Abstract
The application of biochar is one of the promising management practices to alleviate soil acidification and improve soil fertility. However, it has been found to reduce the content of ammonium nitrogen (−N) in the soil, which is the most important form of nitrogen (N) for tea tree growth. To investigate the response of soil −N content to the combined application of biochar and pruned tea plant litter, a pot trial was performed with three treatments: control (CK); biochar (BC); biochar + tea plant litter (BC + L). Soil chemistry properties and ammonification rates were determined, and the microbial community composition was analyzed by high-throughput sequencing. The results showed that the −N content in BC + L treatment was 1.7–9.5 fold higher than CK and BC treatments after 15 days of application, with no difference in the proportion of ammonia oxidation phyla such as Nitrospirae. The proportion of soil fungus Ascomycota was strongly correlated with the content of soil available nitrogen (p = 0.032), and the relationship was well described by a linear equation (R2 = 0.876, p = 0.01). Further redundancy analysis revealed that soil pH, soil organic carbon (SOC), the ratio of SOC to total nitrogen and the ratio of SOC to alkaline hydrolyzable nitrogen appeared to be important factors influencing the separation of BC + L from CK and BC groups. In summary, the addition of biochar and pruned tea plant litter alters soil properties and may influence the composition of microorganisms with various trophic groups, thus affecting ecosystem function. Our results also highlight the importance of returning pruned materials with biochar application in tea plantation ecosystems.
1. Introduction
Tea plant (Camellia sinensis L.) is an important economic crop in tropical and subtropical zones, including Asia and Africa, with about one million hectares of tea plantations worldwide [1]. Soil acidification is a major problem in intensive tea plantation systems, and its degree positively correlates with years of tea planting [2,3]. Soil acidification can cause low soil productivity and a series of environmental problems, such as ammonium nitrogen (−N) and nitrate nitrogen (NO3−−N) leaching and N2O emissions [4,5]. Wang et al. (2010) [2] and Börjesson et al. (2012) [6] reported the contradiction between the preferential absorption of −N for tea plants and the rapid nitrification in the soil, causing tea farmers to use large amounts of chemical nitrogen (N) fertilizer in order to maintain the yield and the content of amino acid (an important quality-related compound) in the leaves. Excessive N supply, which can reach 745 kg N ha−1 yr−1 in some areas of China [7], further stimulated nitrification and then contributed substantially to this deterioration.
Biochar, a carbon-rich material originally designed for carbon sequestration and agricultural waste reduction, has been proven to be effective in soil acidity amelioration, soil fertility enhancement and greenhouse gas reduction [8,9,10,11]. Yuan and Xu (2015) [12] indicated that the increases in soil pH were strongly correlated with alkaline substances in biochar (R2 = 0.95), e.g., Ca, K, Mg, Na and Si. Moreover, biochar has been reported to enhance soil water retention [13], alter soil microbial community structure and improve nutrient utilization by offering additional benefits for agroecology [14]. However, several studies also raised the limitations of this strategy. Nguyen et al. (2017) [15] reported that the application of biochar averagely reduced the contents of soil inorganic nitrogen (SIN) by 11 ± 2% of −N and 10 ± 1.6% of NO3−−N. This study highlighted a further consideration of biochar application models, such as combining them with other agronomic practices [16,17]. One explanation for SIN reduction is that biochars could affect soil nitrification, a key process in soil N cycling. Some studies have revealed that biochar added to acidic soils can accelerate nitrification rates. Because nitrifiers (both bacterial and archaeal nitrifiers) that mediate nitrification favor neutral soil, the increased nitrifier population due to biochar addition provided the soil with a greater nitrification potential. For instance, Dai et al. (2014) [18] found that the nitrification degree in red sandy soil with a pH of 4.55 after biochar addition was much smaller than in soils of pH 5.13 and 5.63. Ameloot et al. (2015) [19] also found that biochar influenced N transformation processes indirectly by affecting microbial activities, depending on the initial soil pH and biochar application rate. However, pH is not only one important factor for microbial population change (e.g., nitrifiers); soil nutrient contents and soil adsorption capacity, among others, also need further investigation. In addition, biochar could influence the soil N cycle in abiotic ways, such as increasing N absorption by a combination of surface precipitation, electrostatic and complexation forces on the surface between soil particles and associated pores [20,21,22,23].
Since the addition of biochar will inevitably increase acid soil pH, we tried to find a practicable way to remedy the loss of ammonium nitrogen caused by the nitrification increase in tea orchard soil. Some reports have shown that plant litter also strongly influences soil properties and changes microbial community structures [24,25] due to it being a basic carrier of nutrients, especially since it is followed by an increase in labile soil C [26,27]. In turn, soil microorganisms, especially fungal communities, have been reported to play important roles in the decomposition of cellulosic and polyphenolic organic matter and the assembly of a specific community [28]. Therefore, we also suspect that tea plant litter may greatly affect soil properties. In tea plantations, pruning is one of the recommended agricultural measures to protect leaves from diseases and pests. This practice normally produces 7521–8279 kg·ha−1 of pruned litter in the field [29]. Given that the timing of biochar application (in winter) usually is not consistent with the timing of pruning (in spring, summer or autumn), few studies to date have assessed the influence of the combination of biochar and pruned tea plant litter on the nitrogen availability for tea plant and microbial communities in acid soil ecosystems. It is also unclear whether such a change in management is important in such scenarios.
Therefore, we conducted a pot culture trial using an acidic tea plantation soil to reveal the effects of biochar, with and without pruned tea plant litter, on the available N (−N) of tea plants in the soil and microbial community composition over a one-month period. We hypothesized that (1) biochar contains a large amount of carbon that is difficult for microorganisms to use, so adding it to tea plantation soil would certainly shift the soil microbial community structure, leading to an increase in the proportion of nitrifying bacteria such as ammonia-oxidizing bacteria (AOB) or ammonia-oxidizing archaea (AOA). In addition, the soil pH would be more suitable for both, thus reducing the soil −N content; (2) application of pruned litter as a labile flow of carbon would inhibit nitrification and favor −N retention; and (3) some microorganisms associated with N mineralization are more sensitive to this specific soil environment. The findings obtained in this study will help us better understand whether pruned litter can be used as a soil amendment for tea plantation ecosystems after biochar application to promote the soil N transformation processes that increase the available N of tea trees.
2. Materials and Methods
2.1. Preparation of Biochar, Soils and Tea Plant Litter
The biochar used in the experiment was generated from pyrolyzing rice straw at 450 °C for 1 h under O2-limited conditions (N2 was used as a carrier gas) and then cooled and crushed through a 2 mm sieve for chemical analysis by an elemental analyzer (Vario EL Cube, Elementar Analysensysteme GmbH, Langenselbold, Germany). The contents of C, H, N and S were 58.93%, 1.88%, 1.52% and 0.24%, respectively. The ratio of total C to total nitrogen (C/N) and the ratio of total C to total H (C/H) were 38.78 and 31.31, respectively. The soil used in the experiment was collected from the topsoil (0–20 cm) of a 50-year-old tea plantation in southern AnHui Province, China (31.3° N,119.17° E). The soil type is acidic Alfisol, a typical soil type widely distributed in southern China, which developed from quaternary red earth with the textural classes of 25.62–40.10–34.28% (sand–silt–clay). After removing plant residuals, the soil was air-dried and ground to pass through 2 mm sieve. The initial soil pH (H2O, 1:2.5 w/v) was 4.30, and the organic matter content, total nitrogen (TN), available phosphorus and available potassium were 19.5 g·kg−1, 0.81 g·kg−1, 34.3 mg·kg−1 and 78 mg·kg−1, respectively. The tea tree litter used in the experiment was collected from a pruned tea plantation (pruned in early May after the spring tea season) located in Huangshan, Anhui Province, China. The stems were removed, and the remaining leaves were dried in an oven at 60 °C, ground up in a grinder and prepared for use. The contents of C and N were 46.9% and 3.24%, respectively.
2.2. Experimental Design and Sampling
The soil was loaded into pots with 5 kg of soil in each pot and then pre-cultured for two weeks at 80% of the water holding capacity before formal experiment. The experiment was conducted with the following treatments: (i) Soil without any additive as blank control (CK); (ii) biochar was applied at a rate of 1% (w/w) (BC); and (iii) biochar and tea tree litter were added at the rates of 0.5% and 0.6% (w/w), respectively, in order to maintain same amount of carbon with BC treatment (BC + L). A total of 54 pots were incubated for the experiment (3 treatments × 6 times × 3 replicates). Afterwards, all pots were incubated at 25 °C in an artificial climate chamber. The moisture content (80% of the water holding capacity) was checked gravimetrically every 2 to 3 days and adjusted by adding deionized water. The samples from randomly selected three replicates of each treatment on 1, 7, 15, 30, 45 and 60 days were collected for analysis. The soil sample was immediately divided into three sub-samples. One sub-sample was stored in a freezer at −80 °C for microorganism analysis (sampled at 1, 15, 30 and 60 days), and the other part was freshly sieved using a 2 mm sieve and stored in a refrigerator at 4 °C for −N, NO3−−N and MBN determination. The rest of the sub-sample was air-dried and further divided into two parts; one part for pH and available nutrient analysis, and the other was sieved using a 0.15 mm sieve for TN and SOC analyses.
2.3. Soil Chemical Analysis
Soil organic carbon (SOC) was determined by potassium dichromate oxidation method. Total nitrogen (TN) was determined by an element analyzer (Vario EL III, Elementar, Hanau, Germany). −N in the soil was extracted with 2 mol·L−1 KCl at a ratio of 1:10 (w/v) for 30 min and determined by a Continuous Flow Analyzer (SAN++, Skalar, Breda, The Netherlands). Microbial biomass nitrogen (MBN) was determined using the fumigation extraction method [30] by fumigating 15 g of soil with ethanol-free chloroform followed by 0.5 mol·L−1 K2SO4 extraction (1:4). Soil pH was determined with water at a ratio of 1:2.5 (w/v) using a pH-meter (LE438, Mettler Toledo, Greifensee, Switzerland). Alkaline hydrolyzable nitrogen (AN) was determined by the alkali diffusion method using 1 mol·L−1 NaOH [31]. Ammonification rate (the net ammonification rate) of the treated soils were calculated from the concentration of −N using Equation (1) [32]:
where NammR is the net ammonification rate in the treatment (mg NH4−N·kg−1·d−1), Naf and Caf are the peak concentrations of −N in the treatment soil and in the control soil (mg −N·kg−1 soil), respectively, Nai and Cai are the initial concentrations of −N (mg −N·kg−1 soil) in the treatment soil and in the control soil (mg −N·kg−1 soil), respectively, and af and ai represent sampling time (day) of peak concentration and initial concentration of −N, respectively.
2.4. DNA Extraction and Illumina Sequencing
Total DNA was extracted from 0.2 g of fresh soil using the Mag-Bind Soil DNA Kit (Omega, GA, USA) according to the manufacturer’s instructions. DNA concentration was measured using a Qubit 3.0 (Life Technologies Corporation, Carlsbad, CA, USA) to ensure that adequate amounts of high-quality genomic DNA had been extracted. The V3–V4 hypervariable regions of bacterial 16S rRNA gene for each soil sample were amplified using barcoded reverse primers 41F (5′−3′): CCCTACACGACGCTCTTCCGATCTG (barcode) CCTACGG GNGGCWGCAG and 805R (5′−3′):GACTGGAGTTCCTTGGCATTCCA (barcode) GACT.
ACHVGGGTATCTAATCC. ITS1 targeted at Internal Transcribed Spacer (ITS) gene of fungi was amplified using primers ITS1F (5′−3′): CCCTACACGACGCTCTTC CGATCTN (barcode) CTTGGTCATTTAGAGGAAGTAA and ITS2R (5′−3′): GTGACTGGAGTTCCTT.
GGCACCCGAG AATTCCA (barcode) GCTGCG TTCTTCATCGATGC. The PCR reaction was set up as follows: microbial DNA (10 ng/μL) 2 μL; amplicon PCR forward primer (10 μM) 1 μL; amplicon PCR reverse primer (10 μM) 1 μL; 2× KAPA HiFi Hot Start Ready Mix 15 μL (total 30 μL). The plate was sealed, and PCR performed in a thermal instrument (Applied Biosystems 9700, Carlsbad, CA, USA). The bacterial V3–V4 region amplification used the following program: 1 cycle of denaturing at 95 °C for 3 min, first 5 cycles of denaturing at 95 °C for 30 s, annealing at 45 °C for 30 s, elongation at 72 °C for 30 s, then 20 cycles of denaturing at 95 °C for 30 s, annealing at 55 °C for 30 s, elongation at 72 °C for 30 s and a final extension at 72 °C for 5 min. The fungal ITS2 region amplification started with an initial denaturation at 94 °C for 3 min, 30 cycles at 94 °C for 40 s, 50 °C for 60 s, 72 °C for 60 s, and a final extension at 72 °C for 10 min. The PCR products were checked using electrophoresis in 1 % (w/v) agarose gels in TBE buffer (Tris, boric acid, EDTA) stained with ethidium bromide (EB) and visualized under UV light. The free primers and primer dimer species in the amplicon product were purified using Beckman Coulter AMPure XP kit (Beckman Coulter, Brea, CA, USA). The DNA concentration was checked using a Qubit Fluorometer (Invitrogen, Carlsbad, CA, USA). DNA concentration was normalized to 10 nM and the samples were sent for unidirectional pyrosequencing at Sangon Biotechnology Co., Ltd. (Shanghai, China) on an Illumina MiSeq instrument (Illumina, San Diego, CA, USA).
2.5. Processing of Illumina MiSeq Sequence Data
In total, 16S rRNA and ITS gene sequence reads were assigned to each sample according to the individual unique barcode and then analyzed using the quantitative insights in microbial ecology (QIIME) [33]. After removing the barcode, primers, and low-quality sequences (<200 bp), the sequence chimeras were detected and then eliminated using the UCHIME algorithm [34]. The trimmed and unique sequences were clustered using UPARSE at a 97% similarity level to generate operational taxonomic units (OTUs). For each OTU, a representative sequence was selected and used to assign taxonomic composition by a BLAST comparison within the GenBank database. The prediction of functional genes based on the retained OTUs were performed using FAPROTAX [35] and FUNGuild [36] tools.
2.6. Statistical Analyses
The correlation between repeated measurements over time including SOC, TN, −N, AN and MBN properties of soil were analyzed. The probability of order in the ante-dependence structures were all larger than 0.05, indicating that these values were not auto-correlated as a time series. A two-way analysis of variance (ANOVA) was used to evaluate the effects of the different treatments, incubation time and their interactions on SOC, TN, −N, AN and MBN. Standard deviation (SD) was used to indicate variability among replicates and Fisher’s post hoc test at a confidence level of 95% was used to establish significant differences between values. All of the above statistical analyses were performed using SPSS Statistics 22.0 software for windows (SPSS Inc., Chicago, IL, USA). Significant differences in microbial community structure between treatments over the course of the experiment were analyzed using Bray–Curtis resemblance matrices in the program PRIMER Version 6.1.9 (PRIMERE Ltd., Plymouth, UK). Additionally, similarity percentage (SIMPER) analysis was used to elucidate which specific OTUs contributed to differences in the similarity matrix structure between treatments [37]. The relationship between environmental factors and main microbial parameters was reflected by redundancy analysis (RDA) using the program Canoca version 5.
3. Results
3.1. Changes in Soil Property
Soil pH and contents of SOC, AN, −N and MBN were all significantly (p < 0.05, or p < 0.01, or p < 0.001) affected by treatment, sampling time and their interaction effects (Table 1), while TN content was influenced only by treatment. In detail, biochar addition (BC, BC + L) resulted in significantly higher SOC content than non-addition treatment (CK) most of the time (p < 0.05) (Figure 1A). An inconsistent pattern in the dynamics of SOC content was observed in all treatments during the early stage of incubation (1–15 days). After 30 days, the SOC contents in the BC treatment were highest, and they were 11.1% and 18.2% higher than that in BC + L and CK treatments, respectively (p < 0.05), at the end of incubation, which suggested that the biochar and pruned tea plant litter were decomposed to a certain extent. Soil TN was not influenced as much as the other properties across all treatments (Figure 1B). The content of AN in CK and BC treatments was relatively stable (Figure 1C), while those in BC + L treatment showed a monotonic increase during 1–30 days of incubation and were significantly (p < 0.05) higher than CK and BC treatments during the 15–60 days, except the 45th day in CK treatment. The soil −N contents of all treatments decreased during the incubation, with those in BC + L treatment decreasing more slowly, and they were 1.7–9.5 fold higher than those in CK and BC treatments from 15 to 45 days; furthermore, −N contents in BC treatment reduced sharply during within 7 days and remained at the lowest level (Figure 1D). There was no significant difference between the BC and CK treatments with regard to MBN content, but the combination of biochar with tea plant litter led to a significant increase in MBN content of 46.2–105.1% during 15–30 days (p < 0.05), which suggested an increased microbial biomass and nitrogen assimilation in this treatment. As expected, the application of biochar significantly elevated soil pH as compared with CK (p < 0.05); additionally, pruned litter addition further increased pH value by 0.1–0.4 unit, especially in the later incubation time (Figure 1F). The net ammonification rate (NammR) in soil was calculated according to the concentration change of −N. The decreasing trend implied that the consumptions of −N in all soils were significant (Figure 1D). In this case, NammR in BC + L showed an effect on accumulation of −N, being about 1.17 mg ·kg−1·d−1 more than that in BC treatment, when CK was considered as reference value (Figure 2).
Table 1.
Two-way ANOVA results for the effects of treatment and sampling time and their interactions on soil chemical and biological properties.

Figure 1.
The content of SOC (A), TN (B), AN (C), −N (D), MBN (E) and pH value (F) during the 60-day incubation period in various treatments. CK, blank control; BC, biochar application; and BC + L, biochar and tea plant litter application. The vertical bars indicate standard errors. Each treatment contained three replicates.
Figure 2.
Net ammonification rate (NammR) of different treatments. CK, blank control; BC, biochar application; and BC + L, biochar and tea plant litter application. Data are presented as mean ± SD. *** indicates a significant difference between treatments BC and BC + L (p < 0.001). Each treatment contained three replicates.
3.2. Microbial Community Characteristics Investigated by Miseq Pyrosequecing
The high-throughput sequencing of raw sequences was optimized to yield a total of 83,661–121,247 16S clean reads and 26,650–128,897 ITS1 clean reads for each soil sample under different treatment. The high-quality gene sequences generated from the soil samples were clustered into OTUs at 97% sequence similarity. Venn diagrams were constructed to illustrate the number of shared and unique fungal and bacterial OTUs present in each treatment (Figure 3). As illustrated in the Venn diagrams the majority of bacterial and fungal OTUs were shared between treatments, with 30.65% (4194) of the bacterial OTUs and 18.64% (664) of the fungal OTUs present in all treatments, respectively. Notably, CK treatment had the greatest number of total and unique OTUs, it means that applying biochar or biochar combined with litter reduced the number of bacterial and fungal taxonomic groups in the tea plantation soil (Figure 3). Specifically, the OTUs showed considerable overlap in bacterial communities among treatments; however, 1871 (20.02%), 1507 (17.06%) and 1533 (18.09%) OTUs were unique to the CK, BC and BC + L, respectively, among which the number of overlap and unique OTUs decreased mostly in the BC + L treatment (Figure 3A). The numbers of OTUs in fungal communities varied more widely than that of bacterial communities (Figure 3B). For example, in the BC + L treatment, the proportion of unique OTUs among treatments increased from 18% (in bacteria) to 34% (in fungi). Moreover, the total of fungal OTUs detected in the CK treatment was similar to that in the BC treatment. Although the number of overlap and unique OTUs also decreased mostly in BC + L treatment, the BC + L treatment had the greatest proportion of unique OTUs (33.38%) (Figure 3B).
Figure 3.
Venn diagram indicating the shared and unique soil bacterial OTUs (A) and fungal OTUs (B) found in the three treatments. CK, blank control; BC, biochar application; and BC + L, biochar and tea plant litter application.
The taxa sequence of Nitrospirae was collected to reflect nitrification discrepancy across treatments. It was found that the addition of biochar resulted in a slight increase in the OTUs number of Nitrospirae (about 40 OTUs) compared to the CK treatment, and the addition of biochar (BC) and combination of biochar and tea plant litter (BC + L) made the ratio of Nitrospirae OUTs increase from 0.04% to 0.06% and 0.05%, respectively; however, neither change was significant (p > 0.05) (Figure 4).
Figure 4.
OTUs number and ratio of Nitrospirae under different treatments. CK, blank control; BC, biochar application; and BC + L, biochar and tea plant litter application. Same upper- and lower-case letters indicate no significant differences at p < 0.05 level in OTU number and ratio of Nitrospirae, respectively, across different treatments. The vertical bars indicate standard errors. Each treatment contained three replicates.
Then, we identified five high abundance taxa in phyla and genera of bacterial and fungal community, respectively (Figure 5). The dominant phyla in the bacterial community across all samples during the whole incubation period were Proteobacteria, Acidobacteria, Actinobacteria, Candidate division WPS−2 and Chloroflexi (the relative abundances of each phylum at stated periods >5%), accounting for more than 80% of the bacterial sequences (Figure 5A,B). Across different soil samples, there was only significant difference in Candidate division WPS−2, as application of biochar decreased its relative abundance as compared with CK. Moreover, unclassified bacteria in the genus level were observed in relatively high abundance (Figure 5B). They were dominant in all of the tested soil samples, accounting for 25.65–28.49% of the sequences. This was followed by WPS−2_genera_incertae_sedis (8.45–13.96%), and the variation trend was consistent with that of phylum level. The biochar and pruned litter treatments had no significant effects on the relative abundances of other genera (Gp1, Sphingomonas and Ktedonobacter). In the fungal community (Figure 5C,D), the groups with top five relative abundance were in the following order: Ascomycota (37.16–71.69%), Basidiomycota (27.62–35.42%), unclassified fungi (10.13–19.32%), Chytridiomycota (0.21–12.07%) and Mortierellomycota (0.13–1.59%). In general, biochar application did not significantly alter the relative abundance of these groups compared with CK; meanwhile, litter application significantly increased the relative abundance of Ascomycota (32.1–34.5%) but decreased that of Chytridiomycota and Mortierellomycota. The relative abundances of the different genera were recalculated from the proportions of individual sequences from treatments. The Ascomycota had one dominant genus (Talaromyces) in all soil samples. Compared with CK and BC treatment, litter application significantly increased the relative abundance of Talaromyces, while neither that of Nidulariopsis or Saitozyma decreased significantly.
Figure 5.
Top five abundance of bacteria taxa in phylum level (A) and genus level (B) and fungi taxa in phylum level (C) and genus level (D) under different treatments. CK, blank control; BC, biochar application; and BC + L, biochar and tea plant litter application. The vertical bars indicate standard errors. Different letters indicated significant differences in p < 0.05 level across different treatments. Each treatment contained three replicates.
3.3. Relationships between Microbial Community Characteristics and Soil Available N
The linear regression models were utilized for determining the relationship between relative abundance of specific microbial group and soil AN and −N contents. In detail, the OTUs proportion of Proteobacteria, Acidobacteria, Actinobacteria, Candidate division WPS−2, Chloroflexi, Ascomycota, Basidiomycota, unclassified fungi, Chytridiomycota and Mortierellomycota were set as independent variables from X1 to X10; Y1 and Y2 were dependent variables representing the soil’s AN and −N contents (Table 2). The results showed that only the Ascomycota proportion (X6) against the soil’s AN content was strongly correlated (p = 0.032) and well described by the linear equation (R2 = 0.876, p = 0.01). That implied that above 87% of the variance was explained by this model with a significant statistical degree. However, the soil’s −N content as well as AN content were identified not to be sensitive to the rest of the selected microbial proportion, according to model significance (p < 0.05) and multicollinearity test (VIF < 5.0).
Table 2.
Linear regression models between microbial community characteristics and soil available N for tea plant.
3.4. Relationships between Soil Environmental Factors and Microbial Groups
The relationship between soil environmental factors and main microbial parameters was revealed by RDA. Both bacterial and fungal groups responded variably to the different treatments, with the fungal community groups showing more similar cluster based on OTU levels between CK and BC in RDA plots (Figure 6). The first two axes explained a total of 75.4% and 87.6% of the variances in the bacterial community (Figure 6A) and fungal community (Figure 6B), respectively. Soil pH and the contents of TN and AN were the most important in terms of explaining the variation in bacterial community composition (p < 0.05) and showed a small angle with BC + L treatments soils, indicating that these variables contributed to Proteobacteria and Actinobacteria growth. On the contrast, the relative abundance of the Candidate division WPS-2, Acidobacteria and Chloroflexi showed the opposite responses to soil parameters (Figure 6A). As for fungi groups (Figure 6B), of all selected soil parameters, pH and SOC/AN were important in terms of explaining the variation in fungal community of RDA plots (p < 0.05). Additionally, TN and AN were presented with long arrows in RDA plot and showed more projective vectors with canonical axis 1 indicating that these variables were also effective in influencing BC + L soils separation from CK and BC groups. For example, the relative abundance of the Ascomycota showed a positive correlations with soil pH (r = 0.69, p < 0.05); whereas the relative abundance of Chytridiomycota was negatively correlated with soil pH (r = −0.68, p < 0.05) and TN content (r = −0.78, p < 0.01); the relative abundances of unclassified fungi was negatively correlated with soil AN content (r = −0.58, p< 0.01); Basidiomycota and Mortierellomycota were weakly correlated with soil properties (p > 0.05) (Table 3).
Figure 6.
RDA analysis of the relationship between environmental factors and bacterial (A) and fungal (B) groups.
Table 3.
Pearson correlation between soil environmental factors and main microbial parameters (n = 12).
4. Discussion
4.1. Response of Soil Property to Biochar and Pruned Tea Plant Litter
The findings reported above imply no overall positive response in soil N availability following the biochar application to cultivated soil. The consistent reduction in soil −N content across treatments with stable TN pools was most likely due to the inevitable nitrification effect under aerobic conditions (Figure 1). Given that the microbial biomass N increased inapparently after biochar application, biochar used in this study had a limited amount of labile C or N that would possibly trigger the microbial incorporation of C and N from resident organic matter [38]. Contrary to our hypothesis, we also observed a significant reduction in soil −N content (Figure 1D) and a nonsignificant change in the proportion of Nitrospirae after the addition of pruned tea plant litter (Figure 4). These results, combined with changes in SOC and pH value, provided strong evidence that the combined application of biochar and pruned litter was able to promote the mineralization of organic matters and then resulted in an increase in soil AN, −N and MBN contents. Previous studies have confirmed that biochar could affect soil N through various processes. Firstly, abiotic effects, such as increasing N absorption by a combination of electrostatic, complexation and capillary forces on the surface of soil particles and associated pores. Generally, biochar produced at high temperatures and slow pyrolysis possesses a higher BET-specific surface area and pore volume and has a higher physisorption capacity [15,39]. Secondly, biochar could trigger N immobilization or mineralization associated with biological processes by adjusting the C:N ratio. A C:N ratio of 20 is the threshold; if the ratio is above 20, N immobilization occurs; otherwise, N mineralization happens [40]. In reality, this threshold ranges between 20 and 32 [41]. The C:N ratio of the soil also can be used to explain the priming effect; soil C:N ratio over 32 stimulates N immobilization [42]. In this study, the initial ratio of SOC:TN in CK, biochar addition and biochar with pruned litter addition were 13:1, 17:1 and 17:11, respectively. The SOC of the test soil was about 80% of the TC, and thus, in fact, the C/N of the test soil was about 21:1–16:1, which indicated that the N mineralization in all three treatments was the prominent process compared to N immobilization. In addition, high-quality tea litter with low polyphenol concentration and high alkaline substance could promote the growth of microorganisms [43] because they prefer easily degradable materials to the more recalcitrant SOC [26]. Similarly, in the current experiment, partial replacement of biochar by pruned litter may significantly promote bioavailable carbon in the soil. Resident soil microbial communities would consequently exert a low C:N recycling pattern, where N would be more likely to be immobilized following increases in AN and −N contents according to the consumer-driven nutrient recycling theory [44]. Although, other supporting evidence showed that polyphenols in tea plant leaves could inhibit nitrobacteria growth [45].
4.2. Response of Microbial Community to Biochar and Pruned Tea Litter
Bacteria and fungi, the two major components of the soil microbial community, play important roles in the ecosystem. For example, they participate in a variety of soil physiological and biochemical processes, including N transformation and cycling. Our results showed that a small change (0.2–0.6 unit) in soil pH value significantly affected bacterial and fungal diversities and compositions (Figure 3, Figure 5 and Figure 6), which was consistent with our third hypothesis. This finding corroborates previous observations that the microbial community in acidified soil may change significantly even when there is a slight change in soil pH [46,47]. It was found that reduction in soil pH could result in intracellular acidification of microorganisms, which inhibits enzymic activity and overall cell metabolism, so that some taxonomic groups are unable to grow or survive when soil pH decreases. Furthermore, changes in soil pH could regulate nutrient availability and aluminum toxicity in the soil [48]. In this study, the negative correlations between some specific taxonomic groups and soil pH (Figure 5, Table 3) suggest that some other environmental factors could not be ignored in such a pH range (pH 4.2–4.9).
The reduction in diversity and composition of soil bacterial and fungal communities with biochar addition could be partially explained by the enzyme inhibition theory, which suggests that oxidative enzymes are directly inhibited by acetaldehyde, aldehydes, α- and β-pinene and ethylene from biochar [15,49]. These inhibitors can therefore reduce the availability of C to microbes, which would then reduce microbial biomass and activity. Furthermore, pruned tea litter significantly contributed to changes in the characteristics of the soil microbial communities. Similar results were also reported in previous research in grassland ecosystems and tea plantation ecosystems, where the authors found that N-induced changes in the stoichiometry of litter increased the diversity of fungal communities [28,50]. Others also found that microbial biomass, soil community, and functional diversity were all significantly reduced by the cultivation of E. camaldulensis plants, due to the high levels of polyphenols in the soils originating from plant litter [51]. In addition, soil fungal communities have been reported to be more sensitive to polyphenols; however, whether the effects of these chemicals are positive or negative appears to depend on the specific type of polyphenols. For example, polyphenols from tea plant litter can inhibit soil nitrification and N mineralization [28], and host-derived polyphenols from shoot extracts can increase mycelium biomass [52].
The oligotrophic-copiotrophic theory further suggested that the mixed addition of pruned litter stimulated the growth of oligotrophic taxa yet retarded the growth of copiotrophic taxa. Cellulose and lignin are the main chemical compounds of plant litter and are known to affect characteristics of soil microbial community by providing a carbon source for soil microorganisms [50]. A recent study reported that cellulose addition either increased or decreased the biomass of soil bacteria, fungi, and actinomycetes, possibly because cellulose addition resulted in the selective proliferation of cellulose utilizers and may have been reflected in SOC/TN [26,53]. According to the oligotrophic-copiotrophic theory, the Fusarium and Trichoderma genera exhibited a copiotrophic tendency. In contrast, Nitrospira exhibited an oligotrophic tendency, as it was negatively correlated with SOC [43]. We classified the Basidiomycota and Ascomycota into the oligotrophic and copiotrophic categories, respectively, which was supported by a previous study, whereby the proportion of Ascomycota OUT promoted when SOC/TN raised from 13:1 to 17:1. In the case of relatively low ratio of C/N (about 21:1–16:1), many functional groups of fungi can produce hydrolases and oxidases, which can decompose complex polymers in soil and then provide nutrients for plants and microbes [54]. This suggests that fungi play an important role in retaining N in the soil. Hodge et al. (2010) [55] and Yu et al. (2018) [16] also mentioned that fungi had the potential to alter the availability of C and N to bacteria. Our results also showed that the fungal community was more altered than the bacterial community after the application of the pruned litter, especially the increased abundance of the Ascomycota (a typical saprophytic fungus), which was similar to those found in soybean rotational systems under organic and inorganic fertilization [17]. Ascomycota tends to inhabit cool and arid regions because of its evolutionary history, and many of its species play a major ecological role.
A previous study has found that soil microbial community variation was mainly driven by soil C and N contents [56]. In such soil environments, the coupling relationship between the dynamics of fungi and bacteria is usually nutrient-dependent. The fungal community may firstly serve as major lignin and cellulose decomposers for their varied catalytic enzymes, and then part of decomposed nutrients from dead plant material were utilized by bacteria [57]. Our results also confirmed that the fungal community shifted more than the bacterial community after the application of exogenous organic carbon (BC and BC + L), especially in the changes in abundance of the Ascomycota, Proteobacteria and Actinobacteria with the application of the biochar–tea tree litter. Overall, these changes in the microbial communities indicated the response of microbes to the environmental factors described above, which constrained them to improve efficiencies of organic carbon mineralization and N immobilization.
4.3. Implications for Management
The addition of organic and chemical fertilizers alone or combined with biochar to an acidic tea plantation soil in winter is a common method of nutrient supplementation. Clearly, application of biochar is not a more efficient means of achieving an increase in soil pH in acidic agriculture compared with lime (CaCO3), as biochar also helps change the physiochemical characters of surface soils without the noted accumulation of inorganic N in the deep soil layers [15,20].
Tea tree pruning generally takes place in summer to stimulate the re-growth of tea trees, which usually does not match the timing of biochar application. Implementation of a combined application of biochar and pruned tea plant litter may effectively involve them in various soil internal nutrient cycling processes, thereby increasing the mobility of soil N and potentially benefiting nutrient bioassimilation.
5. Conclusions
The addition of biochar to tea plantation soil increased soil pH and SOC content, but reduced −N content in the early stage of incubation. The mixed addition of pruned tea plant litter with biochar further increased soil pH during incubation and increased organic carbon mineralization, resulting in a reduction in SOC content and an increase in effective soil N supply in the late stage of incubation, and ultimately a significantly higher net ammonification rate than the biochar application alone. The present study demonstrated that the addition of biochar alone or combined with tea plant prunings, especially the latter, significantly altered the diversity and composition of soil bacteria and fungi, with greater changes in the fungal community and no significant changes in the proportion of Nitrospirae in soil. Moreover, we found that soil pH and content of TN and AN played a key role in driving the change of soil bacterial communities, while pH and SOC/AN played a key role in that of soil fungal communities. Overall, our study proved that the combined application of biochar and pruned tea plant litter in tea plantation affects the soil microbial community by changing soil physicochemical properties, thus increasing the available N in the soil. The present study contributes to the understanding of soil biological processes after biochar application in the presence of tea tree prunings with particular properties and provides a basis for using biochar to improve the tea plant available N supply in tea plantation ecosystems.
Author Contributions
Conceptualization, Y.L., Y.W. and W.L.; methodology, Y.L., Y.W. and W.L.; experimental design, Y.L., Y.Z. and W.L.; investigation, Y.L., Y.Z., Y.S. (Yulong Sun) and X.X.; data analysis, Y.L. and Y.Z.; writing—original draft preparation, Y.L.; writing—review and editing, Y.Z. and Y.S. (Youjian Su); funding acquisition, Y.S. (Youjian Su) and Y.W. All authors have read and agreed to the published version of the manuscript.
Funding
This research was funded by the China Agriculture Research System of MOF and MARA (CARS–19), the National Basic Long-Term Monitoring Project (initial trail) (NAES–AE–040), the Talent Program of Huangshan University (2020xkjq010), and the Transformation and Application of New Species and New Technology Achievements in Yuexi County’s Characteristic Agriculture (2023YL028).
Data Availability Statement
Not applicable.
Conflicts of Interest
The authors declare no conflict of interest.
Abbreviations
| AN | available nitrogen |
| ANOVA | analysis of variance |
| AOA | ammonia-oxidizing archaea |
| AOB | ammonia-oxidizing bacteria |
| C/H | the ratio of total carbon to total H |
| C/N | the ratio of total carbon to total nitrogen |
| MBN | microbial biomass nitrogen |
| N | nitrogen |
| –N | ammonium nitrogen |
| NO3−–N | nitrate nitrogen |
| OTU | operational taxonomic unit |
| RDA | redundancy analysis |
| SOC | soil organic carbon |
| TC | total carbon |
| TN | total nitrogen |
References
- Crops and Livestock Products. Available online: https://www.fao.org/faostat/en/#data/QCL (accessed on 10 April 2023).
- Wang, H.; Xu, R.K.; Wang, N.; Li, X.H. Soil acidification of alfisols as influenced by tea cultivation in eastern China. Pedosphere 2010, 20, 799–806. [Google Scholar] [CrossRef]
- Su, Y.J.; Liao, W.Y.; Wang, Y.J.; Zhang, Y.L.; Wu, X.R.; Hu, S.G.; Sun, L. Influences of soil pH and cultivation years on active aluminum species distribution from tea soils in southern Anhui, China. J. Agro-Environ. Sci. 2013, 32, 721–728. [Google Scholar] [CrossRef]
- Huang, Y.; Kang, R.; Mulder, J.; Zhang, T.; Duan, L. Nitrogen saturation, soil acidification, and ecological effects in a subtropical pine forest on acid soil in southwest China. J. Geophys. Res. Biogeosci. 2015, 120, 2457–2472. [Google Scholar] [CrossRef]
- Raut, N.; Dörsch, P.; Sitaula, B.K.; Bakken, L.R. Soil acidification by intensified crop production in south Asia results in higher N2O/(N2 + N2O) product ratios of denitrification. Soil Biol. Biochem. 2012, 55, 104–112. [Google Scholar] [CrossRef]
- Börjesson, G.; Menichetti, L.; Kirchmann, H.; Kätterer, T. Soil microbial community structure affected by 53 years of nitrogen fertilisation and different organic amendments. Biol. Fertil. Soils 2012, 48, 245–257. [Google Scholar] [CrossRef]
- Ni, K.; Liao, W.Y.; Yi, X.Y.; Niu, S.Y.; Ma, L.F.; Shi, Y.Z.; Zhang, Q.F.; Liu, M.Y.; Ruan, J.Y. Fertilization status and reduction potential in tea gardens of China. J. Plant Nutr. Fert 2019, 25, 421–432. [Google Scholar]
- Dai, Z.; Zhang, X.; Tang, C.; Muhammad, N.; Wu, J.; Brookes, P.C.; Xu, J. Potential role of biochars in decreasing soil acidification—A critical review. Sci. Total Environ. 2017, 581–582, 601–611. [Google Scholar] [CrossRef]
- Case, S.D.C.; McNamara, N.P.; Reay, D.S.; Stott, A.W.; Grant, H.K.; Whitaker, J. Biochar suppresses N2O emissions while maintaining N availability in a sandy loam soil. Soil Biol. Biochem. 2015, 81, 178–185. [Google Scholar] [CrossRef]
- Yuan, J.H.; Xu, R.K. Effects of biochars generated from crop residues on chemical properties of acid soils from tropical and subtropical China. Soil Res. 2012, 50, 570–578. [Google Scholar] [CrossRef]
- Kulczycki, G.; Magnucka, E.G.; Oksińska, M.P.; Kucińska, J.; Kobyłecki, R.; Pawęska, K.; Zarzycki, R.; Kacprzak, A.; Pietr, S.J. The effect of various types of biochar mixed with mineral fertilization on the development and ionome of winter wheat (Triticum aestivum L.) seedlings and soil properties in a pot experiment. Agronomy 2020, 10, 1903. [Google Scholar] [CrossRef]
- Yuan, J.H.; Xu, R.K. The amelioration effects of low temperature biochar generated from nine crop residues on an acidic ultisol. Soil Use Manag. 2011, 27, 110–115. [Google Scholar] [CrossRef]
- Soinne, H.; Hovi, J.; Tammeorg, P.; Turtola, E. Effect of biochar on phosphorus sorption and clay soil aggregate stability. Geoderma 2014, 219–220, 162–167. [Google Scholar] [CrossRef]
- Van Zwieten, L.; Rose, T.; Herridge, D.; Kimber, S.; Rust, J.; Cowie, A.; Morris, S. Enhanced biological N2 fixation and yield of faba bean (Vicia faba L.) in an acid soil following biochar addition: Dissection of causal mechanisms. Plant Soil 2015, 395, 7–20. [Google Scholar] [CrossRef]
- Nguyen, T.T.N.; Xu, C.-Y.; Tahmasbian, I.; Che, R.; Xu, Z.; Zhou, X.; Wallace, H.M.; Bai, S.H. Effects of biochar on soil available inorganic nitrogen: A review and meta-analysis. Geoderma 2017, 288, 79–96. [Google Scholar] [CrossRef]
- Yu, L.; Yu, M.; Lu, X.; Tang, C.; Liu, X.; Brookes, P.C.; Xu, J. Combined application of biochar and nitrogen fertilizer benefits nitrogen retention in the rhizosphere of soybean by increasing microbial biomass but not altering microbial community structure. Sci. Total Environ. 2018, 640–641, 1221–1230. [Google Scholar] [CrossRef]
- Kim, J.; Yoo, G.; Kim, D.; Ding, W.; Kang, H. Combined application of biochar and slow-release fertilizer reduces methane emission but enhances rice yield by different mechanisms. Appl. Soil Ecol. 2017, 117–118, 57–62. [Google Scholar] [CrossRef]
- Dai, Z.; Wang, Y.; Muhammad, N.; Yu, X.; Xiao, K.; Meng, J.; Liu, X.; Xu, J.; Brookes, P.C. The effects and mechanisms of soil acidity changes, following incorporation of biochars in three soils differing in initial pH. Soil Sci. Soc. Am. J. 2014, 78, 1606–1614. [Google Scholar] [CrossRef]
- Ameloot, N.; Sleutel, S.; Das, K.C.; Kanagaratnam, J.; de Neve, S. Biochar amendment to soils with contrasting organic matter level: Effects on N mineralization and biological soil properties. GCB Bioenergy 2015, 7, 135–144. [Google Scholar] [CrossRef]
- Yu, L.; Lu, X.; He, Y.; Brookes, P.C.; Liao, H.; Xu, J. Combined biochar and nitrogen fertilizer reduces soil acidity and promotes nutrient use efficiency by soybean crop. J. Soils Sediments 2017, 17, 599–610. [Google Scholar] [CrossRef]
- Mukherjee, A.; Lal, R. Biochar impacts on soil physical properties and greenhouse gas emissions. Agronomy 2013, 3, 313–339. [Google Scholar] [CrossRef]
- Nelson, N.O.; Agudelo, S.C.; Yuan, W.; Gan, J. Nitrogen and phosphorus availability in biochar-amended soils. Soil Sci. 2011, 176, 218. [Google Scholar] [CrossRef]
- Ding, Y.; Liu, Y.X.; Wu, W.X.; Shi, D.Z.; Yang, M.; Zhong, Z.K. Evaluation of biochar effects on nitrogen retention and leaching in multi-layered soil columns. Water Air Soil Pollut. 2010, 213, 47–55. [Google Scholar] [CrossRef]
- Che, R.; Qin, J.; Tahmasbian, I.; Wang, F.; Zhou, S.; Xu, Z.; Cui, X. Litter amendment rather than phosphorus can dramatically change inorganic nitrogen pools in a degraded grassland soil by affecting nitrogen-cycling microbes. Soil Biol. Biochem. 2018, 120, 145–152. [Google Scholar] [CrossRef]
- Marcos, M.S.; Bertiller, M.B.; Cisneros, H.S.; Olivera, N.L. Nitrification and ammonia-oxidizing bacteria shift in response to soil moisture and plant litter quality in arid soils from the patagonian monte. Pedobiologia 2016, 59, 1–10. [Google Scholar] [CrossRef]
- Bhatnagar, J.M.; Peay, K.G.; Treseder, K.K. Litter chemistry influences decomposition through activity of specific microbial functional guilds. Ecol. Monogr. 2018, 88, 429–444. [Google Scholar] [CrossRef]
- Shan, L.; Song, C.; Zhang, X.; Ren, J. Effects of long-term nitrogen and phosphorus addition on plant defence compounds in a freshwater wetland. Ecol. Indic. 2018, 94, 1–6. [Google Scholar] [CrossRef]
- Yang, X.; Ma, L.; Ji, L.; Shi, Y.; Yi, X.; Yang, Q.; Ni, K.; Ruan, J. Long-term nitrogen fertilization indirectly affects soil fungi community structure by changing soil and pruned litter in a subtropical tea (Camellia sinensis L.) plantation in China. Plant Soil 2019, 444, 409–426. [Google Scholar] [CrossRef]
- Qamar-uz-Zaman; Sarwar, S.; Ahmad, F.; Hamid, F.S. Effect of nitrogenous fertilizer on the growth and yield of tea (Camellia sinensis L.) pruned in curved vs. flat shape. J. Agric. Res. 2011, 49, 477–482. [Google Scholar]
- Vance, E.D.; Brookes, P.C.; Jenkinson, D.S. An extraction method for measuring soil microbial biomass C. Soil Biol. Biochem. 1987, 19, 703–707. [Google Scholar] [CrossRef]
- Roberts, T.L.; Ross, W.J.; Norman, R.J.; Slaton, N.A.; Wilson, C.E., Jr. Predicting nitrogen fertilizer needs for rice in arkansas using alkaline hydrolyzable-nitrogen. Soil Sci. Soc. Am. J. 2011, 75, 1161–1171. [Google Scholar] [CrossRef]
- Thangarajan, R.; Bolan, N.S.; Naidu, R.; Surapaneni, A. Effects of temperature and amendments on nitrogen mineralization in selected australian soils. Environ. Sci. Pollut. Res. 2015, 22, 8843–8854. [Google Scholar] [CrossRef]
- Caporaso, J.G.; Kuczynski, J.; Stombaugh, J.; Bittinger, K.; Bushman, F.D.; Costello, E.K.; Fierer, N.; Peña, A.G.; Goodrich, J.K.; Gordon, J.I.; et al. QIIME allows analysis of high-throughput community sequencing data. Nat. Methods 2010, 7, 335–336. [Google Scholar] [CrossRef]
- Edgar, R.C.; Haas, B.J.; Clemente, J.C.; Quince, C.; Knight, R. UCHIME improves sensitivity and speed of chimera detection. Bioinformatics 2011, 27, 2194–2200. [Google Scholar] [CrossRef]
- Langille, M.G.I.; Zaneveld, J.; Caporaso, J.G.; McDonald, D.; Knights, D.; Reyes, J.A.; Clemente, J.C.; Burkepile, D.E.; Vega Thurber, R.L.; Knight, R.; et al. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nat. Biotechnol. 2013, 31, 814–821. [Google Scholar] [CrossRef]
- Nguyen, N.H.; Song, Z.; Bates, S.T.; Branco, S.; Tedersoo, L.; Menke, J.; Schilling, J.S.; Kennedy, P.G. FUNGuild: An open annotation tool for parsing fungal community datasets by ecological guild. Fungal Ecol. 2016, 20, 241–248. [Google Scholar] [CrossRef]
- Clarke, K.R.; Warwick, R.M. Change in Marine Communities: An Approach to Statistical Analysis and Interpretation, 2nd ed.; Plymouth Marine Laboratory: Plymouth, UK, 2001. [Google Scholar]
- Gao, S.; DeLuca, T.H. Biochar alters nitrogen and phosphorus dynamics in a western rangeland ecosystem. Soil Biol. Biochem. 2020, 148, 107868. [Google Scholar] [CrossRef]
- Ahmad, M.; Rajapaksha, A.U.; Lim, J.E.; Zhang, M.; Bolan, N.; Mohan, D.; Vithanage, M.; Lee, S.S.; Ok, Y.S. Biochar as a sorbent for contaminant management in soil and water: A review. Chemosphere 2014, 99, 19–33. [Google Scholar] [CrossRef]
- Zavalloni, C.; Alberti, G.; Biasiol, S.; Vedove, G.D.; Fornasier, F.; Liu, J.; Peressotti, A. Microbial mineralization of biochar and wheat straw mixture in soil: A short-term study. Appl. Soil Ecol. 2011, 50, 45–51. [Google Scholar] [CrossRef]
- Kuzyakov, Y. Priming Effects: Interactions between living and dead organic matter. Soil Biol. Biochem. 2010, 42, 1363–1371. [Google Scholar] [CrossRef]
- Wang, H.Y.; Gai, X.P.; Zhai, L.M.; Liu, H.B. Effect of biochar on soil nitrogen cycling: A review. Acta Ecol. Sin. 2016, 36, 5998–6011. [Google Scholar] [CrossRef]
- Yang, X.; Ni, K.; Shi, Y.; Yi, X.; Ji, L.; Ma, L.; Ruan, J. Heavy nitrogen application increases soil nitrification through ammonia-oxidizing bacteria rather than archaea in acidic tea (Camellia sinensis L.) plantation soil. Sci. Total Environ. 2020, 717, 137248. [Google Scholar] [CrossRef] [PubMed]
- Zechmeister-Boltenstern, S.; Keiblinger, K.M.; Mooshammer, M.; Peñuelas, J.; Richter, A.; Sardans, J.; Wanek, W. The application of ecological stoichiometry to plant-microbial-soil organic matter transformations. Ecol. Monogr. 2015, 85, 133–155. [Google Scholar] [CrossRef]
- Diallo, M.D.; Guisse, A.; Sall, S.N.; Dick, R.P.; Assigbetse, K.B.; Dieng, A.L.; Chotte, J. Influence of tropical leaf litter on nitrogen mineralization and community structure of ammonia-oxidizing bacteria. Biotechnol. Agron. Soc. Environ. 2015, 19, 173–183. [Google Scholar]
- Glassman, S.I.; Wang, I.J.; Bruns, T.D. Environmental filtering by pH and soil nutrients drives community assembly in fungi at fine spatial scales. Mol. Ecol. 2017, 26, 6960–6973. [Google Scholar] [CrossRef]
- Zhang, T.; Wang, N.F.; Liu, H.Y.; Zhang, Y.Q.; Yu, L.Y. Soil pH is a key determinant of soil fungal community composition in the Ny-Ålesund region, Svalbard (high arctic). Front. Microbiol. 2016, 7, 227. [Google Scholar] [CrossRef]
- Yang, X.D.; Ni, K.; Shi, Y.Z.; Yi, X.Y.; Zhang, Q.F.; Fang, L.; Ma, L.F.; Ruan, J. Effects of long-term nitrogen application on soil acidification and solution chemistry of a tea plantation in China. Agric. Ecosyst. Environ. 2018, 252, 74–82. [Google Scholar] [CrossRef]
- Liu, W.J.; Jiang, H.; Yu, H.Q. Development of biochar-based functional materials: Toward a sustainable platform carbon material. Chem. Rev. 2015, 115, 12251–12285. [Google Scholar] [CrossRef]
- Li, Y.; Bezemer, T.M.; Yang, J.; Lü, X.; Li, X.; Liang, W.; Han, X.; Li, Q. Changes in litter quality induced by N deposition alter soil microbial communities. Soil Biol. Biochem. 2019, 130, 33–42. [Google Scholar] [CrossRef]
- Soumare, A.; Sall, S.N.; Sanon, A.; Cissoko, M.; Hafidi, M.; Ndoye, I.; Duponnois, R. Changes in soil pH, polyphenol content and microbial community mediated by eucalyptus camaldulensis. Appl. Ecol. Environ. Res. 2016, 14, 1–19. [Google Scholar] [CrossRef]
- Hättenschwiler, S.; Vitousek, P.M. The role of polyphenols in terrestrial ecosystem nutrient cycling. Trends Ecol. Evol. 2000, 15, 238–243. [Google Scholar] [CrossRef]
- Siles, J.A.; Cajthaml, T.; Frouz, J.; Margesin, R. Assessment of soil microbial communities involved in cellulose utilization at two contrasting alpine forest sites. Soil Biol. Biochem. 2019, 129, 13–16. [Google Scholar] [CrossRef]
- Dighton, J. Fungi in Ecosystem Processes, 2nd ed.; CRC Press: Boca Raton, FL, USA, 2018; ISBN 978-1-315-37152-8. [Google Scholar] [CrossRef]
- Hodge, A.; Fitter, A.H. Substantial nitrogen acquisition by arbuscular mycorrhizal fungi from organic material has implications for N cycling. Proc. Natl. Acad. Sci. USA 2010, 107, 13754–13759. [Google Scholar] [CrossRef]
- Tang, S.; Ma, Q.; Marsden, K.A.; Chadwick, D.R.; Luo, Y.; Kuzyakov, Y.; Wu, L.; Jones, D.L. Microbial community succession in soil is mainly driven by carbon and nitrogen contents rather than phosphorus and sulphur contents. Soil Biol. Biochem. 2023, 180, 109019. [Google Scholar] [CrossRef]
- Bamminger, C.; Zaiser, N.; Zinsser, P.; Lamers, M.; Kammann, C.; Marhan, S. Effects of biochar, earthworms, and litter addition on soil microbial activity and abundance in a temperate agricultural soil. Biol. Fertil. Soils 2014, 50, 1189–1200. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).