Prevalence and Characterization of PVL-Positive Staphylococcus aureus Isolated from Raw Cow’s Milk
Abstract
1. Introduction
2. Results
2.1. Prevalence and Molecular Characterization of PVL-Positive S. aureus
2.2. Virulence Gene Profiles and Genotypic Profiles of β-Lactam Resistance
2.3. Antimicrobial Susceptibility Testing and Resistance Patterns of the PVL-Positive MRSA and MSSA
2.4. Association of Resistance Phenotypes, Resistant Genes, and Virulence-Associated Genes in PVL-Positive S. aureus
3. Discussion
4. Conclusions
5. Materials and Methods
5.1. Sampling
5.2. Bacterial Isolation
5.3. Genomic DNA Extraction and Molecular Characterization of PVL-Positive S. aureus
5.4. Antimicrobial Susceptibility Test
5.5. Detection of Virulence-Associated Genes
5.6. Genotypic Profile of β-Lactam Resistance
| Target Gene | Primer Direction and Sequence | Amplicon Size (bp) | Reference |
|---|---|---|---|
| nuc | F: GTGCTGGCATATGTATGGCAATTG | 660 | [90] |
| R: CTGAATCAGCGTTGTCTTCGCTCCAA | |||
| Pvl | F: ATCATTAGGTAAAATGTCTGGACA TGATCCA | 433 | [46] |
| R: GCATCAACTGTATTGGATAGCAAAAGC | |||
| mecA | F: TCCAGATTACAACTTCACCAGG | 162 | [97] |
| R: CCACTTCATATCTTGTAACG | |||
| blaZ | F: TACAACTGTAATATCGGAGGG | 861 | [97] |
| R: CATTACACTCTTGGCGGTTTC | |||
| tst | F: CGTAAGCCCTTTGTTGCTTG | 543 | [90] |
| R: CCACCCGTTTTATCGCTTGAAC | |||
| hla | F: CCGGTACTACAGATATTGGAAGC | 744 | [90] |
| R: GGTAATCATCACGAACTCGTTCG | |||
| seb | F: TCG CAT CAA ACT GAC AAA CG | 478 | [96] |
| R: GCA GGT ACT CTA TAA GTG CC | |||
| sea | F: GCA GGG AAC AGC TTT AGG C | 520 | [95] |
| R: GTT CTG TAG AAG TAT GAA ACA CG | |||
| sec | F: CTT GTA TGT ATG GAG GAA TAA CAA | 283 | [95] |
| R: TGC AGG CAT CAT ATC ATA CCA | |||
| see | F: TAC CAA TTA ACT TGT GGA TAG AC | 170 | [95] |
| R: CTC TTT GCA CCT TAC CGC | |||
| seg | F: CGT CTC CAC CTG TTG AAG G | 327 | [95] |
| R: CCA AGT GAT TGT CTA TTG TCG | |||
| sei | F: CAA CTC GAA TTT TCA ACA GGT AC | 465 | [95] |
| R: CAG GCA GTC CAT CTC CTG | |||
| selj | F: CAT CAG AAC TGT TGT TCC GCT AG | 142 | [95] |
| R: CTG AAT TTT ACC ATC AAA GGT AC |
5.7. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| PVL | Panton-Valentine leucocidin |
| MRSA | methicillin-resistant S. aureus |
| MSSA | methicillin-sensitive S. aureus |
| CLSI | Clinical and Laboratory Standards Institute |
| PCR | Polymerase chain reaction |
| TSB | Trypticase soy broth |
| MDR | Multidrug resistance |
| SEs | Staphylococcal enterotoxin genes |
| bp | Base pairs |
| TSST-1 | Toxic shock syndrome toxin-1 |
| VRSA | Vancomycin-resistant S. aureus strains |
| SFP | Staphylococcal food poisoning |
| CIP | Ciprofloxacin |
| E | Erythromycin |
| CN | Gentamicin |
| P | Penicillin |
| CL | Clindamycin |
| OX | Oxacillin |
| SAM | Ampicillin-sulbactam |
| C | Chloramphenicol |
| SXT | Trimethoprim-sulfamethoxazole |
| VA | Vancomycin Appendix A |
References
- Dhanashekar, R.; Akkinepalli, S.; Nellutla, A. Milk-borne infections. An analysis of their potential effect on the milk industry. Germs 2012, 2, 101–109. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bennett, S.D.; Walsh, K.A.; Gould, L.H. Foodborne disease outbreaks caused by Bacillus cereus, Clostridium perfringens, and Staphylococcus aureus—United States, 1998–2008. Clin. Infect. Dis. 2013, 57, 425–433. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Papadopoulos, P.; Papadopoulos, T.; Angelidis, A.S.; Boukouvala, E.; Zdragas, A.; Papa, A.; Hadjichristodoulou, C.; Sergelidis, D. Prevalence of Staphylococcus aureus and of methicillin-resistant S. aureus (MRSA) along the production chain of dairy products in north-western Greece. Food Microbiol. 2018, 69, 43–50. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Turner, N.A.; Sharma-Kuinkel, B.K.; Maskarinec, S.A.; Eichenberger, E.M.; Shah, P.P.; Carugati, M.; Holland, T.L.; Fowler, V.G., Jr. Methicillin-resistant Staphylococcus aureus: An overview of basic and clinical research. Nat. Rev. Microbiol. 2019, 17, 203–218. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lejeune, J.T.; Rajala-Schultz, P.J. Food safety: Unpasteurized milk: A continued public health threat. Clin. Infect. Dis. 2009, 48, 93–100. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, S.; Zhang, F.; Huang, J.; Wu, Q.; Zhang, J.; Dai, J.; Zeng, H.; Yang, X.; Chen, M.; Pang, R.; et al. Phenotypic and genotypic characterization of PVL-positive Staphylococcus aureus isolated from retail foods in China. Int. J. Food Microbiol. 2019, 304, 119–126. [Google Scholar] [CrossRef] [Scilit]
- Barrio, M.B.; Rainard, P.; Prevost, G. LukM/LukF’-PV is the most active Staphylococcus aureus leukotoxin on bovine neutrophils. Microbes. Infect. 2006, 8, 2068–2074. [Google Scholar] [CrossRef] [Scilit]
- Rahimi, E.; Alian, F. Presence of enterotoxigenic Staphylococcus aureus in cow, camel, sheep, goat, and buffalo bulk tank milk. Vet. Arh. 2013, 83, 23–30. [Google Scholar]
- Benic, M.; Habrun, B.; Kompes, G.; Mihaljevic, Z.; Cvetnic, Z.; Cergolj, M.; Macesic, N. Cell content in milk from cows with S. aureus intramammary infection. Vet. Arh. 2012, 82, 411–422. [Google Scholar]
- Contreras, A.; Sierra, D.; Sanchez, A.; Corrales, J.C.; Marco, J.C.; Paape, M.J.; Gonzalo, C. Mastitis in small ruminants. Small Rumin. Res. 2007, 68, 145–153. [Google Scholar] [CrossRef] [Scilit]
- Algammal, A.M.; Hetta, H.F.; Elkelish, A.; Alkhalifah, D.H.H.; Hozzein, W.N.; Batiha, G.E.; El Nahhas, N.; Mabrok, M.A. Methicillin-Resistant Staphylococcus aureus (MRSA): One Health Perspective Approach to the Bacterium Epidemiology, Virulence Factors, Antibiotic-Resistance, and Zoonotic Impact. Infect. Drug Resist. 2020, 13, 3255–3265. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Silva, S.D.S.P.D.; Cidral, T.A.; Soares, M.J.; de Melo, M.C. Enterotoxin-Encoding Genes in Staphylococcus spp. from Food Handlers in a University Restaurant. Foodborne Pathog. Dis. 2015, 12, 921–925. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tarekgne, E.K.; Skjerdal, T.; Skeie, S.; Rudi, K.; Porcellato, D.; Felix, B.; Narvhus, J.A. Enterotoxin Gene Profile and Molecular Characterization of Staphylococcus aureus Isolates from Bovine Bulk Milk and Milk Products of Tigray Region, Northern Ethiopia. J. Food Prot. 2016, 79, 1387–1395. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mekonnen, S.A.; Lam, T.; Hoekstra, J.; Rutten, V.; Tessema, T.S.; Broens, E.M.; Riesebos, A.E.; Spaninks, M.P.; Koop, G. Characterization of Staphylococcus aureus isolated from milk samples of dairy cows in small holder farms of North-Western Ethiopia. BMC Vet. Res. 2018, 14, 246. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, D.; Zhang, L.; Zhou, X.; He, Y.; Yong, C.; Shen, M.; Szenci, O.; Han, B. Antimicrobial susceptibility, virulence genes, and randomly amplified polymorphic DNA analysis of Staphylococcus aureus recovered from bovine mastitis in Ningxia, China. J. Dairy Sci. 2016, 99, 9560–9569. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tam, K.; Torres, V.J. Staphylococcus aureus Secreted Toxins and Extracellular Enzymes. Microbiol. Spectr. 2019, 7, GPP3-0039-2018. [Google Scholar] [CrossRef] [Scilit]
- Shambat, S.M.; Haggar, A.; Vandenesch, F.; Lina, G.; van Wamel, W.J.; Arakere, G.; Svensson, M.; Norrby-Teglund, A. Levels of alpha-toxin correlate with distinct phenotypic response profiles of blood mononuclear cells and with agr background of community-associated Staphylococcus aureus isolates. PLoS ONE 2014, 9, e106107. [Google Scholar] [CrossRef] [Scilit]
- Maurer, K.; Reyes-Robles, T.; Alonzo, F., 3rd; Durbin, J.; Torres, V.J.; Cadwell, K. Autophagy mediates tolerance to Staphylococcus aureus alpha-toxin. Cell Host Microbe 2015, 17, 429–440. [Google Scholar] [CrossRef] [Scilit]
- Popov, L.M.; Marceau, C.D.; Starkl, P.M.; Lumb, J.H.; Shah, J.; Guerrera, D.; Cooper, R.L.; Merakou, C.; Bouley, D.M.; Meng, W.; et al. The adherens junctions control susceptibility to Staphylococcus aureus alpha-toxin. Proc. Natl. Acad. Sci. USA 2015, 112, 14337–14342. [Google Scholar] [CrossRef] [Scilit]
- Argudin, M.A.; Mendoza, M.C.; Rodicio, M.R. Food poisoning and Staphylococcus aureus enterotoxins. Toxins 2010, 2, 1751–1773. [Google Scholar] [CrossRef] [Scilit]
- Rankin, S.; Roberts, S.; O’Shea, K.; Maloney, D.; Lorenzo, M.; Benson, C.E. Panton valentine leukocidin (PVL) toxin positive MRSA strains isolated from companion animals. Vet. Microbiol. 2005, 108, 145–148. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gillet, Y.; Issartel, B.; Vanhems, P.; Fournet, J.C.; Lina, G.; Bes, M.; Vandenesch, F.; Piemont, Y.; Brousse, N.; Floret, D.; et al. Association between Staphylococcus aureus strains carrying gene for Panton-Valentine leukocidin and highly lethal necrotising pneumonia in young immunocompetent patients. Lancet 2002, 359, 753–759. [Google Scholar] [CrossRef] [Scilit]
- Pitkala, A.; Salmikivi, L.; Bredbacka, P.; Myllyniemi, A.L.; Koskinen, M.T. Comparison of tests for detection of beta-lactamase-producing staphylococci. J. Clin. Microbiol. 2007, 45, 2031–2033. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Santy-Tomlinson, J. Antimicrobial resistance stewardship: It’s up to us all. Int. J. Orthop. Trauma Nurs. 2018, 28, 1–3. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, H.Z.; Hackbarth, C.J.; Chansky, K.M.; Chambers, H.F. A proteolytic transmembrane signaling pathway and resistance to beta-lactams in staphylococci. Science 2001, 291, 1962–1965. [Google Scholar] [CrossRef] [Scilit]
- Lowy, F.D. Antimicrobial resistance: The example of Staphylococcus aureus. J. Clin. Investig. 2003, 111, 1265–1273. [Google Scholar] [CrossRef]
- Cikman, A.; Aydin, M.; Gulhan, B.; Karakecili, F.; Kurtoglu, M.G.; Yuksekkaya, S.; Parlak, M.; Gultepe, B.S.; Cicek, A.C.; Bilman, F.B.; et al. Absence of the mecC gene in methicillin-resistant Staphylococcus aureus isolated from various clinical samples: The first multi-centered study in Turkey. J. Infect. Public Health 2019, 12, 528–533. [Google Scholar] [CrossRef] [Scilit]
- Perez, J.R.; Rosa, L.Z.; Sanchez, A.G.; Salcedo, J.H.d.M.; Rodriguez, J.M.A.; Horrillo, R.C.; Zurita, S.G.; Molino, M.G. Multiple Antimicrobial Resistance in Methicillin-Resistant Staphylococcus sciuri Group Isolates from Wild Ungulates in Spain. Antibiotics 2021, 10, 920. [Google Scholar] [CrossRef] [Scilit]
- Morgan, M. Methicillin-resistant Staphylococcus aureus and animals: Zoonosis or humanosis? J. Antimicrob. Chemother. 2008, 62, 1181–1187. [Google Scholar] [CrossRef] [Scilit]
- Hefzy, E.M.; Hassan, G.M.; El Reheem, F.A. Detection of Panton-Valentine Leukocidin-Positive Methicillin-Resistant Staphylococcus aureus Nasal Carriage among Egyptian Health Care Workers. Surg. Infect. 2016, 17, 369–375. [Google Scholar] [CrossRef] [Scilit]
- Elgendy, S.G.; Hameed, W.A.; Hameed, M.R.A.; Hassan, A.T. Detection of Panton-Valentine Leukocidin Gene in Clinical Isolates of Staphylococci at Assiut University Hospitals. Egypt. J. Med. Microbiol. 2016, 25, 77–83. [Google Scholar] [CrossRef] [Scilit]
- Khairalla, A.S.; Wasfi, R.; Ashour, H.M. Carriage frequency, phenotypic, and genotypic characteristics of methicillin-resistant Staphylococcus aureus isolated from dental health-care personnel, patients, and environment. Sci. Rep. 2017, 7, 7390. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ali, H.A.; El-Mahdy, R.H.; Gaballah, M.A. Community-acquired methicillin-resistant Staphylococcus aureus colonization in atopic dermatitis patients in Mansoura, Egypt. Biomed. Dermatol. 2019, 3, 2. [Google Scholar] [CrossRef] [Scilit]
- Pereyra, E.A.; Picech, F.; Renna, M.S.; Baravalle, C.; Andreotti, C.S.; Russi, R.; Calvinho, L.F.; Diez, C.; Dallard, B.E. Detection of Staphylococcus aureus adhesion and biofilm-producing genes and their expression during internalization in bovine mammary epithelial cells. Vet. Microbiol. 2016, 183, 69–77. [Google Scholar] [CrossRef] [Scilit]
- Ahmed, A.A.-H.; Maharik, N.M.S.; Valero, A.; Kamal, S.M. Incidence of enterotoxigenic Staphylococcus aureus in milk and Egyptian artisanal dairy products. Food Control 2019, 104, 20–27. [Google Scholar] [CrossRef] [Scilit]
- Al-Ashmawy, M.A.; Sallam, K.I.; Abd-Elghany, S.M.; Elhadidy, M.; Tamura, T. Prevalence, Molecular Characterization, and Antimicrobial Susceptibility of Methicillin-Resistant Staphylococcus aureus Isolated from Milk and Dairy Products. Foodborne Pathog. Dis. 2016, 13, 156–162. [Google Scholar] [CrossRef] [Scilit]
- Awad, A.; Ramadan, H.; Nasr, S.; Ateya, A.; Atwa, S. Genetic Characterization, Antimicrobial Resistance Patterns and Virulence Determinants of Staphylococcus aureus Isolated form Bovine Mastitis. Pak. J. Biol. Sci. 2017, 20, 298–305. [Google Scholar] [CrossRef] [Scilit]
- Abdeen, E.E.; Mousa, W.S.; Salam, S.Y.A.; Al-Maary, K.S.; Mubarak, A.S.; Moussa, I.M.; Hemeg, H.A.; Almuzaini, A.M.; Alajaji, A.I.; Alsubki, R.A.; et al. Antibiogram and phylogenetic diversity of enterotoxigenic Staphylococcus aureus strains from milk products and public health implications. Saudi J. Biol. Sci. 2020, 27, 1968–1974. [Google Scholar] [CrossRef] [Scilit]
- Younis, G.; Sadat, A.; Maghawry, M. Characterization of Coa Gene and Antimicrobial Profiles of Staphylococcus Aureus Isolated from Bovine Clinical and Subclinical mastitis. Adv. Anim. Vet. Sci. 2018, 6, 161–168. [Google Scholar] [CrossRef] [Scilit]
- Gundogan, N.; Avci, E. Occurrence and antibiotic resistance ofEscherichia coli, Staphylococcus aureusandBacillus cereusin raw milk and dairy products in Turkey. Int. J. Dairy Technol. 2014, 67, 562–569. [Google Scholar] [CrossRef] [Scilit]
- Liu, H.; Li, S.; Meng, L.; Dong, L.; Zhao, S.; Lan, X.; Wang, J.; Zheng, N. Prevalence, antimicrobial susceptibility, and molecular characterization of Staphylococcus aureus isolated from dairy herds in northern China. J. Dairy Sci. 2017, 100, 8796–8803. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kou, X.; Cai, H.; Huang, S.; Ni, Y.; Luo, B.; Qian, H.; Ji, H.; Wang, X. Prevalence and Characteristics of Staphylococcus aureus Isolated from Retail Raw Milk in Northern Xinjiang, China. Front. Microbiol. 2021, 12, 705947. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Egyptian Standards. Milk and Milk Products Part1: Raw Milk; Egyptian Organization for Standardization and Quality Control: Cairo, Egypt, 2005; pp. 1–154. [Google Scholar]
- Addis, M.; Pal, M.; Kyule, M.N. Isolation and Identification of Staphylococcus Species from Raw Bovine Milk in Debre Zeit, Ethiopia. Vet. Res. 2011, 4, 45–49. [Google Scholar] [CrossRef]
- Fogo, A.; Kemp, N.; Morris-Jones, R. PVL positive Staphylococcus aureus skin infections. BMJ 2011, 343, d5343. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lina, G.; Piemont, Y.; Godail-Gamot, F.; Bes, M.; Peter, M.O.; Gauduchon, V.; Vandenesch, F.; Etienne, J. Involvement of Panton-Valentine leukocidin-producing Staphylococcus aureus in primary skin infections and pneumonia. Clin. Infect. Dis. 1999, 29, 1128–1132. [Google Scholar] [CrossRef] [Scilit]
- Kwon, N.H.; Park, K.T.; Moon, J.S.; Jung, W.K.; Kim, S.H.; Kim, J.M.; Hong, S.K.; Koo, H.C.; Joo, Y.S.; Park, Y.H. Staphylococcal cassette chromosome mec (SCCmec) characterization and molecular analysis for methicillin-resistant Staphylococcus aureus and novel SCCmec subtype IVg isolated from bovine milk in Korea. J. Antimicrob. Chemother. 2005, 56, 624–632. [Google Scholar] [CrossRef] [Scilit]
- Haran, K.P.; Godden, S.M.; Boxrud, D.; Jawahir, S.; Bender, J.B.; Sreevatsan, S. Prevalence and characterization of Staphylococcus aureus, including methicillin-resistant Staphylococcus aureus, isolated from bulk tank milk from Minnesota dairy farms. J. Clin. Microbiol. 2012, 50, 688–695. [Google Scholar] [CrossRef] [Scilit]
- Shrivastava, N.; Sharma, V.; Shrivastav, A.; Nayak, A.; Rai, A.K. Prevalence and characterization of Panton-Valentine leukocidin-positive Staphylococcus aureus in bovine milk in Jabalpur district of Madhya Pradesh, India. Vet. World. 2018, 11, 316–320. [Google Scholar] [CrossRef] [Scilit]
- Umaru, G.A.; Kwaga, J.K.P.; Bello, M.; Raji, M.A.; Maitala, Y.S. Antibiotic resistance of Staphylococcus aureus isolated from fresh cow milk in settled Fulani herds in Kaduna State, Nigeria. Bull. Anim. Health Prod. Afr. 2016, 64, 173–182. [Google Scholar]
- Dinges, M.M.; Orwin, P.M.; Schlievert, P.M. Exotoxins of Staphylococcus aureus. Clin. Microbiol. Rev. 2000, 13, 16–34. [Google Scholar] [CrossRef]
- Vrieling, M.; Boerhout, E.M.; van Wigcheren, G.F.; Koymans, K.J.; Mols-Vorstermans, T.G.; de Haas, C.J.; Aerts, P.C.; Daemen, I.J.; van Kessel, K.P.; Koets, A.P.; et al. LukMF’ is the major secreted leukocidin of bovine Staphylococcus aureus and is produced in vivo during bovine mastitis. Sci. Rep. 2016, 6, 37759. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schmidt, T.; Kock, M.M.; Ehlers, M.M. Molecular Characterization of Staphylococcus aureus Isolated from Bovine Mastitis and Close Human Contacts in South African Dairy Herds: Genetic Diversity and Inter-Species Host Transmission. Front. Microbiol. 2017, 8, 511. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Crespo-Piazuelo, D.; Lawlor, P.G. Livestock-associated methicillin-resistant Staphylococcus aureus (LA-MRSA) prevalence in humans in close contact with animals and measures to reduce on-farm colonisation. Ir. Vet. J. 2021, 74, 21. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Umeda, K.; Nakamura, H.; Yamamoto, K.; Nishina, N.; Yasufuku, K.; Hirai, Y.; Hirayama, T.; Goto, K.; Hase, A.; Ogasawara, J. Molecular and epidemiological characterization of staphylococcal foodborne outbreak of Staphylococcus aureus harboring seg, sei, sem, sen, seo, and selu genes without production of classical enterotoxins. Int. J. Food Microbiol. 2017, 256, 30–35. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wakabayashi, Y.; Umeda, K.; Yonogi, S.; Nakamura, H.; Yamamoto, K.; Kumeda, Y.; Kawatsu, K. Staphylococcal food poisoning caused by Staphylococcus argenteus harboring staphylococcal enterotoxin genes. Int. J. Food Microbiol. 2018, 265, 23–29. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.; Yeh, A.J.; Cheung, G.Y.; Villaruz, A.E.; Tan, V.Y.; Joo, H.S.; Chatterjee, S.S.; Yu, Y.; Otto, M. Basis of virulence in a Panton-Valentine leukocidin-negative community-associated methicillin-resistant Staphylococcus aureus strain. J. Infect. Dis. 2015, 211, 472–480. [Google Scholar] [CrossRef] [Scilit]
- Ren, Q.; Liao, G.; Wu, Z.; Lv, J.; Chen, W. Prevalence and characterization of Staphylococcus aureus isolates from subclinical bovine mastitis in southern Xinjiang, China. J. Dairy Sci. 2020, 103, 3368–3380. [Google Scholar] [CrossRef] [Scilit]
- Le Loir, Y.; Baron, F.; Gautier, M. Staphylococcus aureus and food poisoning. Genet. Mol. Res. 2003, 2, 63–76. [Google Scholar]
- Chao, G.; Bao, G.; Cao, Y.; Yan, W.; Wang, Y.; Zhang, X.; Zhou, L.; Wu, Y. Prevalence and diversity of enterotoxin genes with genetic background of Staphylococcus aureus isolates from different origins in China. Int. J. Food Microbiol. 2015, 211, 142–147. [Google Scholar] [CrossRef] [Scilit]
- Peles, F.; Wagner, M.; Varga, L.; Hein, I.; Rieck, P.; Gutser, K.; Kereszturi, P.; Kardos, G.; Turcsanyi, I.; Beri, B.; et al. Characterization of Staphylococcus aureus strains isolated from bovine milk in Hungary. Int. J. Food Microbiol. 2007, 118, 186–193. [Google Scholar] [CrossRef] [Scilit]
- Oliveira, L.; Rodrigues, A.C.; Hulland, C.; Ruegg, P.L. Enterotoxin production, enterotoxin gene distribution, and genetic diversity of Staphylococcus aureus recovered from milk of cows with subclinical mastitis. Am. J. Vet. Res. 2011, 72, 1361–1368. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Asao, T.; Kumeda, Y.; Kawai, T.; Shibata, T.; Oda, H.; Haruki, K.; Nakazawa, H.; Kozaki, S. An extensive outbreak of staphylococcal food poisoning due to low-fat milk in Japan: Estimation of enterotoxin A in the incriminated milk and powdered skim milk. Epidemiol. Infect. 2003, 130, 33–40. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Omoe, K.; Ishikawa, M.; Shimoda, Y.; Hu, D.L.; Ueda, S.; Shinagawa, K. Detection of seg, seh, and sei genes in Staphylococcus aureus isolates and determination of the enterotoxin productivities of S. aureus isolates Harboring seg, seh, or sei genes. J. Clin. Microbiol. 2002, 40, 857–862. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Perez, V.K.C.; Costa, G.M.D.; Guimaraes, A.S.; Heinemann, M.B.; Lage, A.P.; Dorneles, E.M.S. Relationship between virulence factors and antimicrobial resistance in Staphylococcus aureus from bovine mastitis. J. Glob. Antimicrob. Resist. 2020, 22, 792–802. [Google Scholar] [CrossRef] [Scilit]
- Fessler, A.; Scott, C.; Kadlec, K.; Ehricht, R.; Monecke, S.; Schwarz, S. Characterization of methicillin-resistant Staphylococcus aureus ST398 from cases of bovine mastitis. J. Antimicrob. Chemother. 2010, 65, 619–625. [Google Scholar] [CrossRef] [Scilit]
- Yang, F.L.; Li, X.S.; Liang, X.W.; Zhang, X.F.; Qin, G.S.; Yang, B.Z. Detection of virulence-associated genes in Staphylococcus aureus isolated from bovine clinical mastitis milk samples in Guangxi. Trop. Anim. Health Prod. 2012, 44, 1821–1826. [Google Scholar] [CrossRef] [Scilit]
- Jones, T.F.; Kellum, M.E.; Porter, S.S.; Bell, M.; Schaffner, W. An outbreak of community-acquired foodborne illness caused by methicillin-resistant Staphylococcus aureus. Emerg. Infect. Dis. 2002, 8, 82–84. [Google Scholar] [CrossRef] [Scilit]
- Kamal, R.M.; Bayoumi, M.A.; El Aal, S.F.A. MRSA detection in raw milk, some dairy products and hands of dairy workers in Egypt, a mini-survey. Food Control 2013, 33, 49–53. [Google Scholar] [CrossRef] [Scilit]
- Algammal, A.M.; Enany, M.E.; El-Tarabili, R.M.; Ghobashy, M.O.I.; Helmy, Y.A. Prevalence, Antimicrobial Resistance Profiles, Virulence and Enterotoxins-Determinant Genes of MRSA Isolated from Subclinical Bovine Mastitis in Egypt. Pathogens 2020, 9, 362. [Google Scholar] [CrossRef] [Scilit]
- Turkyilmaz, S.; Tekbiyik, S.; Oryasin, E.; Bozdogan, B. Molecular epidemiology and antimicrobial resistance mechanisms of methicillin-resistant Staphylococcus aureus isolated from bovine milk. Zoonoses Public Health 2010, 57, 197–203. [Google Scholar] [CrossRef] [Scilit]
- Rhee, C.H.; Woo, G.J. Emergence and characterization of foodborne methicillin-resistant Staphylococcus aureus in Korea. J. Food Prot. 2010, 73, 2285–2290. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Spohr, M.; Rau, J.; Friedrich, A.; Klittich, G.; Fetsch, A.; Guerra, B.; Hammerl, J.A.; Tenhagen, B.A. Methicillin-resistant Staphylococcus aureus (MRSA) in three dairy herds in southwest Germany. Zoonoses Public Health 2011, 58, 252–261. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hussein, S.A.E.-M.; Ahlam, A.E.-L.; Mahmoud, N.E. Antibiotics Residues of Some Famous Antibiotics in Raw Milk of Different Species Sold at Local Markets. Alex. J. Vet. Sci. 2020, 64, 72. [Google Scholar]
- Kumar, N.; Sharma, G.; Leahy, E.; Shome, B.R.; Bandyopadhyay, S.; Deka, R.P.; Shome, R.; Dey, T.K.; Lindahl, J.F. Understanding Antibiotic Usage on Small-Scale Dairy Farms in the Indian States of Assam and Haryana Using a Mixed-Methods Approach-Outcomes and Challenges. Antibiotics 2021, 10, 1124. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Redding, L.E.; Cubas-Delgado, F.; Sammel, M.D.; Smith, G.; Galligan, D.T.; Levy, M.Z.; Hennessy, S. Antibiotic residues in milk from small dairy farms in rural Peru. Food Addit. Contam. Part A 2014, 31, 1001–1008. [Google Scholar] [CrossRef] [Scilit]
- Orwa, J.D.; Matofari, J.W.; Muliro, P.S.; Lamuka, P. Assessment of sulphonamides and tetracyclines antibiotic residue contaminants in rural and peri urban dairy value chains in Kenya. Int. J. Food Contam. 2017, 4, 5. [Google Scholar] [CrossRef] [Scilit]
- World Health Organization. Regional Office for the Eastern Mediterranean. Report on the Consultative Meeting on Antimicrobial Resistance for Countries in the Eastern Mediterranean Region: From Policies to Action; Sharm El Sheikh, Egypt, 2013. Available online: http://apps.who.int/iris/handle/10665/11 (accessed on 20 December 2021).
- World Health Organization. Antimicrobial Resistance for Countries in the Eastern Mediterranean Region. 2017. Available online: https://apps.who.int/iris/handle/10665/259051 (accessed on 20 December 2021).
- Tartor, Y.H.; Gharieb, R.M.A.; El-Aziz, N.K.A.; El Damaty, H.M.; Enany, S.; Khalifa, E.; Attia, A.S.A.; Abdellatif, S.S.; Ramadan, H. Virulence Determinants and Plasmid-Mediated Colistin Resistance mcr Genes in Gram-Negative Bacteria Isolated From Bovine Milk. Front. Cell. Infect. Microbiol. 2021, 11, 761417. [Google Scholar] [CrossRef] [Scilit]
- Mechesso, A.F.; Kim, S.J.; Park, H.S.; Choi, J.H.; Song, H.J.; Kim, M.H.; Lim, S.K.; Yoon, S.S.; Moon, D.C. Short communication: First detection of Panton-Valentine leukocidin-positive methicillin-resistant Staphylococcus aureus ST30 in raw milk taken from dairy cows with mastitis in South Korea. J. Dairy Sci. 2021, 104, 969–976. [Google Scholar] [CrossRef] [Scilit]
- Yang, F.; Wang, Q.; Wang, X.; Wang, L.; Xiao, M.; Li, X.; Zhang, S.; Li, H.; Luo, J. Prevalence of blaZ gene and other virulence genes in penicillin-resistantStaphylococcus aureus isolated from bovine mastitis cases in Gansu, China. Turk. J. Vet. Anim. Sci. 2015, 39, 634–636. [Google Scholar] [CrossRef] [Scilit]
- Silva, A.T.F.; da Silva, J.G.; Aragao, B.B.; Peixoto, R.M.; Mota, R.A. Occurrence of beta-lactam-resistant Staphylococcus aureus in milk from primiparous dairy cows in the northeastern region of Brazil. Trop. Anim. Health Prod. 2020, 52, 2303–2307. [Google Scholar] [CrossRef] [Scilit]
- Hammad, A.M.; Shimamoto, T.; Shimamoto, T. Genetic characterization of antibiotic resistance and virulence factors in Enterococcus spp. from Japanese retail ready-to-eat raw fish. Food Microbiol. 2014, 38, 62–66. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fikru, G. Staphylococcus: Epidemiology and its Drug Resistance in Cattle, Food Chains and Humans in Central Ethiopia. Master’s Thesis, Addis Ababa University, Bishoftu, Ethiopia, 2014. [Google Scholar]
- Normanno, G.; Corrente, M.; La Salandra, G.; Dambrosio, A.; Quaglia, N.C.; Parisi, A.; Greco, G.; Bellacicco, A.L.; Virgilio, S.; Celano, G.V. Methicillin-resistant Staphylococcus aureus (MRSA) in foods of animal origin product in Italy. Int. J. Food Microbiol. 2007, 117, 219–222. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mphahlele, M.P.; Oguttu, J.W.; Petzer, I.M.; Qekwana, D.N. Prevalence and antimicrobial drug resistance of Staphylococcus aureus isolated from cow milk samples. Vet. World 2020, 13, 2736–2742. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mekuria, A.; Asrat, D.; Woldeamanuel, Y.; Tefera, G. Identification and antimicrobial susceptibility of Staphylococcus aureus isolated from milk samples of dairy cows and nasal swabs of farm workers in selected dairy farms around Addis Ababa, Ethiopia. Afr. J. Microbiol. Res. 2013, 7, 3501–3510. [Google Scholar]
- Sharma, D.; Sharma, P.K.; Malik, A. Prevalence and Antimicrobial Susceptibility of Drug Resistant Staphylococcus aureus in Raw Milk of Dairy Cattle. Int. Res. J. Microbiol. 2011, 2, 466–470. [Google Scholar]
- Sallam, K.I.; Abd-Elghany, S.M.; Elhadidy, M.; Tamura, T. Molecular Characterization and Antimicrobial Resistance Profile of Methicillin-Resistant Staphylococcus aureus in Retail Chicken. J. Food Prot. 2015, 78, 1879–1884. [Google Scholar] [CrossRef] [Scilit]
- Weinstein, M.P.; Lewis, J.S., 2nd. The Clinical and Laboratory Standards Institute Subcommittee on Antimicrobial Susceptibility Testing: Background, Organization, Functions, and Processes. J. Clin. Microbiol. 2020, 58, e01864-19. [Google Scholar] [CrossRef]
- Wayne, P.A. Clinical and Laboratory Standards Institute (CLSI), Performance Standards for Antimicrobial Susceptibility Testing. Inform. Suppl. 2011, 31, 100–121. [Google Scholar]
- Waters, A.E.; Contente-Cuomo, T.; Buchhagen, J.; Liu, C.M.; Watson, L.; Pearce, K.; Foster, J.T.; Bowers, J.; Driebe, E.M.; Engelthaler, D.M.; et al. Multidrug-Resistant Staphylococcus aureus in US Meat and Poultry. Clin. Infect. Dis. 2011, 52, 1227–1230. [Google Scholar] [CrossRef] [Scilit]
- Krumperman, P.H. Multiple antibiotic resistance indexing of Escherichia coli to identify high-risk sources of fecal contamination of foods. Appl. Environ. Microbiol. 1983, 46, 165–170. [Google Scholar] [CrossRef] [Scilit]
- Monday, S.R.; Bohach, G.A. Use of multiplex PCR to detect classical and newly described pyrogenic toxin genes in staphylococcal isolates. J. Clin. Microbiol. 1999, 37, 3411–3414. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Johnson, W.M.; Tyler, S.D.; Ewan, E.P.; Ashton, F.E.; Pollard, D.R.; Rozee, K.R. Detection of genes for enterotoxins, exfoliative toxins, and toxic shock syndrome toxin 1 in Staphylococcus aureus by the polymerase chain reaction. J. Clin. Microbiol. 1991, 29, 426–430. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oliveira, C.J.; Tiao, N.; de Sousa, F.G.; de Moura, J.F.; Filho, L.S.; Gebreyes, W.A. Methicillin-Resistant Staphylococcus aureus from Brazilian Dairy Farms and Identification of Novel Sequence Types. Zoonoses Public Health 2016, 63, 97–105. [Google Scholar] [CrossRef] [Scilit]
- Jiang, H.; Yu, T.; Yang, Y.; Yu, S.; Wu, J.; Lin, R.; Li, Y.; Fang, J.; Zhu, C. Co-occurrence of Antibiotic and Heavy Metal Resistance and Sequence Type Diversity of Vibrio parahaemolyticus Isolated from Penaeus vannamei at Freshwater Farms, Seawater Farms, and Markets in Zhejiang Province, China. Front. Microbiol. 2020, 11, 1294. [Google Scholar] [CrossRef] [Scilit]
- Kolde, R. Package ‘pheatmap’. R Package 2015, 1, 790. [Google Scholar]


| Gene | Frequency Distribution | ||
|---|---|---|---|
| PVL-Positive MRSA (n = 37) | PVL-Positive MSSA (n = 76) | Total PVL-Positive S. aureus (n = 113) | |
| mecA | 37 (32.7%) | 0 | 37 (32.7%) |
| blaZ | 32 (28.3%) | 64 (56.6%) | 96 (84.9%) |
| tst | 0 | 1 (0.9%) | 1 (0.9%) |
| hla | 18 (15.9%) | 44 (38.9%) | 62 (54.9%) |
| sea | 20 (17.7%) | 30 (26.6%) | 50 (44.2%) |
| seb | 2 (1.8%) | 5 (4.4%) | 7 (6.2%) |
| sec | 0 | 1 (0.9%) | 1 (0.9%) |
| see | 0 | 0 | 0 |
| seg | 0 | 0 | 0 |
| sei | 0 | 0 | 0 |
| selj | 0 | 0 | 0 |
| sea/seb | 0 | 1 (0.9%) | 1 (0.9%) |
| Antimicrobial Agent | Family | CPD | PVL-Positive MRSA (n = 37) | PVL-Positive MSSA (n = 76) | PVL-Positive S. aureus (n = 113) | |||
|---|---|---|---|---|---|---|---|---|
| Resistant No (%) | Sensitive No (%) | Resistant No (%) | Sensitive No (%) | Resistant No (%) | Sensitive No (%) | |||
| Penicillin (P) | β-lactam | 10 μg | 37 (32.7%) | 0 | 65 (57.5%) | 11 (9.7%) | 102 (90.3%) | 11 (9.7%) |
| Ampicillin(AMP) | β-lactam | 10 μg | 37 (32.7%) | 0 | 43 (38.05%) | 33 (29.2%) | 80 (70.8%) | 33 (29.2%) |
| Ciprofloxacin (CIP) | Fluoroquinolone | 5 μg | 24 (21.2%) | 13 (11.5%) | 23 (20.4%) | 53 (46.9%) | 47 (41.6%) | 66 (58.4%) |
| Chloramphenicol (C) | Phenicols | 30 μg | 12 (10.6%) | 25 (22.1%) | 4 (3.5%) | 72 (63.7%) | 16 (14.0%) | 97 (85.8%) |
| Clindamycin (DA) | Lincosamide | 2 μg | 20 (17.7%) | 17 (15.04%) | 22 (19.5%) | 54 (47.8%) | 42 (37.2%) | 71 (62.8%) |
| Erythromycin (E) | Macrolide | 15 μg | 22 (19.5%) | 15 (13.3%) | 17 (15.04%) | 59 (52.2%) | 39 (34.5%) | 74 (65.5%) |
| Gentamicin (CN) | Aminoglycoside | 10 μg | 11 (9.7%) | 26 (23%) | 12 (10.6%) | 64 (56.6%) | 23 (20.4%) | 90 (79.6%) |
| Tetracycline (TE) | Tetracycline | 30 μg | 32 (28.3%) | 5 (4.4%) | 22 (19.5%) | 54 (36.3%) | 54 (47.79%) | 59 (40.7%) |
| Trimethoprim- sulfamethoxazole (SXT) | Sulphonamide | 25 μg | 35 (31.0%) | 2 (1.77%) | 27 (23.9%) | 49 (43.6%) | 62 (54.9%) | 51 (45.13%) |
| Antibiotypes | Resistance Pattern | Isolate No (%) (n = 37) | MAR Index | MAR (n = 37) |
|---|---|---|---|---|
| I | P, AMP, C, and TE | 1 (2.7%) | 0.44 | + |
| II | P, AMP, SXT, and TE | 1 (2.7%) | 0.44 | + |
| III | P, AMP, CIP, and CN | 1 (2.7%) | 0.44 | + |
| IV | P, AMP, C, SXT, and TE | 4 (10.8%) | 0.56 | + |
| V | P, AMP, DA, E, and SXT | 1 (2.7%) | 0.56 | + |
| VI | P, AMP, CIP, SXT, and TE | 5 (13.5%) | 0.56 | + |
| VII | P, AMP, C, DA, SXT, and TE | 1 (2.7%) | 0.67 | + |
| VIII | P, AMP, CIP, C, SXT, and TE | 1 (2.7%) | 0.67 | + |
| IX | P, AMP, DA, E, SXT, and TE | 2 (5.4%) | 0.67 | + |
| X | P, AMP, E, CN, SXT, and TE | 1 (2.7%) | 0.67 | + |
| XI | P, AMP, CIP, DA, SXT, and TE | 1 (2.7%) | 0.67 | + |
| XII | P, AMP, CIP, DA, E, SXT, and TE | 7 (18.9%) | 0.78 | + |
| XIII | P, AMP, C, DA, E, SXT, and TE | 1 (2.7%) | 0.78 | + |
| XIV | P, AMP, CIP, E, CN, SXT, and TE | 1 (2.7%) | 0.78 | + |
| XV | P, AMP, CIP, DA, E, CN, and SXT | 3 (8.1%) | 0.78 | + |
| XVI | P, AMP, DA, E, CN, SXT, and TE | 1 (2.7%) | 0.78 | + |
| XVII | P, AMP, CIP, C, E, SXT, and TE | 1 (2.7%) | 0.89 | + |
| XVIII | P, AMP, CIP, C, E, CN, SXT, and TE | 1 (5.4%) | 0.89 | + |
| XIX | P, AMP, CIP, DA, E, CN, SXT, and TE | 1 (2.7%) | 0.89 | + |
| XX | P, AMP, CIP, C, DA, E, CN, SXT, and TE | 2 (5.4%) | 1 | + |
| Antibiotypes | Resistance Pattern | Isolate No (%) (n = 76) | MAR Index | MAR (n = 29) |
|---|---|---|---|---|
| I | 0 | 5 (6.58%) | 0.00 | - |
| II | P | 26 (34.2%) | 0.11 | - |
| III | CIP | 1 (1.3%) | 0.11 | - |
| IV | AMP | 3 (3.9%) | 0.11 | - |
| V | P and AMP | 6 (7.9%) | 0.22 | - |
| VI | P and DA | 1 (1.3%) | 0.22 | - |
| VII | AMP and DA | 2 (2.6%) | 0.22 | - |
| VIII | P, AMP, and SXT | 1 (1.3%) | 0.33 | - |
| IX | P, AMP, and CIP | 2 (2.6%) | 0.33 | - |
| X | P, AMP, CIP, and DA | 2 (2.6%) | 0.44 | + |
| XI | P, AMP, SXT, and TE | 4 (5.2%) | 0.44 | + |
| XII | P, AMP, C, TE, and CIP | 1 (1.3%) | 0.56 | + |
| XIII | P, AMP, CIP, CN, and SXT | 1 (1.3%) | 0.56 | + |
| XIV | P, AMP, CIP, SXT, and TE | 1 (1.3%) | 0.56 | + |
| XV | P, AMP, E, SXT, and TE | 1 (1.3%) | 0.56 | + |
| XVI | P, AMP, CIP, C, and SXT | 1 (1.3%) | 0.56 | + |
| XVII | P, AMP, CN, E, SXT, and TE | 1 (1.3%) | 0.67 | + |
| XVIII | P, AMP, CIP, DA, E, and SXT | 3 (3.9%) | 0.67 | + |
| XIX | P, AMP, CN, DA, SXT, and TE | 2 (2.6%) | 0.67 | + |
| XX | P, AMP, CIP, DA, E, SXT, and TE | 2 (2.6%) | 0.78 | + |
| XXI | P, AMP, DA, E, CN, SXT, and TE | 1 (1.3%) | 0.78 | + |
| XXII | P, AMP, CIP, C, DA, E, SXT, and TE | 2 (2.6%) | 0.89 | + |
| XXIII | P, AMP, CIP, DA, E, CN, SXT, and TE | 7 (9.1%) | 0.89 | + |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sadat, A.; Shata, R.R.; Farag, A.M.M.; Ramadan, H.; Alkhedaide, A.; Soliman, M.M.; Elbadawy, M.; Abugomaa, A.; Awad, A. Prevalence and Characterization of PVL-Positive Staphylococcus aureus Isolated from Raw Cow’s Milk. Toxins 2022, 14, 97. https://doi.org/10.3390/toxins14020097
Sadat A, Shata RR, Farag AMM, Ramadan H, Alkhedaide A, Soliman MM, Elbadawy M, Abugomaa A, Awad A. Prevalence and Characterization of PVL-Positive Staphylococcus aureus Isolated from Raw Cow’s Milk. Toxins. 2022; 14(2):97. https://doi.org/10.3390/toxins14020097
Chicago/Turabian StyleSadat, Asmaa, Radwa Reda Shata, Alshimaa M. M. Farag, Hazem Ramadan, Adel Alkhedaide, Mohamed Mohamed Soliman, Mohamed Elbadawy, Amira Abugomaa, and Amal Awad. 2022. "Prevalence and Characterization of PVL-Positive Staphylococcus aureus Isolated from Raw Cow’s Milk" Toxins 14, no. 2: 97. https://doi.org/10.3390/toxins14020097
APA StyleSadat, A., Shata, R. R., Farag, A. M. M., Ramadan, H., Alkhedaide, A., Soliman, M. M., Elbadawy, M., Abugomaa, A., & Awad, A. (2022). Prevalence and Characterization of PVL-Positive Staphylococcus aureus Isolated from Raw Cow’s Milk. Toxins, 14(2), 97. https://doi.org/10.3390/toxins14020097

