Accumulation of Polyphenolics and Differential Expression of Genes Related to Shikimate Pathway during Fruit Development and Maturation of Chinese Olive (Canarium album)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. Methods
2.2.1. Extraction of Shikimate, Quinate and Phenolic Compounds
2.2.2. UPLC-MS Analysis
2.2.3. Gene Expression Analyses
2.2.4. Data Analysis
3. Results
3.1. Changes in Shikimate, Quinate and Phenolic Substances during Fruit Development
3.2. Changes in Shikimate-Metabolism-Related Genes’ Expression during Fruit Development
3.2.1. Expression Changes of DAHPSs
3.2.2. Expression Changes of DHQS
3.2.3. Expression Changes of DHD/SDHs
3.2.4. Expression Changes of CS
3.2.5. Expression Changes of CMs
3.3. Correlation Analysis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
Appendix A
Chemical Compound | Retention Time (min) | Ionization Mode | Mass Number | Parent Ion |
---|---|---|---|---|
Shikimate | 1.16 | ESI(-) | 174 | 173 |
Quinate | 1.09 | ESI(-) | 192 | 191 |
Gallate | 1.98 | ESI(-) | 170 | 169 |
Ellagate | 8.16 | ESI(-) | 302 | 301 |
(iso)Corilagin | 5.93 | ESI(-) | 634 | 633 |
Hyperoside | 7.80 | ESI(-) | 464 | 463 |
Quercetin | 9.45 | ESI(-) | 302 | 301 |
Keampferol | 10.20 | ESI(-) | 286 | 285 |
Luteolin | 9.72 | ESI(-) | 286 | 285 |
Primers | Primer Sequence(5′-3′) | |
---|---|---|
Actin7 | F | GCATCAGTGAGATCACGTCCG |
R | CTGTGCCAATTTACGAGGGG | |
DAHPS-1 | F | TGTCTCAACCTCCGCTCTTT |
R | CGCTGAGATGGGTTTGAGTG | |
DAHPS-2 | F | ATAACGCACGCTAGAATG |
R | GATGTGATCGGCTGCAAAGT | |
DAHPS-3 | F | AAATCCCCGCAGTTCTCCGC |
R | TACTGGCATTCTGGGTCTTGGT | |
DHQS | F | CAAGCTGTTGGTGAGACGAG |
R | ATCCAGGTAAATCGGCCCAA | |
DHD/SDH-1 | F | GCATTGATTCCCTCACAACATTC |
R | TCTAAGTCGAGAGCCCGTCTCA | |
DHD/SDH-2 | F | TCTCTGCACTTCCACTCACCAT |
R | ACTGGTGCGCAAATCATTGT | |
DHD/SDH-3 | F | TTGGCAGCAGCCTATCCTCCAA |
R | CCTTTGCTTTTCGCATCTCG | |
DHD/SDH-4 | F | CCCCTTTGCCCACTTTGTTC |
R | GCTCCCAAGTCCATGGCTAA | |
DHD/SDH-5 | F | TGATCAGCAAAAACGGATGG |
R | CGGTCAACAAGATGGCTGAG | |
CS | F | TTGGGTTCTCTTCTGCCGTC |
R | CCAAATGTGGTAACACGGAAGT | |
CM-1 | F | AAGTTGCTCCGACTCAGACCC |
R | ACCTGAACATAGAATCGTGGGAG | |
CM-2 | F | TGAGGCTGTAGAAGAGATGGTGAA |
R | GAGGTTTCAATCTAAGCGGCG |
References
- Ye, Q.; Zhang, S.; Qiu, N.; Liu, L.; Wang, W.; Xie, Q.; Chang, Q.; Chen, Q. Identification and Characterization of Glucosyltransferase That Forms 1-Galloyl-β-d-Glucogallin in Canarium album L., a Functional Fruit Rich in Hydrolysable Tannins. Molecules 2021, 26, 4650. [Google Scholar] [CrossRef] [PubMed]
- Lai, R.; Shen, C.; Feng, X.; Gao, M.; Zhang, Y.; Wei, X.; Chen, Y.; Cheng, C.; Wu, R. Integrated Metabolomic and Transcriptomic Analysis Reveals Differential Flavonoid Accumulation and Its Underlying Mechanism in Fruits of Distinct Canarium album Cultivars. Foods 2022, 11, 2527. [Google Scholar] [CrossRef] [PubMed]
- Lai, R.-L.; Feng, X.; Chen, J.; Chen, Y.-T.; Wu, R.-J. The complete chloroplast genome characterization and phylogenetic analysis of Canarium album. Mitochondrial DNA Part B 2019, 4, 2948–2949. [Google Scholar] [CrossRef] [Green Version]
- He, Z.; Xia, W. Analysis of phenolic compounds in Chinese olive (Canarium album L.) fruit by RPHPLC–DAD–ESI–MS. Food Chem. 2007, 105, 1307–1311. [Google Scholar] [CrossRef]
- Yokoyama, R.; de Oliveira, M.V.V.; Kleven, B.; Maeda, H.A. The entry reaction of the plant shikimate pathway is subjected to highly complex metabolite-mediated regulation. Plant Cell 2021, 33, 671–696. [Google Scholar] [CrossRef]
- Kanaris, M.; Poulin, J.; Shahinas, D.; Johnson, D.; Crowley, V.M.; Fucile, G.; Provart, N.; Christendat, D. Elevated tyrosine results in the cytosolic retention of 3-deoxy-d-arabino-heptulosonate 7-phosphate synthase in Arabidopsis thaliana. Plant J. Cell Mol. Biol. 2022, 109, 789–803. [Google Scholar] [CrossRef] [PubMed]
- Yuan, J.; Zhong, S.; Long, Y.; Guo, J.; Yu, Y.; Liu, J. Shikimate Kinase Plays Important Roles in Anthocyanin Synthesis in Petunia. Int. J. Mol. Sci. 2022, 23, 15964. [Google Scholar] [CrossRef]
- Habashi, R.; Hacham, Y.; Dhakarey, R.; Matityahu, I.; Holland, D.; Tian, L.; Amir, R. Elucidating the role of shikimate dehydrogenase in controlling the production of anthocyanins and hydrolysable tannins in the outer peels of pomegranate. BMC Plant Biol. 2019, 19, 476. [Google Scholar] [CrossRef]
- Tahara, K.; Nishiguchi, M.; Funke, E.; Miyazawa, S.I.; Miyama, T.; Milkowski, C. Dehydroquinate dehydratase/shikimate dehydrogenases involved in gallate biosynthesis of the aluminum-tolerant tree species Eucalyptus camaldulensis. Planta 2020, 253, 3. [Google Scholar] [CrossRef]
- Guo, J.; Carrington, Y.; Alber, A.; Ehlting, J. Molecular Characterization of Quinate and Shikimate Metabolism in Populus trichocarpa*. J. Biol. Chem. 2014, 289, 23846–23858. [Google Scholar] [CrossRef] [Green Version]
- Aydin, A.; Kurt, F.; Hürkan, K. Key aromatic amino acid players in soybean (Glycine max) genome under drought and salt stresses. Biocatal. Agric. Biotechnol. 2021, 35, 102094. [Google Scholar] [CrossRef]
- Filiz, E.; Cetin, D.; Akbudak, M.A. Aromatic amino acids biosynthesis genes identification and expression analysis under salt and drought stresses in Solanum lycopersicum L. Sci. Hortic. 2019, 250, 127–137. [Google Scholar] [CrossRef]
- Dyer, W.E.; Weaver, L.M.; Zhao, J.M.; Kuhn, D.N.; Weller, S.C.; Herrmann, K.M. A cDNA encoding 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase from Solanum tuberosum L. J. Biol. Chem. 1990, 265, 1608–1614. [Google Scholar] [CrossRef]
- Zhang, Z.-Z.; Li, X.-X.; Chu, Y.-N.; Zhang, M.-X.; Wen, Y.-Q.; Duan, C.-Q.; Pan, Q.-H. Three types of ultraviolet irradiation differentially promote expression of shikimate pathway genes and production of anthocyanins in grape berries. Plant Physiol. Biochem. 2012, 57, 74–83. [Google Scholar] [CrossRef] [PubMed]
- Yokoyama, R.; Kleven, B.; Gupta, A.; Wang, Y.; Maeda, H.A. 3-Deoxy-D-arabino-heptulosonate 7-phosphate synthase as the gatekeeper of plant aromatic natural product biosynthesis. Curr. Opin. Plant Biol. 2022, 67, 102219. [Google Scholar] [CrossRef] [PubMed]
- Bontpart, T.; Marlin, T.; Vialet, S.; Guiraud, J.L.; Pinasseau, L.; Meudec, E.; Sommerer, N.; Cheynier, V.; Terrier, N. Two shikimate dehydrogenases, VvSDH3 and VvSDH4, are involved in gallic acid biosynthesis in grapevine. J. Exp. Bot. 2016, 67, 3537–3550. [Google Scholar] [CrossRef] [Green Version]
- Huang, K.; Li, M.; Liu, Y.; Zhu, M.; Zhao, G.; Zhou, Y.; Zhang, L.; Wu, Y.; Dai, X.; Xia, T.; et al. Functional Analysis of 3-Dehydroquinate Dehydratase/Shikimate Dehydrogenases Involved in Shikimate Pathway in Camellia sinensis. Front. Plant Sci. 2019, 10, 1268. [Google Scholar] [CrossRef]
- Michel, G.; Roszak, A.W.; Sauvé, V.; Maclean, J.; Matte, A.; Coggins, J.R.; Cygler, M.; Lapthorn, A.J. Structures of Shikimate Dehydrogenase AroE and Its Paralog YdiB: A common structural framework for different activities*. J. Biol. Chem. 2003, 278, 19463–19472. [Google Scholar] [CrossRef] [Green Version]
- Peek, J.; Lee, J.; Hu, S.; Senisterra, G.; Christendat, D. Structural and mechanistic analysis of a novel class of shikimate dehydrogenases: Evidence for a conserved catalytic mechanism in the shikimate dehydrogenase family. Biochemistry 2011, 50, 8616–8627. [Google Scholar] [CrossRef]
- Lynch, J.H. Revisiting the dual pathway hypothesis of Chorismate production in plants. Hortic. Res. 2022, 9, uhac052. [Google Scholar] [CrossRef]
- Qian, Y.; Lynch, J.H.; Guo, L.; Rhodes, D.; Morgan, J.A.; Dudareva, N. Completion of the cytosolic post-chorismate phenylalanine biosynthetic pathway in plants. Nat. Commun. 2019, 10, 15. [Google Scholar] [CrossRef] [PubMed]
- Jia, B.; Cheng, Z.; Wang, Q.; Zhang, S.; Heng, W.; Zhu, L. Characterization of the composition and gene expression involved the shikimate pathway in the exocarp of ‘Dangshansuli’ pear and its russet mutant. Hortic. Environ. Biotechnol. 2021, 62, 125–134. [Google Scholar] [CrossRef]
- Zhong, S.; Chen, Z.; Han, J.; Zhao, H.; Liu, J.; Yu, Y. Suppression of chorismate synthase, which is localized in chloroplasts and peroxisomes, results in abnormal flower development and anthocyanin reduction in petunia. Sci. Rep. 2020, 10, 10846. [Google Scholar] [CrossRef] [PubMed]
- Wilawan, N.; Ngamwonglumlert, L.; Devahastin, S.; Chiewchan, N. Changes in enzyme activities and amino acids and their relations with phenolic compounds contents in okra treated by LED lights of different colors. Food Bioprocess. Technol. 2019, 12, 1945–1954. [Google Scholar] [CrossRef]
- Jones, J.D.; Henstrand, J.M.; Handa, A.K.; Herrmann, K.M.; Weller, S.C. Impaired Wound Induction of 3-Deoxy-D-arabino-heptulosonate-7-phosphate (DAHP) Synthase and Altered Stem Development in Transgenic Potato Plants Expressing a DAHP Synthase Antisense Construct. Plant Physiol. 1995, 108, 1413–1421. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ding, L.; Hofius, D.; Hajirezaei, M.R.; Fernie, A.R.; Börnke, F.; Sonnewald, U. Functional analysis of the essential bifunctional tobacco enzyme 3-dehydroquinate dehydratase/shikimate dehydrogenase in transgenic tobacco plants. J. Exp. Bot. 2007, 58, 2053–2067. [Google Scholar] [CrossRef] [Green Version]
- Herrmann, K.M. The shikimate pathway as an entry to aromatic secondary metabolism. Plant Physiol. 1995, 107, 7–12. [Google Scholar] [CrossRef] [Green Version]
- Akagi, T.; Ikegami, A.; Suzuki, Y.; Yoshida, J.; Yamada, M.; Sato, A.; Yonemori, K. Expression balances of structural genes in shikimate and flavonoid biosynthesis cause a difference in proanthocyanidin accumulation in persimmon (Diospyros kaki Thunb.) fruit. Planta 2009, 230, 899–915. [Google Scholar] [CrossRef]
- Cai, J.; Wang, J.; Zhao, J.; Pan, T.; Guo, Z.; She, W. Metabolomics and Its Difference of Chinese Olive Fruit of Different Varieties (lines) During the Ripening Period. Chin. J. Trop. Crops 2022, 43, 2304–2315. (In Chinese) [Google Scholar] [CrossRef]
- Wang, J.; Cai, J.; Zhao, J.; Guo, Z.; Pan, T.; Yu, Y.; She, W. Enzyme Activities in the Lignin Metabolism of Chinese Olive (Canarium album) with Different Flesh Characteristics. Horticulturae 2022, 8, 408. [Google Scholar] [CrossRef]
- Reichel, M.; Carle, R.; Sruamsiri, P.; Neidhart, S. Changes in flavonoids and nonphenolic pigments during on-tree maturation and postharvest pericarp browning of litchi (Litchi chinensis Sonn.) as shown by HPLC-MSn. J. Agric. Food Chem. 2011, 59, 3924–3939. [Google Scholar] [CrossRef] [PubMed]
- Muir, S.R.; Collins, G.J.; Robinson, S.; Hughes, S.; Bovy, A.; Ric De Vos, C.H.; van Tunen, A.J.; Verhoeyen, M.E. Overexpression of petunia chalcone isomerase in tomato results in fruit containing increased levels of flavonols. Nat. Biotechnol. 2001, 19, 470–474. [Google Scholar] [CrossRef] [PubMed]
- Huang, M. Measurement of Hyperoside Content, Cloning and Expression of the Synthesis Genes in Canarium album. Master’s Thesis, Fujian Agriculture and Forestry University, Fujian, China, 2017. (In Chinese). [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Hulme, A.C. Quinic and shikimic acids in fruits. Qual. Plant. Mater. Veg. 1958, 3, 468–473. [Google Scholar] [CrossRef]
- Marsh, K.; Rossiter, K.; Lau, K.; Walker, S.; Gunson, A.; Macrae, E. The use of fruit pulps to explore flavour in kiwifruit. Acta Hortic. 2003, 610, 229–237. [Google Scholar] [CrossRef]
- Ossipov, V.; Chernov, A.V.; Zrazhevskaya, G.; Shein, I.V. Quinate:NAP(P)+-oxidoreductase from Larix sibirica: Purification, characterization and function. Trees 1995, 10, 46–51. [Google Scholar] [CrossRef]
- Guo, L.; Qiang, T.; Ma, Y.; Ren, L.; Dai, T. Purification and characterization of hydrolysable tannins extracted from Coriaria nepalensis bark using macroporous resin and their application in gallic acid production. Ind. Crops Prod. 2021, 162, 113302. [Google Scholar] [CrossRef]
- Ghasemi, S.; Kumleh, H.H.; Kordrostami, M. Changes in the expression of some genes involved in the biosynthesis of secondary metabolites in Cuminum cyminum L. under UV stress. Protoplasma 2019, 256, 279–290. [Google Scholar] [CrossRef]
- Cai, J. Cloning and Expression Analysis of Shikimic Acid Metabolism Related Genes During the Development of Chinese Olive Fruit. Master’s Thesis, Fujian Agriculture and Forestry University, Fujian, China, 2022. (In Chinese). [Google Scholar]
- Marsh, K.B.; Boldingh, H.L.; Shilton, R.S.; Laing, W.A. Changes in quinic acid metabolism during fruit development in three kiwifruit species. Funct. Plant Biol. FPB 2009, 36, 463–470. [Google Scholar] [CrossRef]
- Colquhoun, T.; Schimmel, B.; Kim, J.Y.; Reinhardt, D.; Cline, K.; Clark, D. A petunia chorismate mutase specialized for the production of floral volatiles. Plant J. Cell Mol. Biol. 2009, 61, 145–155. [Google Scholar] [CrossRef] [Green Version]
- Li, X. Collaborative Expression Mechanism between Shikimate Pathway and Flavonoid Metabolism. Ph.D. Thesis, China Agricultural University, Beijing, China, 2016. (In Chinese). [Google Scholar]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cai, J.; Wang, N.; Zhao, J.; Zhao, Y.; Xu, R.; Fu, F.; Pan, T.; Yu, Y.; Guo, Z.; She, W. Accumulation of Polyphenolics and Differential Expression of Genes Related to Shikimate Pathway during Fruit Development and Maturation of Chinese Olive (Canarium album). Agronomy 2023, 13, 895. https://doi.org/10.3390/agronomy13030895
Cai J, Wang N, Zhao J, Zhao Y, Xu R, Fu F, Pan T, Yu Y, Guo Z, She W. Accumulation of Polyphenolics and Differential Expression of Genes Related to Shikimate Pathway during Fruit Development and Maturation of Chinese Olive (Canarium album). Agronomy. 2023; 13(3):895. https://doi.org/10.3390/agronomy13030895
Chicago/Turabian StyleCai, Jingrong, Naiyu Wang, Junyue Zhao, Yan Zhao, Rong Xu, Fanghao Fu, Tengfei Pan, Yuan Yu, Zhixiong Guo, and Wenqin She. 2023. "Accumulation of Polyphenolics and Differential Expression of Genes Related to Shikimate Pathway during Fruit Development and Maturation of Chinese Olive (Canarium album)" Agronomy 13, no. 3: 895. https://doi.org/10.3390/agronomy13030895
APA StyleCai, J., Wang, N., Zhao, J., Zhao, Y., Xu, R., Fu, F., Pan, T., Yu, Y., Guo, Z., & She, W. (2023). Accumulation of Polyphenolics and Differential Expression of Genes Related to Shikimate Pathway during Fruit Development and Maturation of Chinese Olive (Canarium album). Agronomy, 13(3), 895. https://doi.org/10.3390/agronomy13030895