Anti-Inflammatory and Osteogenic Effect of Phloroglucinol-Enriched Whey Protein Isolate Fibrillar Coating on Ti-6Al-4V Alloy
Abstract
1. Introduction
2. Materials and Methods
2.1. Preparation of WPI Fibrillar Suspensions
2.2. Preparation and Characterization of WPI Fibrillar Coatings
2.3. Bacterial Strains and Culture Conditions
2.4. Bacterial Biofilm Development
2.5. Analysis of Bacterial Biofilm Structure and Composition
2.6. BM-MSC Culture and Seeding
2.7. BM-MSCs: Bacterial Biofilm Challenge
2.8. SEM Evaluation of BM-MSCs on Ti6Al4V Alloy
2.9. BM-MSC Metabolic Activity
2.10. BM-MSC Gene Expression Analysis
2.11. Statistical Analysis
3. Results and Discussion
3.1. Characterization of the WPI/PG Coatings on Ti6Al4V Alloy
3.2. Characterization of the Multispecies Biofilm
3.3. In Vitro Studies: Evaluation of WPI/PG Coatings in a Co-Culture Model of Multispecies Biofilm and BM-MSCs
3.3.1. BM-MSC Attachment, Spread, and Morphology
3.3.2. BM-MSC Metabolic Activity
3.3.3. Expression of Genes Related to Bone Matrix Formation and Mineralization in BM-MSCs
3.3.4. Gene Expression of Pro-Inflammatory Markers in BM-MSCs
3.4. General Discussion and Outlook
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ma, Y.; Wang, S.; Wang, H.; Chen, X.; Shuai, Y.; Wang, H.; Mao, Y.; He, F. Mesenchymal Stem Cells and Dental Implant Osseointegration during Aging: From Mechanisms to Therapy. Stem Cell Res. Ther. 2023, 14, 382. [Google Scholar] [CrossRef] [PubMed]
- Emam, S.M.; Moussa, N. Signaling Pathways of Dental Implants’ Osseointegration: A Narrative Review on Two of the Most Relevant; NF-κB and Wnt Pathways. BDJ Open 2024, 10, 29. [Google Scholar] [CrossRef] [PubMed]
- Lasserre, J.F.; Brecx, M.C.; Toma, S. Oral Microbes, Biofilms and Their Role in Periodontal and Peri-Implant Diseases. Materials 2018, 11, 1802. [Google Scholar] [CrossRef] [PubMed]
- Seo, B.Y.; Son, K.; Son, Y.-T.; Dahal, R.H.; Kim, S.; Kim, J.; Hwang, J.; Kwon, S.-M.; Lee, J.-M.; Lee, K.-B.; et al. Influence of Dental Titanium Implants with Different Surface Treatments Using Femtosecond and Nanosecond Lasers on Biofilm Formation. J. Funct. Biomater. 2023, 14, 297. [Google Scholar] [CrossRef]
- Kligman, S.; Ren, Z.; Chung, C.-H.; Perillo, M.A.; Chang, Y.-C.; Koo, H.; Zheng, Z.; Li, C. The Impact of Dental Implant Surface Modifications on Osseointegration and Biofilm Formation. J. Clin. Med. 2021, 10, 1641. [Google Scholar] [CrossRef]
- Zhao, H.; Yang, Y.; An, J.; Xin, H.; Xiao, Y.; Jia, Z.; Wu, Y.; Sheng, L.; Wen, M. Cu2O Nanocubes Embedded in Polycaprolactone Nanofibers for Photo–Chemotherapeutic Wound Disinfection and Regeneration. ACS Appl. Nano Mater. 2024, 7, 17707–17718. [Google Scholar] [CrossRef]
- Nazarov, D.; Kozlova, L.; Rogacheva, E.; Kraeva, L.; Maximov, M. Atomic Layer Deposition of Antibacterial Nanocoatings: A Review. Antibiotics 2023, 12, 1656. [Google Scholar] [CrossRef]
- Long, L.; Fan, Y.; Yang, X.; Ding, X.; Hu, Y.; Zhang, G.; Xu, F.-J. A Hydrophobic Cationic Polyphenol Coating for Versatile Antibacterial and Hemostatic Devices. Chem. Eng. J. 2022, 444, 135426. [Google Scholar] [CrossRef]
- Malheiros, S.S.; Nagay, B.E.; Bertolini, M.M.; De Avila, E.D.; Shibli, J.A.; Souza, J.G.S.; Barão, V.A.R. Biomaterial Engineering Surface to Control Polymicrobial Dental Implant-Related Infections: Focusing on Disease Modulating Factors and Coatings Development. Expert Rev. Med. Devices 2023, 20, 557–573. [Google Scholar] [CrossRef]
- Douglas, T.E.L.; Vandrovcová, M.; Kročilová, N.; Keppler, J.K.; Zárubová, J.; Skirtach, A.G.; Bačáková, L. Application of Whey Protein Isolate in Bone Regeneration: Effects on Growth and Osteogenic Differentiation of Bone-Forming Cells. J. Dairy Sci. 2018, 101, 28–36. [Google Scholar] [CrossRef]
- Heyn, T.R.; Garamus, V.M.; Neumann, H.R.; Uttinger, M.J.; Guckeisen, T.; Heuer, M.; Selhuber-Unkel, C.; Peukert, W.; Keppler, J.K. Influence of the Polydispersity of pH 2 and pH 3.5 Beta-Lactoglobulin Amyloid Fibril Solutions on Analytical Methods. Eur. Polym. J. 2019, 120, 109211. [Google Scholar] [CrossRef]
- Akkermans, C.; Venema, P.; Van Der Goot, A.J.; Gruppen, H.; Bakx, E.J.; Boom, R.M.; Van Der Linden, E. Peptides Are Building Blocks of Heat-Induced Fibrillar Protein Aggregates of β-Lactoglobulin Formed at pH 2. Biomacromolecules 2008, 9, 1474–1479. [Google Scholar] [CrossRef]
- Keppler, J.K.; Martin, D.; Garamus, V.M.; Berton-Carabin, C.; Nipoti, E.; Coenye, T.; Schwarz, K. Functionality of Whey Proteins Covalently Modified by Allyl Isothiocyanate. Part 1 Physicochemical and Antibacterial Properties of Native and Modified Whey Proteins at pH 2 to 7. Food Hydrocoll. 2017, 65, 130–143. [Google Scholar] [CrossRef]
- Gupta, D.; Kocot, M.; Tryba, A.M.; Serafim, A.; Stancu, I.C.; Jaegermann, Z.; Pamuła, E.; Reilly, G.C.; Douglas, T.E.L. Novel Naturally Derived Whey Protein Isolate and Aragonite Biocomposite Hydrogels Have Potential for Bone Regeneration. Mater. Des. 2020, 188, 108408. [Google Scholar] [CrossRef]
- Hempel, U.; Matthäus, C.; Preissler, C.; Möller, S.; Hintze, V.; Dieter, P. Artificial Matrices With High-Sulfated Glycosaminoglycans and Collagen Are Anti-Inflammatory and Pro-Osteogenic for Human Mesenchymal Stromal Cells. J. Cell. Biochem. 2014, 115, 1561–1571. [Google Scholar] [CrossRef]
- Hempel, U.; Preissler, C.; Vogel, S.; Möller, S.; Hintze, V.; Becher, J.; Schnabelrauch, M.; Rauner, M.; Hofbauer, L.C.; Dieter, P. Artificial Extracellular Matrices with Oversulfated Glycosaminoglycan Derivatives Promote the Differentiation of Osteoblast-Precursor Cells and Premature Osteoblasts. BioMed Res. Int. 2014, 2014, 938368. [Google Scholar] [CrossRef] [PubMed]
- Norris, K.; Kocot, M.; Tryba, A.M.; Chai, F.; Talari, A.; Ashton, L.; Parakhonskiy, B.V.; Samal, S.K.; Blanchemain, N.; Pamuła, E.; et al. Marine-Inspired Enzymatic Mineralization of Dairy-Derived Whey Protein Isolate (WPI) Hydrogels for Bone Tissue Regeneration. Mar. Drugs 2020, 18, 294. [Google Scholar] [CrossRef]
- Lee, D.-S.; Cho, Y.-S.; Je, J.-Y. Antioxidant and Antibacterial Activities of Chitosan-Phloroglucinol Conjugate. Fish. Aquat. Sci. 2013, 16, 229–235. [Google Scholar] [CrossRef]
- Platania, V.; Douglas, T.E.L.; Zubko, M.K.; Ward, D.; Pietryga, K.; Chatzinikolaidou, M. Phloroglucinol-Enhanced Whey Protein Isolate Hydrogels with Antimicrobial Activity for Tissue Engineering. Mater. Sci. Eng. C 2021, 129, 112412. [Google Scholar] [CrossRef]
- Kang, K.A.; Lee, K.H.; Chae, S.; Zhang, R.; Jung, M.S.; Ham, Y.M.; Baik, J.S.; Lee, N.H.; Hyun, J.W. Cytoprotective Effect of Phloroglucinol on Oxidative Stress Induced Cell Damage via Catalase Activation. J. Cell. Biochem. 2006, 97, 609–620. [Google Scholar] [CrossRef]
- Kim, M.-M.; Kim, S.-K. Effect of Phloroglucinol on Oxidative Stress and Inflammation. Food Chem. Toxicol. 2010, 48, 2925–2933. [Google Scholar] [CrossRef] [PubMed]
- Lišková, J.; Douglas, T.E.L.; Beranová, J.; Skwarczyńska, A.; Božič, M.; Samal, S.K.; Modrzejewska, Z.; Gorgieva, S.; Kokol, V.; Bačáková, L. Chitosan Hydrogels Enriched with Polyphenols: Antibacterial Activity, Cell Adhesion and Growth and Mineralization. Carbohydr. Polym. 2015, 129, 135–142. [Google Scholar] [CrossRef] [PubMed]
- Mieszkowska, A.; Beaumont, H.; Martocq, L.; Koptyug, A.; Surmeneva, M.A.; Surmenev, R.A.; Naderi, J.; Douglas, T.E.L.; Gurzawska-Comis, K.A. Phenolic-Enriched Collagen Fibrillar Coatings on Titanium Alloy to Promote Osteogenic Differentiation and Reduce Inflammation. Int. J. Mol. Sci. 2020, 21, 6406. [Google Scholar] [CrossRef] [PubMed]
- Rabe, R.; Hempel, U.; Martocq, L.; Keppler, J.K.; Aveyard, J.; Douglas, T.E.L. Dairy-Inspired Coatings for Bone Implants from Whey Protein Isolate-Derived Self-Assembled Fibrils. Int. J. Mol. Sci. 2020, 21, 5544. [Google Scholar] [CrossRef]
- Douglas, T.E.L.; Hempel, U.; Żydek, J.; Vladescu, A.; Pietryga, K.; Kaeswurm, J.A.H.; Buchweitz, M.; Surmenev, R.A.; Surmeneva, M.A.; Cotrut, C.M.; et al. Pectin Coatings on Titanium Alloy Scaffolds Produced by Additive Manufacturing: Promotion of Human Bone Marrow Stromal Cell Proliferation. Mater. Lett. 2018, 227, 225–228. [Google Scholar] [CrossRef]
- Van Bael, S.; Chai, Y.C.; Truscello, S.; Moesen, M.; Kerckhofs, G.; Van Oosterwyck, H.; Kruth, J.-P.; Schrooten, J. The Effect of Pore Geometry on the in Vitro Biological Behavior of Human Periosteum-Derived Cells Seeded on Selective Laser-Melted Ti6Al4V Bone Scaffolds. Acta Biomater. 2012, 8, 2824–2834. [Google Scholar] [CrossRef]
- Facchetti, D.; Hempel, U.; Martocq, L.; Smith, A.M.; Koptyug, A.; Surmenev, R.A.; Surmeneva, M.A.; Douglas, T.E.L. Heparin Enriched-WPI Coating on Ti6Al4V Increases Hydrophilicity and Improves Proliferation and Differentiation of Human Bone Marrow Stromal Cells. Int. J. Mol. Sci. 2021, 23, 139. [Google Scholar] [CrossRef]
- Keppler, J.K.; Heyn, T.R.; Meissner, P.M.; Schrader, K.; Schwarz, K. Protein Oxidation during Temperature-Induced Amyloid Aggregation of Beta-Lactoglobulin. Food Chem. 2019, 289, 223–231. [Google Scholar] [CrossRef]
- Surmeneva, M.; Chudinova, E.; Syrtanov, M.; Koptioug, A.; Surmenev, R. Investigation of the HA Film Deposited on the Porous Ti6Al4V Alloy Prepared via Additive Manufacturing. IOP Conf. Ser. Mater. Sci. Eng. 2015, 98, 012025. [Google Scholar] [CrossRef]
- Norris, K.; Mishukova, O.I.; Zykwinska, A.; Colliec-Jouault, S.; Sinquin, C.; Koptioug, A.; Cuenot, S.; Kerns, J.G.; Surmeneva, M.A.; Surmenev, R.A.; et al. Marine Polysaccharide-Collagen Coatings on Ti6Al4V Alloy Formed by Self-Assembly. Micromachines 2019, 10, 68. [Google Scholar] [CrossRef]
- Ramage, G.; Lappin, D.F.; Millhouse, E.; Malcolm, J.; Jose, A.; Yang, J.; Bradshaw, D.J.; Pratten, J.R.; Culshaw, S. The Epithelial Cell Response to Health and Disease Associated Oral Biofilm Models. J. Periodontal Res. 2017, 52, 325–333. [Google Scholar] [CrossRef] [PubMed]
- Muchova, M.; Balacco, D.L.; Grant, M.M.; Chapple, I.L.C.; Kuehne, S.A.; Hirschfeld, J. Fusobacterium Nucleatum Subspecies Differ in Biofilm Forming Ability in Vitro. Front. Oral Health 2022, 3, 853618. [Google Scholar] [CrossRef] [PubMed]
- Millhouse, E.; Jose, A.; Sherry, L.; Lappin, D.F.; Patel, N.; Middleton, A.M.; Pratten, J.; Culshaw, S.; Ramage, G. Development of an in Vitroperiodontal Biofilm Model for Assessing Antimicrobial and Host Modulatory Effects of Bioactive Molecules. BMC Oral Health 2014, 14, 80. [Google Scholar] [CrossRef]
- Guggenheim, B.; Gmür, R.; Galicia, J.C.; Stathopoulou, P.G.; Benakanakere, M.R.; Meier, A.; Thurnheer, T.; Kinane, D.F. In Vitromodeling of Host-Parasite Interactions: The “subgingival” Biofilm Challenge of Primary Human Epithelial Cells. BMC Microbiol. 2009, 9, 280. [Google Scholar] [CrossRef] [PubMed]
- Abranches, J.; Zeng, L.; Kajfasz, J.K.; Palmer, S.R.; Chakraborty, B.; Wen, Z.T.; Richards, V.P.; Brady, L.J.; Lemos, J.A. Biology of Oral Streptococci. Microbiol. Spectr. 2018, 6. [Google Scholar] [CrossRef]
- Shahoumi, L.A.; Saleh, M.H.A.; Meghil, M.M. Virulence Factors of the Periodontal Pathogens: Tools to Evade the Host Immune Response and Promote Carcinogenesis. Microorganisms 2023, 11, 115. [Google Scholar] [CrossRef]
- Chopra, A.; Bhat, S.G.; Sivaraman, K. Porphyromonas Gingivalis Adopts Intricate and Unique Molecular Mechanisms to Survive and Persist within the Host: A Critical Update. J. Oral Microbiol. 2020, 12, 1801090. [Google Scholar] [CrossRef]
- Raja, M. Aggregatibacter Actinomycetemcomitans—A Tooth Killer? J. Clin. Diagn. Res. 2014, 8, ZE13. [Google Scholar] [CrossRef]
- Xing, H.; Taguchi, Y.; Komasa, S.; Yamawaki, I.; Sekino, T.; Umeda, M.; Okazaki, J. Effect of Porphyromonas Gingivalis Lipopolysaccharide on Bone Marrow Mesenchymal Stem Cell Osteogenesis on a Titanium Nanosurface. J. Periodontol. 2015, 86, 448–455. [Google Scholar] [CrossRef]
- Huang, Z.; Chen, G.; Wu, H.; Huang, X.; Xu, R.; Deng, F.; Li, Y. Ebselen Restores Peri-Implantitis-Induced Osteogenic Inhibition via Suppressing BMSCs Ferroptosis. Exp. Cell Res. 2023, 427, 113612. [Google Scholar] [CrossRef]
- Bifari, F.; Lisi, V.; Mimiola, E.; Pasini, A.; Krampera, M. Immune Modulation by Mesenchymal Stem Cells. Transfus. Med. Hemother. 2008, 35, 194–204. [Google Scholar] [CrossRef]
- Wang, M.; Yuan, Q.; Xie, L. Mesenchymal Stem Cell-Based Immunomodulation: Properties and Clinical Application. Stem Cells Int. 2018, 2018, 3057624. [Google Scholar] [CrossRef] [PubMed]
- Boyan, B.D.; Cheng, A.; Olivares-Navarrete, R.; Schwartz, Z. Implant Surface Design Regulates Mesenchymal Stem Cell Differentiation and Maturation. Adv. Dent. Res. 2016, 28, 10–17. [Google Scholar] [CrossRef]
- Civantos, A.; Domínguez, C.; Pino, R.J.; Setti, G.; Pavón, J.J.; Martínez-Campos, E.; Garcia Garcia, F.J.; Rodríguez, J.A.; Allain, J.P.; Torres, Y. Designing Bioactive Porous Titanium Interfaces to Balance Mechanical Properties and in Vitro Cells Behavior towards Increased Osseointegration. Surf. Coat. Technol. 2019, 368, 162–174. [Google Scholar] [CrossRef]
- Yao, Y.; Yang, Y.; Ye, Q.; Cao, S.; Zhang, X.; Zhao, K.; Jian, Y. Effects of Pore Size and Porosity on Cytocompatibility and Osteogenic Differentiation of Porous Titanium. J. Mater. Sci. Mater. Med. 2021, 32, 72. [Google Scholar] [CrossRef]
- Guadarrama Bello, D.; Fouillen, A.; Badia, A.; Nanci, A. A Nanoporous Titanium Surface Promotes the Maturation of Focal Adhesions and Formation of Filopodia with Distinctive Nanoscale Protrusions by Osteogenic Cells. Acta Biomater. 2017, 60, 339–349. [Google Scholar] [CrossRef] [PubMed]
- Stone, A.P.; Rand, E.; Thornes, G.; Kay, A.G.; Barnes, A.L.; Hitchcock, I.S.; Genever, P.G. Extracellular Matrices of Stromal Cell Subtypes Regulate Phenotype and Contribute to the Stromal Microenvironment In Vivo. Stem Cell Res. Ther. 2024, 15, 178. [Google Scholar] [CrossRef]
- Ward, C.L.; Sanchez Jr, C.J.; Pollot, B.E.; Romano, D.R.; Hardy, S.K.; Becerra, S.C.; Rathbone, C.R.; Wenke, J.C. Soluble Factors from Biofilms of Wound Pathogens Modulate Human Bone Marrow-Derived Stromal Cell Differentiation, Migration, Angiogenesis, and Cytokine Secretion. BMC Microbiol. 2015, 15, 75. [Google Scholar] [CrossRef]
- Vyas, K.S.; Wong, L.K. Detection of Biofilm in Wounds as an Early Indicator for Risk for Tissue Infection and Wound Chronicity. Ann. Plast. Surg. 2016, 76, 127–131. [Google Scholar] [CrossRef] [PubMed]
- Komori, T. Regulation of Osteoblast Differentiation by Runx2. In Osteoimmunology; Choi, Y., Ed.; Advances in Experimental Medicine and Biology; Springer: Boston, MA, USA, 2009; Volume 658, pp. 43–49. ISBN 978-1-4419-1049-3. [Google Scholar]
- Silvent, J.; Nassif, N.; Helary, C.; Azaïs, T.; Sire, J.-Y.; Guille, M.M.G. Collagen Osteoid-Like Model Allows Kinetic Gene Expression Studies of Non-Collagenous Proteins in Relation with Mineral Development to Understand Bone Biomineralization. PLoS ONE 2013, 8, e57344. [Google Scholar] [CrossRef]
- Xu, J.; Li, Z.; Hou, Y.; Fang, W. Potential Mechanisms Underlying the Runx2 Induced Osteogenesis of Bone Marrow Mesenchymal Stem Cells. Am. J. Transl. Res. 2015, 7, 2527–2535. [Google Scholar]
- Liu, T.M.; Lee, E.H. Transcriptional Regulatory Cascades in Runx2-Dependent Bone Development. Tissue Eng. Part B Rev. 2013, 19, 254–263. [Google Scholar] [CrossRef]
- AlMoharib, H.S.; AlRowis, R.; AlMubarak, A.; Waleed Almadhoon, H.; Ashri, N. The Relationship between Matrix Metalloproteinases-8 and Peri-Implantitis: A Systematic Review and Meta-Analysis. Saudi Dent. J. 2023, 35, 283–293. [Google Scholar] [CrossRef] [PubMed]
- Sugawara, Y.; Suzuki, K.; Koshikawa, M.; Ando, M.; Iida, J. Necessity of Enzymatic Activity of Alkaline Phosphatase for Mineralization of Osteoblastic Cells. Jpn. J. Pharmacol. 2002, 88, 262–269. [Google Scholar] [CrossRef] [PubMed]
- Zohar, R.; Cheifetz, S.; McCulloch, C.A.G.; Sodek, J. Analysis of Intracellular Osteopontin as a Marker of Osteoblastic Cell Differentiation and Mesenchymal Cell Migration. Eur. J. Oral Sci. 1998, 106, 401–407. [Google Scholar] [CrossRef]
- Manolagas, S.C. Osteocalcin Promotes Bone Mineralization but Is Not a Hormone. PLOS Genet. 2020, 16, e1008714. [Google Scholar] [CrossRef]
- Umeyama, R.; Yamawaki, T.; Liu, D.; Kanazawa, S.; Takato, T.; Hoshi, K.; Hikita, A. Optimization of Culture Duration of Bone Marrow Cells before Transplantation with a β-Tricalcium Phosphate/Recombinant Collagen Peptide Hybrid Scaffold. Regen. Ther. 2020, 14, 284–295. [Google Scholar] [CrossRef]
- Pullisaar, H.; Verket, A.; Szoke, K.; Tiainen, H.; Haugen, H.J.; Brinchmann, J.E.; Reseland, J.E.; Østrup, E. Alginate Hydrogel Enriched with Enamel Matrix Derivative to Target Osteogenic Cell Differentiation in TiO2 Scaffolds. J. Tissue Eng. 2015, 6, 2041731415575870. [Google Scholar] [CrossRef]
- Han, Y.; Yang, J.; Fang, J.; Zhou, Y.; Candi, E.; Wang, J.; Hua, D.; Shao, C.; Shi, Y. The Secretion Profile of Mesenchymal Stem Cells and Potential Applications in Treating Human Diseases. Signal Transduct. Target. Ther. 2022, 7, 92. [Google Scholar] [CrossRef]
- Cai, B.; Lin, D.; Li, Y.; Wang, L.; Xie, J.; Dai, T.; Liu, F.; Tang, M.; Tian, L.; Yuan, Y.; et al. N2-Polarized Neutrophils Guide Bone Mesenchymal Stem Cell Recruitment and Initiate Bone Regeneration: A Missing Piece of the Bone Regeneration Puzzle. Adv. Sci. 2021, 8, 2100584. [Google Scholar] [CrossRef]
- Ebersole, J.L.; Peyyala, R.; Gonzalez, O.A. Biofilm-induced Profiles of Immune Response Gene Expression by Oral Epithelial Cells. Mol. Oral Microbiol. 2019, 34, omi.12251. [Google Scholar] [CrossRef] [PubMed]
- Yin, L.; Li, X.; Hou, J. Macrophages in Periodontitis: A Dynamic Shift between Tissue Destruction and Repair. Jpn. Dent. Sci. Rev. 2022, 58, 336–347. [Google Scholar] [CrossRef] [PubMed]
- Dieckow, S.; Szafrański, S.P.; Grischke, J.; Qu, T.; Doll-Nikutta, K.; Steglich, M.; Yang, I.; Häussler, S.; Stiesch, M. Structure and Composition of Early Biofilms Formed on Dental Implants Are Complex, Diverse, Subject-Specific and Dynamic. NPJ Biofilms Microbiomes 2024, 10, 155. [Google Scholar] [CrossRef] [PubMed]
- Khatri, M.; Bansal, M.; Puri, K.; Mehrotra, S.; Kumar, A.; Rehan, M. Evaluation of the Correlation between Interleukin 1β Levels in Peri-Implant Crevicular Fluid as an Adjunctive Diagnostic Marker with Clinical and Radiographic Parameters for Assessing the Peri-Implant Health Status. Natl. J. Maxillofac. Surg. 2022, 13, 421–429. [Google Scholar] [CrossRef]
- Severino, V.O.; Napimoga, M.H.; De Lima Pereira, S.A. Expression of IL-6, IL-10, IL-17 and IL-8 in the Peri-Implant Crevicular Fluid of Patients with Peri-Implantitis. Arch. Oral Biol. 2011, 56, 823–828. [Google Scholar] [CrossRef]
- Lopes, G.; Sousa, C.; Silva, L.R.; Pinto, E.; Andrade, P.B.; Bernardo, J.; Mouga, T.; Valentão, P. Can Phlorotannins Purified Extracts Constitute a Novel Pharmacological Alternative for Microbial Infections with Associated Inflammatory Conditions? PLoS ONE 2012, 7, e31145. [Google Scholar] [CrossRef]
- Douglas, T.E.L.; Dokupil, A.; Reczyńska, K.; Brackman, G.; Krok-Borkowicz, M.; Keppler, J.K.; Božič, M.; Van Der Voort, P.; Pietryga, K.; Samal, S.K.; et al. Enrichment of Enzymatically Mineralized Gellan Gum Hydrogels with Phlorotannin-Rich Ecklonia Cava Extract Seanol® to Endow Antibacterial Properties and Promote Mineralization. Biomed. Mater. 2016, 11, 045015. [Google Scholar] [CrossRef]
- Eom, S.-H.; Kim, Y.-M.; Kim, S.-K. Antimicrobial Effect of Phlorotannins from Marine Brown Algae. Food Chem. Toxicol. 2012, 50, 3251–3255. [Google Scholar] [CrossRef]







| Coating Denomination | Description |
|---|---|
| [WPI] autoclave | WPI fibrillar coating autoclaved |
| [WPI + PG 0.1%] autoclave | WPI + PG 0.1% mixed coating autoclaved |
| [WPI + PG 0.5%] autoclave | WPI + PG 0.5% mixed coating autoclaved |
| [WPI] autoclave + PG 0.1% | WPI fibrillar coating autoclaved + PG 0.1% added after |
| [WPI] autoclave + PG 0.5% | WPI fibrillar coating autoclaved + PG 0.5% added after |
| Bacteria Species | Primer Sequence (5′ to 3′) Forward | Primer Sequence (5′ to 3′) Reverse |
|---|---|---|
| S. mitis | GATACATAGCCGACCTGAG | CCATTGCCGAAGATTCC |
| P. gingivalis | AGGCAGCTTGCCATACTGCG | ACTGTTAGCAACTACCGATGT |
| A. actinomycetemcomitans | GAACCTTACCTACTCTTGA-CATCCGAA | TGCAGCACCTGTCT-CAAAGC |
| F. nucleatum | GGATTTATTGGGCGTAAAGC | GGCATTCCTACAAATATCTACGAA |
| Gene | Primer Sequence (5′ to 3′) Forward | Primer Sequence (5′ to 3′) Reverse |
|---|---|---|
| glyceraldehyde-3-phosphate dehydrogenase (GAPDH) | GAAGGTGAAGGTCGGAGTC | GAGATGGTGATGGGATTTC |
| RUNX family transcription factor 2 (RUNX2) | TCTTAGAACAAATTCTGCCCTTT | TGCTTTGGTCTTGAAATCACA |
| collagen type I alpha 1 chain (COL1A1) | GGTCAAGATGGTCGCCCC | GGAACACCTCGCTCTCCAG |
| alkaline phosphatase (ALPL) | CCTCGTTGACACCTGGAAGAG | TTCCGTGCGGTTCCAGA |
| osteopontin (SPP1) | CGAGGTGATAGTGTGGTTTATGG | GCACCATTCAACTCCTCGCTTTC |
| bone gamma-carboxyglutamate protein (BGLAP) | CTACCTGTATCAATGGCTGGG | GGATTGAGCTCACACACCT |
| interleukin-1 alpha (IL1A) | CGCCAATGACTCAGAGGAAGA | AGGGCGTCATTCAGGATGAA |
| interleukin-1 beta (IL1B) | TTCGAGGCACAAGGCACAA | AAGTCATCCTCATTGCCACTGT |
| interleukin-8 (IL8) | ATGACTTCCAA-GCTGGCCGTGGCT | TCTCAGCCCTCTTCAAAAACTTCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mieszkowska, A.; Martocq, L.; Koptyug, A.; Surmeneva, M.A.; Surmenev, R.A.; Naderi, J.; Muchova, M.; Gurzawska-Comis, K.A.; Douglas, T.E.L. Anti-Inflammatory and Osteogenic Effect of Phloroglucinol-Enriched Whey Protein Isolate Fibrillar Coating on Ti-6Al-4V Alloy. Polymers 2025, 17, 1514. https://doi.org/10.3390/polym17111514
Mieszkowska A, Martocq L, Koptyug A, Surmeneva MA, Surmenev RA, Naderi J, Muchova M, Gurzawska-Comis KA, Douglas TEL. Anti-Inflammatory and Osteogenic Effect of Phloroglucinol-Enriched Whey Protein Isolate Fibrillar Coating on Ti-6Al-4V Alloy. Polymers. 2025; 17(11):1514. https://doi.org/10.3390/polym17111514
Chicago/Turabian StyleMieszkowska, Anna, Laurine Martocq, Andrey Koptyug, Maria A. Surmeneva, Roman A. Surmenev, Javad Naderi, Maria Muchova, Katarzyna A. Gurzawska-Comis, and Timothy E. L. Douglas. 2025. "Anti-Inflammatory and Osteogenic Effect of Phloroglucinol-Enriched Whey Protein Isolate Fibrillar Coating on Ti-6Al-4V Alloy" Polymers 17, no. 11: 1514. https://doi.org/10.3390/polym17111514
APA StyleMieszkowska, A., Martocq, L., Koptyug, A., Surmeneva, M. A., Surmenev, R. A., Naderi, J., Muchova, M., Gurzawska-Comis, K. A., & Douglas, T. E. L. (2025). Anti-Inflammatory and Osteogenic Effect of Phloroglucinol-Enriched Whey Protein Isolate Fibrillar Coating on Ti-6Al-4V Alloy. Polymers, 17(11), 1514. https://doi.org/10.3390/polym17111514

