Orai3 Regulates Pancreatic Cancer Metastasis by Encoding a Functional Store Operated Calcium Entry Channel
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials and Reagents
2.2. Cell Culture
2.3. Lentiviral Stable Cell Line Generation
2.4. MTT Assay
2.5. Cell Cycle Analysis and Apoptosis Assay
2.6. Calcium Imaging
2.7. Western Blotting
2.8. Wound Healing Assay
2.9. Migration Assay
2.10. In Vivo Experiments
2.11. Tumor Lysates Preparation
2.12. qRT-PCR Analysis
2.13. Statistical Analysis
3. Results
3.1. Orai3 Expression Is Inversely Correlated to the Pancreatic Cancer Patients Survival
3.2. Orai3 Is Expressed in “Normal” as Well as Cancerous Pancreatic Cell Lines and Forms a Functional Ca2+ Influx Channel
3.3. Orai3 Regulates PC Cell Viability, Cell Cycle Progression and Apoptosis
3.4. Orai3 Controls PC Cell Migration In Vitro
3.5. Orai3 Regulates PC Progression and Metastasis In Vivo
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Global Burden of Disease Cancer Collaboration; Fitzmaurice, C.; Abate, D.; Abbasi, N.; Abbastabar, H.; Abd-Allah, F.; Abdel-Rahman, O.; Abdelalim, A.; Abdoli, A.; Abdollahpour, I.; et al. Global, Regional, and National Cancer Incidence, Mortality, Years of Life Lost, Years Lived with Disability, and Disability-Adjusted Life-Years for 29 Cancer Groups, 1990 to 2017: A Systematic Analysis for the Global Burden of Disease Study. JAMA Oncol. 2019, 5, 1749–1768. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rawla, P.; Sunkara, T.; Gaduputi, V. Epidemiology of Pancreatic Cancer: Global Trends, Etiology and Risk Factors. World J. Oncol. 2019, 10, 10–27. [Google Scholar] [CrossRef] [PubMed]
- Das, S.; Batra, S.K. Pancreatic cancer metastasis: Are we being pre-EMTed? Curr. Pharm. Des. 2015, 21, 1249–1255. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Monteith, G.R.; Davis, F.M.; Roberts-Thomson, S.J. Calcium channels and pumps in cancer: Changes and consequences. J. Biol. Chem. 2012, 287, 31666–31673. [Google Scholar] [CrossRef] [Green Version]
- Monteith, G.R.; Prevarskaya, N.; Roberts-Thomson, S.J. The calcium-cancer signalling nexus. Nat. Rev. Cancer 2017, 17, 367–380. [Google Scholar] [CrossRef] [Green Version]
- Vashisht, A.; Trebak, M.; Motiani, R.K. STIM and Orai proteins as novel targets for cancer therapy. A Review in the Theme: Cell and Molecular Processes in Cancer Metastasis. Am. J. Physiol. Cell Physiol. 2015, 309, C457–C469. [Google Scholar] [CrossRef] [Green Version]
- Vaeth, M.; Kahlfuss, S.; Feske, S. CRAC Channels and Calcium Signaling in T Cell-Mediated Immunity. Trends Immunol. 2020, 41, 878–901. [Google Scholar] [CrossRef]
- Yoast, R.E.; Emrich, S.M.; Trebak, M. The anatomy of native CRAC channel(s). Curr. Opin. Physiol. 2020, 17, 89–95. [Google Scholar] [CrossRef]
- Kim, M.H.; Seo, J.B.; Burnett, L.A.; Hille, B.; Koh, D.S. Characterization of store-operated Ca2+ channels in pancreatic duct epithelia. Cell Calcium 2013, 54, 266–275. [Google Scholar] [CrossRef] [Green Version]
- Saurav, S.; Tanwar, J.; Ahuja, K.; Motiani, R.K. Dysregulation of host cell calcium signaling during viral infections: Emerging paradigm with high clinical relevance. Mol. Asp. Med. 2021, 81, 101004. [Google Scholar] [CrossRef]
- Lopez, J.J.; Jardin, I.; Albarran, L.; Sanchez-Collado, J.; Cantonero, C.; Salido, G.M.; Smani, T.; Rosado, J.A. Molecular Basis and Regulation of Store-Operated Calcium Entry. Adv. Exp. Med. Biol. 2020, 1131, 445–469. [Google Scholar] [CrossRef]
- Lewis, R.S. Store-Operated Calcium Channels: From Function to Structure and Back Again. Cold Spring Harb. Perspect. Biol. 2020, 12, a035055. [Google Scholar] [CrossRef]
- Tanwar, J.; Trebak, M.; Motiani, R.K. Cardiovascular and Hemostatic Disorders: Role of STIM and Orai Proteins in Vascular Disorders. Adv. Exp. Med. Biol. 2017, 993, 425–452. [Google Scholar] [CrossRef]
- Avila-Medina, J.; Mayoral-Gonzalez, I.; Galeano-Otero, I.; Redondo, P.C.; Rosado, J.A.; Smani, T. Pathophysiological Significance of Store-Operated Calcium Entry in Cardiovascular and Skeletal Muscle Disorders and Angiogenesis. Adv. Exp. Med. Biol. 2020, 1131, 489–504. [Google Scholar] [CrossRef]
- Johnson, M.; Trebak, M. ORAI channels in cellular remodeling of cardiorespiratory disease. Cell Calcium 2019, 79, 1–10. [Google Scholar] [CrossRef]
- Feske, S. CRAC channels and disease—From human CRAC channelopathies and animal models to novel drugs. Cell Calcium 2019, 80, 112–116. [Google Scholar] [CrossRef]
- Zhang, X.; Xin, P.; Yoast, R.E.; Emrich, S.M.; Johnson, M.T.; Pathak, T.; Benson, J.C.; Azimi, I.; Gill, D.L.; Monteith, G.R.; et al. Distinct pharmacological profiles of ORAI1, ORAI2, and ORAI3 channels. Cell Calcium 2020, 91, 102281. [Google Scholar] [CrossRef]
- Robinson, L.J.; Blair, H.C.; Barnett, J.B.; Soboloff, J. The roles of Orai and Stim in bone health and disease. Cell Calcium 2019, 81, 51–58. [Google Scholar] [CrossRef]
- Tiffner, A.; Derler, I. Isoform-Specific Properties of Orai Homologues in Activation, Downstream Signaling, Physiology and Pathophysiology. Int. J. Mol. Sci. 2021, 22, 8020. [Google Scholar] [CrossRef]
- Motiani, R.K.; Stolwijk, J.A.; Newton, R.L.; Zhang, X.; Trebak, M. Emerging roles of Orai3 in pathophysiology. Channels 2013, 7, 392–401. [Google Scholar] [CrossRef] [Green Version]
- Tanwar, J.; Arora, S.; Motiani, R.K. Orai3: Oncochannel with therapeutic potential. Cell Calcium 2020, 90, 102247. [Google Scholar] [CrossRef]
- Motiani, R.K.; Hyzinski-Garcia, M.C.; Zhang, X.; Henkel, M.M.; Abdullaev, I.F.; Kuo, Y.H.; Matrougui, K.; Mongin, A.A.; Trebak, M. STIM1 and Orai1 mediate CRAC channel activity and are essential for human glioblastoma invasion. Pflugers Arch. 2013, 465, 1249–1260. [Google Scholar] [CrossRef] [Green Version]
- Motiani, R.K.; Abdullaev, I.F.; Trebak, M. A novel native store-operated calcium channel encoded by Orai3: Selective requirement of Orai3 versus Orai1 in estrogen receptor-positive versus estrogen receptor-negative breast cancer cells. J. Biol. Chem. 2010, 285, 19173–19183. [Google Scholar] [CrossRef] [Green Version]
- Motiani, R.K.; Zhang, X.; Harmon, K.E.; Keller, R.S.; Matrougui, K.; Bennett, J.A.; Trebak, M. Orai3 is an estrogen receptor alpha-regulated Ca2+ channel that promotes tumorigenesis. FASEB J. 2013, 27, 63–75. [Google Scholar] [CrossRef] [Green Version]
- Faouzi, M.; Hague, F.; Potier, M.; Ahidouch, A.; Sevestre, H.; Ouadid-Ahidouch, H. Down-regulation of Orai3 arrests cell-cycle progression and induces apoptosis in breast cancer cells but not in normal breast epithelial cells. J. Cell. Physiol. 2011, 226, 542–551. [Google Scholar] [CrossRef]
- Faouzi, M.; Kischel, P.; Hague, F.; Ahidouch, A.; Benzerdjeb, N.; Sevestre, H.; Penner, R.; Ouadid-Ahidouch, H. ORAI3 silencing alters cell proliferation and cell cycle progression via c-myc pathway in breast cancer cells. Biochim. Biophys. Acta 2013, 1833, 752–760. [Google Scholar] [CrossRef] [Green Version]
- Mignen, O.; Thompson, J.L.; Shuttleworth, T.J. Both Orai1 and Orai3 are essential components of the arachidonate-regulated Ca2+-selective (ARC) channels. J. Physiol. 2008, 586, 185–195. [Google Scholar] [CrossRef]
- Mignen, O.; Thompson, J.L.; Shuttleworth, T.J. The molecular architecture of the arachidonate-regulated Ca2+-selective ARC channel is a pentameric assembly of Orai1 and Orai3 subunits. J. Physiol. 2009, 587, 4181–4197. [Google Scholar] [CrossRef]
- Gonzalez-Cobos, J.C.; Zhang, X.; Zhang, W.; Ruhle, B.; Motiani, R.K.; Schindl, R.; Muik, M.; Spinelli, A.M.; Bisaillon, J.M.; Shinde, A.V.; et al. Store-independent Orai1/3 channels activated by intracrine leukotriene C4: Role in neointimal hyperplasia. Circ. Res. 2013, 112, 1013–1025. [Google Scholar] [CrossRef] [Green Version]
- Zhang, X.; Gonzalez-Cobos, J.C.; Schindl, R.; Muik, M.; Ruhle, B.; Motiani, R.K.; Bisaillon, J.M.; Zhang, W.; Fahrner, M.; Barroso, M.; et al. Mechanisms of STIM1 activation of store-independent leukotriene C4-regulated Ca2+ channels. Mol. Cell. Biol. 2013, 33, 3715–3723. [Google Scholar] [CrossRef] [Green Version]
- Shuttleworth, T.J. Orai3--the “exceptional” Orai? J. Physiol. 2012, 590, 241–257. [Google Scholar] [CrossRef] [PubMed]
- Dubois, C.; Vanden Abeele, F.; Lehen’kyi, V.; Gkika, D.; Guarmit, B.; Lepage, G.; Slomianny, C.; Borowiec, A.S.; Bidaux, G.; Benahmed, M.; et al. Remodeling of channel-forming ORAI proteins determines an oncogenic switch in prostate cancer. Cancer Cell 2014, 26, 19–32. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dubois, C.; Kondratska, K.; Kondratskyi, A.; Morabito, A.; Mesilmany, L.; Farfariello, V.; Toillon, R.A.; Ziental Gelus, N.; Laurenge, E.; Vanden Abeele, F.; et al. ORAI3 silencing alters cell proliferation and promotes mitotic catastrophe and apoptosis in pancreatic adenocarcinoma. Biochim. Biophys. Acta Mol. Cell Res. 2021, 1868, 119023. [Google Scholar] [CrossRef] [PubMed]
- Motiani, R.K.; Tanwar, J.; Raja, D.A.; Vashisht, A.; Khanna, S.; Sharma, S.; Srivastava, S.; Sivasubbu, S.; Natarajan, V.T.; Gokhale, R.S. STIM1 activation of adenylyl cyclase 6 connects Ca2+ and cAMP signaling during melanogenesis. EMBO J. 2018, 37, e97597. [Google Scholar] [CrossRef] [PubMed]
- Vashisht, A.; Tanwar, J.; Motiani, R.K. Regulation of proto-oncogene Orai3 by miR18a/b and miR34a. Cell Calcium 2018, 75, 101–111. [Google Scholar] [CrossRef] [PubMed]
- Peinelt, C.; Lis, A.; Beck, A.; Fleig, A.; Penner, R. 2-Aminoethoxydiphenyl borate directly facilitates and indirectly inhibits STIM1-dependent gating of CRAC channels. J. Physiol. 2008, 586, 3061–3073. [Google Scholar] [CrossRef] [PubMed]
- DeHaven, W.I.; Smyth, J.T.; Boyles, R.R.; Bird, G.S.; Putney, J.W., Jr. Complex actions of 2-aminoethyldiphenyl borate on store-operated calcium entry. J. Biol. Chem. 2008, 283, 19265–19273. [Google Scholar] [CrossRef] [Green Version]
- Zhang, S.L.; Kozak, J.A.; Jiang, W.; Yeromin, A.V.; Chen, J.; Yu, Y.; Penna, A.; Shen, W.; Chi, V.; Cahalan, M.D. Store-dependent and -independent modes regulating Ca2+ release-activated Ca2+ channel activity of human Orai1 and Orai3. J. Biol. Chem. 2008, 283, 17662–17671. [Google Scholar] [CrossRef] [Green Version]
- Schindl, R.; Bergsmann, J.; Frischauf, I.; Derler, I.; Fahrner, M.; Muik, M.; Fritsch, R.; Groschner, K.; Romanin, C. 2-aminoethoxydiphenyl borate alters selectivity of Orai3 channels by increasing their pore size. J. Biol. Chem. 2008, 283, 20261–20267. [Google Scholar] [CrossRef] [Green Version]
- Ay, A.S.; Benzerdjeb, N.; Sevestre, H.; Ahidouch, A.; Ouadid-Ahidouch, H. Orai3 constitutes a native store-operated calcium entry that regulates non small cell lung adenocarcinoma cell proliferation. PLoS ONE 2013, 8, e72889. [Google Scholar] [CrossRef] [Green Version]
- Daya, H.A.; Kouba, S.; Ouled-Haddou, H.; Benzerdjeb, N.; Telliez, M.S.; Dayen, C.; Sevestre, H.; Garcon, L.; Hague, F.; Ouadid-Ahidouch, H. Orai3-Mediates Cisplatin-Resistance in Non-Small Cell Lung Cancer Cells by Enriching Cancer Stem Cell Population through PI3K/AKT Pathway. Cancers 2021, 13, 2314. [Google Scholar] [CrossRef]
- Sun, J.; Lu, F.; He, H.; Shen, J.; Messina, J.; Mathew, R.; Wang, D.; Sarnaik, A.; Chang, W.; Kim, M.; et al. STIM1- and Orai1-mediated Ca2+ oscillation orchestrates invadopodium formation and melanoma invasion. J. Cell Biol. 2014, 207, 535–548. [Google Scholar] [CrossRef] [Green Version]
- Chen, Y.; Lai, C.; Chen, Y.; Chiu, W.; Chen, H.; Shen, M. STIM1-dependent Ca2+ signaling regulates podosome formation to facilitate cancer cell invasion. Sci. Rep. 2017, 7, 11523. [Google Scholar] [CrossRef] [Green Version]
- Hammad, A.S.; Machaca, K. Store Operated Calcium Entry in Cell Migration and Cancer Metastasis. Cells 2021, 10, 1246. [Google Scholar] [CrossRef]
- Wei, J.; Deng, Y.; Ye, J.; Luo, Y.; Weng, J.; He, Q.; Liu, F.; Li, M.; Liang, R.; Lin, Y.; et al. Store-operated Ca2+ entry as a key oncogenic Ca2+ signaling driving tumor invasion-metastasis cascade and its translational potential. Cancer Lett. 2021, 516, 64–72. [Google Scholar] [CrossRef]
- Kondratska, K.; Kondratskyi, A.; Yassine, M.; Lemonnier, L.; Lepage, G.; Morabito, A.; Skryma, R.; Prevarskaya, N. Orai1 and STIM1 mediate SOCE and contribute to apoptotic resistance of pancreatic adenocarcinoma. Biochim. Biophys. Acta 2014, 1843, 2263–2269. [Google Scholar] [CrossRef] [Green Version]
- Emrich, S.M.; Yoast, R.E.; Xin, P.; Arige, V.; Wagner, L.E.; Hempel, N.; Gill, D.L.; Sneyd, J.; Yule, D.I.; Trebak, M. Omnitemporal choreographies of all five STIM/Orai and IP3Rs underlie the complexity of mammalian Ca2+ signaling. Cell Rep. 2021, 34, 108760. [Google Scholar] [CrossRef]
- Yoast, R.E.; Emrich, S.M.; Zhang, X.; Xin, P.; Johnson, M.T.; Fike, A.J.; Walter, V.; Hempel, N.; Yule, D.I.; Sneyd, J.; et al. The native ORAI channel trio underlies the diversity of Ca2+ signaling events. Nat. Commun. 2020, 11, 2444. [Google Scholar] [CrossRef]
- Kappel, S.; Kilch, T.; Baur, R.; Lochner, M.; Peinelt, C. The Number and Position of Orai3 Units within Heteromeric Store-Operated Ca2+ Channels Alter the Pharmacology of ICRAC. Int. J. Mol. Sci. 2020, 21, 2458. [Google Scholar] [CrossRef] [Green Version]
- Kang, Q.; Peng, X.; Li, X.; Hu, D.; Wen, G.; Wei, Z.; Yuan, B. Calcium Channel Protein ORAI1 Mediates TGF-beta Induced Epithelial-to-Mesenchymal Transition in Colorectal Cancer Cells. Front. Oncol. 2021, 11, 649476. [Google Scholar] [CrossRef]
- Bhattacharya, A.; Kumar, J.; Hermanson, K.; Sun, Y.; Qureshi, H.; Perley, D.; Scheidegger, A.; Singh, B.B.; Dhasarathy, A. The calcium channel proteins ORAI3 and STIM1 mediate TGF-beta induced Snai1 expression. Oncotarget 2018, 9, 29468–29483. [Google Scholar] [CrossRef] [Green Version]
- Cano, A.; Perez-Moreno, M.A.; Rodrigo, I.; Locascio, A.; Blanco, M.J.; del Barrio, M.G.; Portillo, F.; Nieto, M.A. The transcription factor snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression. Nat. Cell Biol. 2000, 2, 76–83. [Google Scholar] [CrossRef] [PubMed]
- Azimi, I.; Milevskiy, M.J.G.; Chalmers, S.B.; Yapa, K.; Robitaille, M.; Henry, C.; Baillie, G.J.; Thompson, E.W.; Roberts-Thomson, S.J.; Monteith, G.R. ORAI1 and ORAI3 in Breast Cancer Molecular Subtypes and the Identification of ORAI3 as a Hypoxia Sensitive Gene and a Regulator of Hypoxia Responses. Cancers 2019, 11, 208. [Google Scholar] [CrossRef] [Green Version]









| Protein | Brand Name | Catalog Number |
|---|---|---|
| Orai1 | Abcam (Waltham, MA, USA) | ab86748 |
| Orai2 | Abcam (Waltham, MA, USA) | ab180146 |
| Orai3 | Abcam (Waltham, MA, USA) | ab254260 |
| Cyclin D1 | Cell Signaling Technology (Denvers, CO, USA) | 2978S |
| Cdk 4 | Santa Cruz Biotechnology (Dallas, TX, USA) | sc-601 |
| E-Cadherin | Cell Signaling Technology (Denvers, TX, USA) | 24E10 |
| MMP2 | Cell Signaling Technology (Denvers, TX, USA) | 4022S |
| Gene | Forward Primer | Reverse Primer |
|---|---|---|
| Orai1 | AGGTGATGAGCCTCAACGAG | CTGATCATGAGCGCAAACAG |
| Orai2 | GCAGCTACCTGGAACTGGTC | CGGGTACTGGTACTGCGTCT |
| Orai3 | TCCCCATCAGTCTGTCCCTT | GAAGGTCCCACAAGCTCTCC |
| GAPDH | AACTGCTTAGCACCCCTGGC | ATGACCTTGCCCACAGCCTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Arora, S.; Tanwar, J.; Sharma, N.; Saurav, S.; Motiani, R.K. Orai3 Regulates Pancreatic Cancer Metastasis by Encoding a Functional Store Operated Calcium Entry Channel. Cancers 2021, 13, 5937. https://doi.org/10.3390/cancers13235937
Arora S, Tanwar J, Sharma N, Saurav S, Motiani RK. Orai3 Regulates Pancreatic Cancer Metastasis by Encoding a Functional Store Operated Calcium Entry Channel. Cancers. 2021; 13(23):5937. https://doi.org/10.3390/cancers13235937
Chicago/Turabian StyleArora, Samriddhi, Jyoti Tanwar, Nutan Sharma, Suman Saurav, and Rajender K. Motiani. 2021. "Orai3 Regulates Pancreatic Cancer Metastasis by Encoding a Functional Store Operated Calcium Entry Channel" Cancers 13, no. 23: 5937. https://doi.org/10.3390/cancers13235937
APA StyleArora, S., Tanwar, J., Sharma, N., Saurav, S., & Motiani, R. K. (2021). Orai3 Regulates Pancreatic Cancer Metastasis by Encoding a Functional Store Operated Calcium Entry Channel. Cancers, 13(23), 5937. https://doi.org/10.3390/cancers13235937

