (Zm00001d048702), the 3-hydroxyindole-2-ketone monooxygenase gene ZmBX4 (Zm00001d048703), the 2-hydroxy-1,4-benzoxazin-3-one monooxygenase gene ZmBX5 (Zm00001d048705), the UDP-glucosyltransferase genes ZmBX8 (Zm00001d048707) and ZmBX9 (Zm00001d031209), the 2,4-dihydroxy-1,4-benzoxazin-3-one glucosyl double oxygenase gene ZmBX6 (Zm00001d048634), and the 2,4,7-trihydroxy-1,4-benzoxazin-3-one 7-O-methyltransferase gene ZmBX7 (Zm00001d049179). Except for ZmIGL, which showed upregulation at 24 hpi, all other genes exhibited significant downregulation following infection with S. turcica, and most of the DEGs were down-regulated at a higher fold at 72 hpi.

3.5. Transcription Factors Associated with the Response of Maize Leaves to S. turcica Infection

To investigate the regulatory role of transcription factors (TFs) in the response of maize leaves to S. turcica infection, this study analyzed the expression of TFs at different time points before and after pathogen inoculation. A total of 517 TFs showed differential expression following pathogen inoculation (Figure 6). A comparative analysis of the distribution of differentially expressed TFs across families revealed that these genes are distributed among 35 gene families, with notable representation in the WRKY, NAC, MYB_related, MYB, bHLH, and AP2/ERF families, each comprising over 0.5% of the total. Further enrichment analysis indicated that five TF families—HB, NAC, GRAS, LBD (AS2/LOB), and MYB_related were significantly enriched at various time points post-inoculation with S. turcica. The MYB family was significantly enriched in the comparisons of 24 hpi vs. CK and 72 hpi vs. CK, while the WRKY family showed significant enrichment in the 24 hpi vs. CK and 72 hpi vs. 24 hpi comparisons. The AP2/ERF and HSF families were significantly enriched only in the 24 hpi compared to CK, and the bHLH family was significantly enriched only in the 72 hpi in comparison with 24 hpi.

3.6. Validation of DEGs

To validate the RNA-Seq results, six DEGs, including the disease-related protein gene ZmPR6 (Zm00001d028816), the WRKY transcription factor gene ZmWRKY108 (Zm00001d007329), the injury-induced Bowman–Birk proteinase inhibitor (BBI) gene ZmWIP1 (Zm00001d008548), the disease-related sweet protein gene (Zm00001d028400), the phosphoenolpyruvate carboxykinase gene ZmPCK1 (Zm00001d028471), and the thiamine biosynthesis gene ZmTHI2 (Zm00001d028471) were randomly selected for qRT-PCR analysis. As shown in Figure 7, with the exception of Zm0001d028400 and Zm00001d007329 at 72 hpi, the expression trends of the other genes in the qRT-PCR analysis completely aligned with the RNA-Seq results and the correlation coefficient between the two datasets was 0.89 (p = 2.8 × 10−6). These results confirm the high fidelity and consistency of the transcriptome analysis conducted in this study.

4. Discussion

The key to plant defense against pathogen infection is the timely recognition and effective response to stress. The recognition between the host and the pathogen typically occurs within a short timeframe. Currently, RNA-Seq technology, which is based on high-throughput sequencing, has been widely applied to studies of plant–pathogen interactions [17]. However, there has been limited research on the transcriptomic response of maize leaves to the infection process caused by S. turcica. In this study, we identified 3384 and 5769 differentially expressed genes at 24 hpi and 72 hpi using RNA-Seq technology for transcriptomic analysis, respectively (Figure 2A). Additionally, we identified 2938 DEGs identified between the two infection time points (Figure 2A). Many of the identified genes and associated metabolic pathways are linked to plant immune responses. This study investigates the molecular mechanisms underlying the transcriptomic response of maize leaves to S. turcica infection.
Research on primary metabolic changes related to biotic stress has predominantly focused on the role of carbohydrates as products of photosynthesis. Our analysis revealed that the DEGs in maize leaves after infection with S. turcica were significantly enriched in KEGG pathways related to “photosynthesis” and “carbon fixation in photosynthetic organisms” (Figure 4). Two contrasting viewpoints exist regarding how plants regulate photosynthesis during pathogen infection to optimize their defense responses. One perspective posits that biotic stress can enhance photosynthesis. For instance, in sugarcane infected with Xanthomonas albilineans and Acidovorax avenae subsp. avenae, numerous photosynthesis-related genes, such as PSAA1 (encoding one of the PSIP700 apoproteins) and genes related to photosynthetic antenna proteins exhibited upregulation [18,19]. It is hypothesized that the increase in photosynthetic activity may be attributed to two primary reasons: first, the synthesis of defensive metabolites requires carbon fixation, and second, enhancing photosynthetic activity may compensate for the leaf area loss caused by the disease. The alternative viewpoint posits that to prevent pathogen infection, plants often reallocate resources from growth to defense responses, whereby a reduction in photosynthetic capacity may represent an “invisible cost” of the plant’s defense against pathogens [20,21]. An analysis of transcriptomic data from eight different plant species infected by 22 different pathogens (including arthropods, fungi, bacteria, and viruses) found that, despite variations in pathogens, hosts, and sample collection times, damage to plant leaves resulted in almost universal downregulation of photosynthesis-related genes [22]. It is speculated that the widespread downregulation of photosynthesis-related genes following pathogen infection may be essential for supporting the induced defense responses, as it minimizes investment in photosynthetic proteins.
Benzoxazinoids (BXs) are a class of secondary metabolites present in maize and other cereals, whose biosynthesis is primarily regulated by developmental cues [23]. Furthermore, numerous studies have indicated that BXs are involved in plant defense against herbivorous insects and pathogen infections [24]. In this study, RNA-Seq analysis revealed that, with the exception of the ZmBX9 gene, all other genes associated with BX synthesis were downregulated to varying degrees in maize leaves following infection with S. turcica, most exhibiting greater downregulation at 72 hpi (Figure 5). This indicates that the expression levels of benzoxazinoids and their associated biosynthetic pathway genes are closely related to maize’s response to the pathogen, which is consistent with previous findings. Earlier research demonstrated that at relatively early stages of infection (48 hpi), the accumulation of benzoxazinoids, such as DIMBOA-glc, DIMBOA, and HDMBOA-glc, in maize chloroplasts significantly increased, thereby enhancing resistance to the germination and infection of the pathogen’s conidia [25]. However, more recent studies by Beat Keller and colleagues found no significant changes in the levels of HDMBOA-Glc in maize leaves following pathogen inoculation; instead, the concentrations of DIMBOA, DIMBOA-Glc, and DIM 2 BOA-Glc decreased [26]. The primary reason for these differing results may be that the earlier study measured BX levels in the chloroplasts of maize leaves, whereas Beat Keller’s research assessed BX levels in whole maize leaf tissues. Additionally, the former utilized leaves from 8-day-old germinated maize seedlings, whereas the latter examined leaves from 5-week-old maize plants. Although these studies present inconsistent correlations between BX levels and maize resistance to S. turcica, both indicate that the transcriptional expression of BX synthesis-related genes is closely linked to maize’s defensive responses against pathogens. Research by Jurriaan Ton and colleagues reported that the changes in BX levels in maize following stimulation with chitin, a common PAMP from pathogenic fungi, were similar to those observed after inoculation with S. turcica, with most BX synthesis-related genes showing downregulation [25]. In Beat Keller’s study, mutations in BX synthesis-related genes (ZmBX1, ZmBX2, and ZmBX6) actually enhanced resistance to NCLB [26].
Upon sensing pathogen invasion signals, downstream defense response genes in plants are typically regulated positively or negatively by TFs. Among these TFs, WRKY genes play a critical role in biological responses, participating in the protective reactions of plants against various pathogens and being important factors in plant immunity [27]. In this study, WRKY was one of the most abundant TF gene families detected among the DEGs. Following infection with S. turcica, 40 WRKY transcription factor genes in maize leaves showed differential expression at least at 24 hpi or 72 hpi, with 16 of these genes being induced and upregulated (Figure 6). Previous studies have reported that infections by fungi, bacteria, and viruses can induce the upregulation of WRKY gene expression levels and enhance DNA-binding activity. For instance, WRKY22/29 functions as downstream TFs of MPK3/MPK6 in the immune defense process during pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI) induced by the bacterial flg22 in the model plant Arabidopsis thaliana [28]. In the monocot model plant Oryza sativa (rice), OsWRKY13 positively mediates rice’s defense responses against Xanthomonas oryzae pv. oryzae (bacterial blight) and Magnaporthe oryzae (blast fungus) [29]. Other WRKYs, including OsWRKY6, OsWRKY51, and OsWRKY71, also actively mediate resistance against bacterial blight [30,31]. Conversely, OsWRKY28, OsWRKY62, and OsWRKY76 play a negative regulatory role in rice’s responses to blast fungus or bacterial blight [32].
In addition to WRKY, other TF families such as NAC, MYB-related, bHLH, AP2/ERF, LBD, and GRAS also exhibited significant differential expression following pathogen inoculation. NAC transcription factors play a dual role in regulating jasmonic acid and abscisic acid-dependent responses, and they are also involved in interactions with pathogens [33]. For example, the lily NAC transcription factor LrNAC35 contributes to the defense response against cucumber mosaic virus and tobacco mosaic virus [34]. In wheat (Triticum aestivum), NAC21/22 is implicated in plant susceptibility to diseases [35]. Overexpression of the NAC gene SmNAC from eggplant (Solanum melongena) reduced resistance to bacterial wilt [36]. Induction or repression of MYB factors are the fundamentals of the regulatory mechanism in response to biotic stress [37]. LBD proteins, a family of plant-specific transcription factors characterized by a highly conserved LOB domain, play crucial roles in regulating in higher plants [38]. GhLBD41, a lateral organ boundaries transcription factor, positively regulates plants’ resistance to Verticillium dahliae via the jasmonic acid signaling pathway [38]. GRAS plays an important role in plant biotic stress resistance. The GRAS genes S1GRAS4 and S1GRAS6 in tomatoes are upregulated in response to the fungal elicitor EIX, suggesting that GRAS genes play important roles in plant defense against pathogens [39]. Similarly, during the interaction between tomato plants and phytopathogenic bacteria, the expression of GRAS genes suggests that these genes could be involved in the mechanism that activates plant defense responses [39]. Nevertheless, most GRAS subfamily genes remain unresolved, and further investigations are needed to understand GRAS gene interactions with plant defense systems.
Randomly selected genes also play important regulatory roles in plant defense pathways. Plant protease inhibitors are small molecular proteins or peptides that can inhibit the activity of proteolytic enzymes and serve as important defense proteins against pathogen invasion [40]. For instance, the wound-induced protein1 (ZmWIP1, Zm00001d008548), which is associated with hypersensitivity reaction (HR) defense response in maize, was up-regulated by 3.51-fold at 24 hpi and 12.55-fold at 72 hpi, indicating the important role of ZmWIP1 for maize response to S. turcica. The kiwifruit thaumatin-like protein (Zm00001d028400) is a member of the pathogenesis-related (PR) protein family, as its amino acid sequence shows high homology with thaumatins from the West African shrub (Thaumatococcus daniellii). Hence, it is also referred to as a thaumatin-like protein (TLP) [41]. PR proteins are classified into 17 categories, including PR-9, 15, and 16, which encode oxidases and oxidoreductases; PR-3, 4, 8, and 11, which encode chitinases; PR-2, which encodes β-1,3-glucanase; PR-7, which encodes proteases; PR-6, which encodes protease inhibitors; PR-14, which encodes lipid transfer proteins; PR-10, which encodes ribonuclease-like proteins; PR-12 and 13, which encode defensins and sulfur proteins; PR-5, which encodes thaumatin-like proteins; and PR-1 and PR-17, which are less studied and functionally unclassified [42]. Studies have shown that thaumatin-like proteins are involved in active defense responses of plants following infection by pathogenic fungi [7]. Several antifungal thaumatin-like proteins, such as tobacco osmotin, maize zeamatin, barley hordomatin, and wheat trimatin, induce pore formation in fungal cell membranes, thereby exerting antifungal activity [43,44]. WRKY transcription factors (TFs) are essential players in several signaling cascades and regulatory networks that have crucial implications for defense responses in plants [45]. Phosphoenolpyruvate carboxykinase (PEPCK) is an important metabolic regulatory enzyme in flowering plants and a key enzyme in the C4 photosynthetic pathway of C4 plants. The ZmPCK1 gene is an essential gene in the C4 photosynthetic pathway of maize [45]. Photosynthesis is one of the critical responses of maize to infection by S. turcica, the causal agent of NCLB.

5. Conclusions

Transcriptional profiling of maize leaves inoculated with S. turcica at different time points (0, 24, and 72 hpi) revealed that 7196 genes were differentially expressed compared to the control (CK, 0 hpi) during the maize response to pathogen infection. Functional analysis indicated that these DEGs were involved in multiple metabolic pathways. Notably, genes related to “benzoxazinoid biosynthesis”, “tetrapyrrole biosynthesis”, and “photosynthesis” exhibited downregulation, while genes in the “phenolic metabolism” and “phenylpropanoid metabolism” pathways showed upregulation. The TF gene families, including NAC, MYB-related, HB, and WRKY, were significantly enriched among the DEGs following pathogen inoculation. To validate the reproducibility of the transcriptomic data, six randomly selected DEGs were analyzed using qRT-PCR, confirming the reliability of the findings. This study provides a theoretical basis for further elucidating the molecular mechanisms by which maize defends itself against pathogenic fungal infections.

Author Contributions

Conceptualization, H.J., B.T., P.L., Y.L. and J.D.; Methodology, B.T., Z.L., M.Z., H.Z. and M.W.; Formal analysis, B.T., Y.L., Z.L., M.Z., H.Z. and M.W.; Investigation, Z.L., M.Z., H.Z. and M.W.; Writing—original draft, H.J. and P.L.; Writing—review and editing, H.J., P.L., Y.L., J.D., S.G. and X.G.; Supervision, S.G.; Project administration, H.J., J.D. and X.G.; Funding acquisition, Y.L., S.G. and X.G. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Natural Science Foundation of Hebei (C2023204100), Basic Research Projects of Universities in Hebei Province Funded by Shijiazhuang (241791197A), Hebei Provincial Central Leading Local Science and Technology Development Fund Project (236Z6507G), Open Foundation of Collaborative Innovation Center for Wetland Conservation, and Green Development of Hebei Province (2023hbxczx2-2).

Data Availability Statement

The RNA-Seq data are available under accession number PRJNA1185298 on the NCBI server (https://www.ncbi.nlm.nih.gov/bioproject/PRJNA1185298, accessed on 29 December 2024).

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Mishra, M.; Sushma; Sharma, R. Corn (Zea mays) as a nutrient source and diet: A review. Br. J. Pharm. Res. 2021, 149, 299–303. [Google Scholar] [CrossRef]
  2. Li, P.; Shen, S.; Jia, J.; Sun, H.; Zhu, H.; Wei, N.; Yu, B.; Sohail, A.; Wu, D.; Zeng, F.; et al. The catalytic subunit of type 2A protein phosphatase negatively regulates conidiation and melanin biosynthesis in Setosphaeria turcica. Int. J. Biol. Macromol. 2024, 266, 131149. [Google Scholar] [CrossRef] [PubMed]
  3. Niehl, A.; Wyrsch, I.; Boller, T.; Heinlein, M. Double-stranded RNAs induce a pattern-triggered immune signaling pathway in plants. New Phytol. 2016, 211, 1008–1019. [Google Scholar] [CrossRef]
  4. Tsuda, K.; Somssich, I.E. Transcriptional networks in plant immunity. New Phytol. 2015, 206, 932–947. [Google Scholar] [CrossRef] [PubMed]
  5. Zhang, H.; Gao, Z.; Zheng, X.; Zhang, Z. The role of G-proteins in plant immunity. Plant Signal. Behav. 2012, 7, 1284–1288. [Google Scholar] [CrossRef]
  6. Trümper, C.; Paffenholz, K.; Smit, I.; Kössler, P.; Karlovsky, P.; Braun, H.P.; Pawelzik, E. Identification of regulated proteins in naked barley grains (Hordeum vulgare nudum) after Fusarium graminearum infection at different grain ripening stages. J. Proteom. 2016, 133, 86–92. [Google Scholar] [CrossRef]
  7. Batalia, M.A.; Monzingo, A.F.; Ernst, S.; Roberts, W.; Robertus, J.D. The crystal structure of the antifungal protein zeamatin, a member of the thaumatin-like, PR-5 protein family. Nat. Struct. Biol. 1996, 3, 19–23. [Google Scholar] [CrossRef] [PubMed]
  8. Chang, C.; Yu, D.; Jiao, J.; Jing, S.; Schulze-Lefert, P.; Shen, Q.H. Barley MLA immune receptors directly interfere with antagonistically acting transcription factors to initiate disease resistance signaling. Plant Cell 2013, 25, 1158–1173. [Google Scholar] [CrossRef]
  9. Lozano-Durán, R.; Macho, A.P.; Boutrot, F.; Segonzac, C.; Somssich, I.E.; Zipfel, C. The transcriptional regulator BZR1 mediates trade-off between plant innate immunity and growth. eLife 2013, 2, e00983. [Google Scholar] [CrossRef] [PubMed]
  10. Wang, Z.; Gerstein, M.; Snyder, M. RNA-Seq: A revolutionary tool for transcriptomics. Nat. Rev. Genet. 2009, 10, 57–63. [Google Scholar] [CrossRef]
  11. Trapnell, C.; Williams, B.A.; Pertea, G.; Mortazavi, A.; Kwan, G.; van Baren, M.J.; Salzberg, S.L.; Wold, B.J.; Pachter, L. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat. Biotechnol. 2010, 28, 511–515. [Google Scholar] [CrossRef]
  12. Zhang, J.; Chen, L.; Fu, C.; Wang, L.; Liu, H.; Cheng, Y.; Li, S.; Deng, Q.; Wang, S.; Zhu, J.; et al. Comparative transcriptome analyses of gene expression changes triggered by Rhizoctonia solani AG1 IA infection in resistant and susceptible rice varieties. Front. Plant Sci. 2017, 8, 1422. [Google Scholar] [CrossRef]
  13. Zrenner, R.; Verwaaijen, B.; Genzel, F.; Flemer, B.; Grosch, R. Transcriptional changes in potato sprouts upon interaction with Rhizoctonia solani indicate pathogen-induced interference in the defence pathways of potato. Int. J. Mol. Sci. 2021, 22, 3094. [Google Scholar] [CrossRef] [PubMed]
  14. Li, P.; Zhu, H.; Wang, C.; Zeng, F.; Jia, J.; Feng, S.; Han, X.; Shen, S.; Wang, Y.; Hao, Z.; et al. StRAB4 gene is required for filamentous growth, conidial development, and pathogenicity in Setosphaeria turcica. Front. Microbiol. 2024, 14, 1302081. [Google Scholar] [CrossRef] [PubMed]
  15. Meng, Y.; Zeng, F.; Hu, J.; Li, P.; Xiao, S.; Zhou, L.; Gong, J.; Liu, Y.; Hao, Z.; Cao, Z.; et al. Novel factors contributing to fungal pathogenicity at early stages of Setosphaeria turcica infection. Mol. Plant Pathol. 2022, 23, 2–44. [Google Scholar] [CrossRef] [PubMed]
  16. Rowland, B.E.; Henriquez, M.A.; Nilsen, K.T.; Subramaniam, R.; Walkowiak, S. Unraveling plant-pathogen interactions in cereals using RNA-seq. Methods Mol. Biol. 2023, 2659, 103–118. [Google Scholar]
  17. Chu, N.; Zhou, J.R.; Fu, H.Y.; Huang, M.T.; Zhang, H.L.; Gao, S.J. Global gene responses of resistant and susceptible sugarcane cultivars to Acidovorax avenae subsp. avenae identified using comparative transcriptome analysis. Microorganisms 2020, 8, 10. [Google Scholar] [CrossRef]
  18. Meng, J.Y.; Ntambo, M.S.; Rott, P.C. Identification of differentially expressed proteins in sugarcane in response to infection by Xanthomonas albilineans using iTRAQ quantitative proteomics. Microorganisms 2020, 8, 76. [Google Scholar] [CrossRef] [PubMed]
  19. Bilgin, D.D.; Aldea, M.; O’Neill, B.F.; Benitez, M.; Li, M.; Clough, S.J.; DeLucia, E.H. Elevated ozone alters soybean-virus interaction. Mol. Plant-Microbe Interact. 2008, 21, 1297–1308. [Google Scholar] [CrossRef]
  20. Nabity, P.D.; Zavala, J.A.; DeLucia, E.H. Indirect suppression of photosynthesis on individual leaves by arthropod herbivory. Ann. Bot. 2009, 103, 655–663. [Google Scholar] [CrossRef]
  21. Bilgin, D.D.; Zavala, J.A.; Zhu, J.; Clough, S.J.; Ort, D.R.; DeLucia, E.H. Biotic stress globally downregulates photosynthesis genes. Plant Cell Environ. 2010, 33, 1597–1613. [Google Scholar] [CrossRef]
  22. Köhler, A.; Maag, D.; Veyrat, N.; Glauser, G.; Wolfender, J.L.; Turlings, T.C.; Erb, M. Within-plant distribution of 1,4-benzoxazin-3-ones contributes to herbivore niche differentiation in maize. Plant Cell Environ. 2015, 38, 1081–1093. [Google Scholar] [CrossRef] [PubMed]
  23. Niemeyer, H.M. Hydroxamic acids derived from 2-hydroxy-2H-1,4-benzoxazin-3(4H)-one: Key defense chemicals of cereals. J. Agric. Food Chem. 2009, 57, 1677–1696. [Google Scholar] [CrossRef]
  24. Ahmad, S.; Veyrat, N.; Gordon-Weeks, R.; Zhang, Y.; Martin, J.; Smart, L.; Glauser, G.; Erb, M.; Flors, V.; Frey, M.; et al. Benzoxazinoid metabolites regulate innate immunity against aphids and fungi in maize. Plant Physiol. 2011, 157, 317–327. [Google Scholar] [CrossRef] [PubMed]
  25. Yang, P.; Praz, C.; Li, B.; Singla, J.; Robert, C.A.M.; Kessel, B.; Scheuermann, D.; Lüthi, L.; Ouzunova, M.; Erb, M.; et al. Fungal resistance mediated by maize wall-associated kinase ZmWAK-RLK1 correlates with reduced benzoxazinoid content. New Phytol. 2019, 221, 976–987. [Google Scholar] [CrossRef] [PubMed]
  26. Pandey, S.P.; Somssich, I.E. The role of WRKY transcription factors in plant immunity. Plant Physiol. 2009, 150, 1648–1655. [Google Scholar] [CrossRef]
  27. Asai, T.; Tena, G.; Plotnikova, J.; Willmann, M.R.; Chiu, W.L.; Gomez-Gomez, L.; Boller, T.; Ausubel, F.M.; Sheen, J. MAP kinase signalling cascade in Arabidopsis innate immunity. Nature 2002, 415, 977–983. [Google Scholar] [CrossRef]
  28. Qiu, D.; Xiao, J.; Ding, X.; Xiong, M.; Cai, M.; Cao, Y.; Li, X.; Xu, C.; Wang, S. OsWRKY13 mediates rice disease resistance by regulating defense-related genes in salicylate- and jasmonate-dependent signaling. Mol. Plant-Microbe Interact. 2007, 20, 492–499. [Google Scholar] [CrossRef]
  29. Choi, C.; Hwang, S.H.; Fang, I.R.; Kwon, S.I.; Park, S.R.; Ahn, I.; Kim, J.B.; Hwang, D.J. Molecular characterization of Oryza sativa WRKY6, which binds to W-box-like element 1 of the Oryza sativa pathogenesis-related (PR) 10a promoter and confers reduced susceptibility to pathogens. New Phytol. 2015, 208, 846–859. [Google Scholar] [CrossRef] [PubMed]
  30. Hwang, S.H.; Kwon, S.I.; Jang, J.Y.; Fang, I.L.; Lee, H.; Choi, C.; Park, S.; Ahn, I.; Bae, S.C.; Hwang, D.J. OsWRKY51, a rice transcription factor, functions as a positive regulator in defense response against Xanthomonas oryzae pv. Oryzae. Plant Cell Rep. 2016, 35, 1975–1985. [Google Scholar] [CrossRef] [PubMed]
  31. Chujo, T.; Miyamoto, K.; Shimogawa, T.; Shimizu, T.; Otake, Y.; Yokotani, N.; Nishizawa, Y.; Shibuya, N.; Nojiri, H.; Yamane, H.; et al. OsWRKY28, a PAMP-responsive transrepressor, negatively regulates innate immune responses in rice against rice blast fungus. Plant Mol Biol. 2013, 82, 23–37. [Google Scholar] [CrossRef]
  32. Zhang, H.; Kang, H.; Su, C.; Qi, Y.; Liu, X.; Pu, J. Genome-wide identification and expression profile analysis of the NAC transcription factor family during abiotic and biotic stress in woodland strawberry. PLoS ONE 2018, 13, e0197892. [Google Scholar] [CrossRef]
  33. Sun, D.; Zhang, X.; Zhang, Q.; Ji, X.; Jia, Y.; Wang, H.; Niu, L.; Zhang, Y. Comparative transcriptome profiling uncovers a Lilium regale NAC transcription factor, LrNAC35, contributing to defence response against cucumber mosaic virus and tobacco mosaic virus. Mol. Plant Pathol. 2019, 20, 1662–1681. [Google Scholar] [CrossRef]
  34. Feng, H.; Duan, X.; Zhang, Q.; Li, X.; Wang, B.; Huang, L.; Wang, X.; Kang, Z. The target gene of tae-miR164, a novel NAC transcription factor from the NAM subfamily, negatively regulates resistance of wheat to stripe rust. Mol. Plant Pathol. 2014, 15, 284–296. [Google Scholar] [CrossRef]
  35. Na, C.; Shuanghua, W.; Jinglong, F.; Bihao, C.; Jianjun, L.; Changming, C.; Jin, J. Overexpression of the eggplant (Solanum melongena) NAC family transcription factor SmNAC suppresses resistance to bacterial wilt. Sci. Rep. 2016, 6, 31568. [Google Scholar] [CrossRef] [PubMed]
  36. Biswas, D.; Gain, H.; Mandal, A. MYB transcription factor: A new weapon for biotic stress tolerance in plants. Plant Stress 2023, 10, 100252. [Google Scholar] [CrossRef]
  37. Hu, Q.; Wu, D.; Hong, T.; Wang, L.; Wang, S.; Ren, Q. GhLBD41, a lateral organ boundaries transcription factor, positively regulates plants resistance to Verticillium dahliae via the jasmonic acid signaling pathway. Ind. Crops Prod. 2024, 222, 119939. [Google Scholar] [CrossRef]
  38. Khan, Y.; Xiong, Z.; Zhang, H.; Yaseen, T.; Hui, T. Expression and roles of GRAS gene family in plant growth, signal transduction, biotic and abiotic stress resistance and symbiosis formation—A review. Plant Biol. 2022, 24, 404–416. [Google Scholar] [CrossRef]
  39. Qu, L.; Chen, J.; Liu, M.; Pan, N.; Okamoto, H.; Lin, Z.; Li, C.; Li, D.; Wang, J.; Zhu, G.; et al. Molecular cloning and functional analysis of a novel type of Bowman-Birk inhibitor gene family in rice. Plant Physiol. 2003, 133, 560–570. [Google Scholar] [CrossRef]
  40. Wel, H.V.D.; Loeve, K. Isolation and characterization of thaumatin I and II, the sweet-tasting proteins from Thaumatococcus daniellii Benth. Eur. J. Biochem. 1972, 31, 221–225. [Google Scholar] [PubMed]
  41. Sinha, M.; Singh, R.P.; Kushwaha, G.S.; Iqbal, N.; Singh, A.; Kaushik, S.; Kaur, P.; Sharma, S.; Singh, T.P. Current overview of allergens of plant pathogenesis related protein families. Sci. World J. 2014, 16, 543195. [Google Scholar] [CrossRef]
  42. Abada, L.R.; D’Urzo, M.P.; Liua, D.; Narasimhan, M.L.; Reuveni, M.; Zhua, J.K.; Niua, X.; Singhb, N.K.; Hasegawaa, P.M.; Bressan, R.A. Antifungal activity of tobacco osmotin has specificity and involves plasma membrane permeabilization. Plant Sci. 1996, 118, 11–23. [Google Scholar] [CrossRef]
  43. Roberts, W.K.; Selitrennikoff, C.P. Zeamatin, an antifungal protein from maize with membrane-permeabilizing activity. J. Gen. Microbiol. 1990, 136, 1771–1778. [Google Scholar] [CrossRef]
  44. Javed, T.; Gao, S. WRKY transcription factors in plant defense. Trends Genet. 2023, 39, 787–801. [Google Scholar] [CrossRef] [PubMed]
  45. Shen, Z.; Dong, X.; Gao, Z.; Chao, Q.; Wang, B. Phylogenic and phosphorylation regulation difference of phosphoenolpyruvate carboxykinase of C3 and C4 plants. J. Plant Physiol. 2017, 213, 16–22. [Google Scholar] [CrossRef]
Figure 1. Statistical analysis of expressed genes detected by RNA-seq. (A) Venn analysis of expressed genes between sequencing sample groups. (B) Analysis of correlation between sequencing samples, with colors indicating the level of correlation.
Figure 1. Statistical analysis of expressed genes detected by RNA-seq. (A) Venn analysis of expressed genes between sequencing sample groups. (B) Analysis of correlation between sequencing samples, with colors indicating the level of correlation.
Agronomy 15 00069 g001
Figure 2. Counting and Venn diagrams showing the DEGs. (A) Number of DEGs. Blue indicates up-regulated gene expression, and red indicates down-regulated gene expression. (B) The total DEGs. (C) Up-regulated DEGs. (D) Down-regulated DEGs.
Figure 2. Counting and Venn diagrams showing the DEGs. (A) Number of DEGs. Blue indicates up-regulated gene expression, and red indicates down-regulated gene expression. (B) The total DEGs. (C) Up-regulated DEGs. (D) Down-regulated DEGs.
Agronomy 15 00069 g002
Figure 3. Enriched GO terms analyses of DEGs in Zea mays L. during early infection by S. turcica. In the left half of the GO chord diagram, genes are displayed, with red indicating upregulated expression and blue indicating downregulated expression. The left half of the diagram also displays the enriched GO terms, with different colors representing distinct GO terms. The inner circle connections represent the associations between genes and GO terms, with the line color corresponding to the enriched GO term. The log2 fold change (log2FC) indicates the magnitude of gene expression differences, with larger values and deeper red indicating greater upregulation, and smaller values and deeper blue indicating greater downregulation. (A) CK vs. 24 hpi functional enrichment analysis. (B) CK vs. 72 hpi functional enrichment analysis. (C) 24 hpi vs. 72 hpi functional enrichment analysis.
Figure 3. Enriched GO terms analyses of DEGs in Zea mays L. during early infection by S. turcica. In the left half of the GO chord diagram, genes are displayed, with red indicating upregulated expression and blue indicating downregulated expression. The left half of the diagram also displays the enriched GO terms, with different colors representing distinct GO terms. The inner circle connections represent the associations between genes and GO terms, with the line color corresponding to the enriched GO term. The log2 fold change (log2FC) indicates the magnitude of gene expression differences, with larger values and deeper red indicating greater upregulation, and smaller values and deeper blue indicating greater downregulation. (A) CK vs. 24 hpi functional enrichment analysis. (B) CK vs. 72 hpi functional enrichment analysis. (C) 24 hpi vs. 72 hpi functional enrichment analysis.
Agronomy 15 00069 g003
Figure 4. Enriched KEGG pathways analyses of DEGs in Zea mays L. during early infection by S. turcica. (A) 24 hpi vs. CK KEGG enrichment analysis of the differentially expressed genes. (B) 72 hpi vs. CK KEGG enrichment analysis of the differentially expressed genes. (C) 72 hpi vs. 24 hpi KEGG enrichment analysis of the differentially expressed genes.
Figure 4. Enriched KEGG pathways analyses of DEGs in Zea mays L. during early infection by S. turcica. (A) 24 hpi vs. CK KEGG enrichment analysis of the differentially expressed genes. (B) 72 hpi vs. CK KEGG enrichment analysis of the differentially expressed genes. (C) 72 hpi vs. 24 hpi KEGG enrichment analysis of the differentially expressed genes.
Agronomy 15 00069 g004
Figure 5. Benzoxazinoids biosynthesis pathway analyses of DEGs in Zea mays L. during infection by S. turcica.
Figure 5. Benzoxazinoids biosynthesis pathway analyses of DEGs in Zea mays L. during infection by S. turcica.
Agronomy 15 00069 g005
Figure 6. The family distribution of differentially expressed transcription factor gene in responses to S. turcica inoculation. The gray background represents the distribution of all expressed genes in each transcription factor family; the color line graph represents the distribution of differentially expressed genes in each transcription factor family; * represents q ≤ 0.05; **represents q ≤ 0.01; *** represents q ≤ 0.001.
Figure 6. The family distribution of differentially expressed transcription factor gene in responses to S. turcica inoculation. The gray background represents the distribution of all expressed genes in each transcription factor family; the color line graph represents the distribution of differentially expressed genes in each transcription factor family; * represents q ≤ 0.05; **represents q ≤ 0.01; *** represents q ≤ 0.001.
Agronomy 15 00069 g006
Figure 7. Real-time qPCR validation of representative genes at three-time points in Zea mays L. during infection by S. turcica. The left Y axis corresponds to the gene expression level in transcriptome sequencing shown in broken lines. The right Y axis corresponds to the relative gene expression level in qRT-PCR shown in a column. Reference gene: β-actin; n = 3.
Figure 7. Real-time qPCR validation of representative genes at three-time points in Zea mays L. during infection by S. turcica. The left Y axis corresponds to the gene expression level in transcriptome sequencing shown in broken lines. The right Y axis corresponds to the relative gene expression level in qRT-PCR shown in a column. Reference gene: β-actin; n = 3.
Agronomy 15 00069 g007
Table 1. The primers of real-time PCR.
Table 1. The primers of real-time PCR.
Gene IDForward Primer Sequence (5′-3′)Revers Primer Sequence(3′-5′)
ActinCTCGACTCTGGTGATGGTGTGTCGTACTCCGCCTTGGAGAT
Zm00001d007329CTACCGCTGGAGGAAGTACGGACTTCTCGATGGGGTGTGT
Zm00001d 008548AGCAAGGCCATCGACATCAACGGTGCACCTGAACTTGTTG
Zm00001d 028400CCCTGTGTGTGTGTGTGTCTTAGCCGCAGTTGTTGGTCAT
Zm00001d 028816CAACTTCACCTCAGCCATGCTCGGCAGCCTTGAAGATGTT
Zm00001d 028471ATCATCGACGCCATCCACTCAGGATCTCGTCAGTCAGGCT
Zm00001d 044228ATGAAGGCGCTCGACATGAACCTTCTGGCCGGAGATCATC
ZmPRP4GACTGCCAGCTGATCCACTCGGGTTGTAGCTGCAGATGATGA
ZmPRP5TGCTCCTTCAACGGCAACAATGGGTCTTCATGTCGGGG
Table 2. Statistical analysis of RNA-seq data.
Table 2. Statistical analysis of RNA-seq data.
SampleRaw ReadsClean ReadsError Rate (%)Q20 (%)Q30 (%)GC Content (%)
CK_181,110,14280,277,5720.024398.3394.8458.88
CK_282,395,92081,583,8380.023998.4795.2258.67
CK_376,626,05076,025,3180.025797.8193.3358.82
24 hpi_180,029,71479,359,5420.024298.3894.9657.64
24 hpi_272,852,03072,220,5340.024298.3494.8957.94
24 hpi_370,194,85869,503,1160.024298.3794.9457.93
72 hpi_173,677,81472,927,2500.024498.2994.7559.04
72 hpi_271,306,37070,702,2240.02498.4695.1959.46
72 hpi_380,319,75479,733,0480.02498.4595.1659.08
Q20: Ratio of bases with a base calling error less than 0.01; Q30: Ratio of bases with a base calling error less than 0.001.
Table 3. The results of clean read alignment to maize reference genome.
Table 3. The results of clean read alignment to maize reference genome.
SampleClean ReadsTotal MappedMultiple MappedUniquely Mapped
CK_180,277,57277,494,595 (96.53%)2,622,080 (3.27%)74,872,515 (93.27%)
CK_281,583,83878,728,575 (96.5%)2,649,425 (3.25%)76,079,150 (93.25%)
CK_376,025,31873,396,315 (96.54%)2,463,607 (3.24%)70,932,708 (93.3%)
24 hpi_179,359,54276,814,670 (96.79%)3,138,785 (3.96%)73,675,885 (92.84%)
24 hpi_272,220,53469,708,082 (96.52%)2,775,393 (3.84%)66,932,689 (92.68%)
24 hpi_369,503,11667,061,517 (96.49%)2,725,240 (3.92%)64,336,277 (92.57%)
72 hpi_172,927,25070,248,542 (96.33%)2,426,555 (3.33%)67,821,987 (93.0%)
72 hpi_270,702,22468,274,476 (96.57%)2,459,032 (3.48%)65,815,444 (93.09%)
72 hpi_379,733,04877,049,838 (96.63%)2,657,470 (3.33%)74,392,368 (93.3%)
Total mapped: the number of Clean reads that can be located on the genome; Multiple mapped: the number of Clean reads with multiple alignment positions on the reference sequence; Uniquely mapped: there are on the reference sequence The number of clean reads in the only matching position.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Jia, H.; Li, P.; Tao, B.; Liu, Y.; Liu, Z.; Zhu, M.; Zhou, H.; Wang, M.; Dong, J.; Gu, S.; et al. Transcriptomics Analysis of Maize (Zea mays L.) in Response to the Infection by Setosphaeria turcica. Agronomy 2025, 15, 69. https://doi.org/10.3390/agronomy15010069

AMA Style

Jia H, Li P, Tao B, Liu Y, Liu Z, Zhu M, Zhou H, Wang M, Dong J, Gu S, et al. Transcriptomics Analysis of Maize (Zea mays L.) in Response to the Infection by Setosphaeria turcica. Agronomy. 2025; 15(1):69. https://doi.org/10.3390/agronomy15010069

Chicago/Turabian Style

Jia, Hui, Pan Li, Bu Tao, Yuwei Liu, Zhihang Liu, Mengfang Zhu, He Zhou, Maocun Wang, Jingao Dong, Shouqin Gu, and et al. 2025. "Transcriptomics Analysis of Maize (Zea mays L.) in Response to the Infection by Setosphaeria turcica" Agronomy 15, no. 1: 69. https://doi.org/10.3390/agronomy15010069

APA Style

Jia, H., Li, P., Tao, B., Liu, Y., Liu, Z., Zhu, M., Zhou, H., Wang, M., Dong, J., Gu, S., & Gong, X. (2025). Transcriptomics Analysis of Maize (Zea mays L.) in Response to the Infection by Setosphaeria turcica. Agronomy, 15(1), 69. https://doi.org/10.3390/agronomy15010069

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop