Antitumor, Antioxidant, and Hepatoprotective Effects of Grape Seed Oil Nanoemulsion as a Dietary Phytochemical Intervention in Ehrlich Solid Tumors

Abstract

Background/Objectives: Grape seed oil (GSO) is a potent source of dietary phytochemicals, particularly polyphenols and flavonoids, known for their health-promoting properties. This study aims to investigate the anticancer and hepatoprotective effects of a nanoemulsion formulation of grape seed oil (GSONE), to enhance the efficacy and bioavailability of its phytochemical constituents against solid tumors. Methods: Ninety female Swiss albino mice were divided into six groups: control, alone, GSONE alone, Ehrlich solid tumor (EST), EST treated with GSO, and EST treated with GSONE. Tumor development, growth performance, serum biochemistry, antioxidant status, hepatic histopathology, apoptotic gene expression, and flow cytometry analyses were assessed following 30 days of daily oral treatment. Results: GSONE significantly reduced tumor weight and volume (52.9%) and more effectively counteracted tumor-induced body weight loss than crude GSO. Treatment with GSONE normalized serum protein levels and improved liver function markers (AST, ALT, ALP, total bilirubin) to near-control values. Tumor markers (AFP, CEA) and oxidative stress indices (MDA, 8-OHdG) were markedly decreased, while activities of hepatic antioxidants (SOD, CAT, GPx, GSH) were restored. GSONE enhanced gene expression of pro-apoptotic markers (Bax, TP53, caspase-3, caspase-9), suppressed anti-apoptotic Bcl-2, and significantly increased the proportion of p53- and cleaved caspase-3-positive tumor cells. Liver histopathology and ultrastructure demonstrated normalized morphology and reduced damage in GSONE-treated mice. Multivariate analyses confirmed GSONE’s restorative effect compared to raw GSO. Conclusions: The delivery of dietary phytochemicals via nanoemulsion significantly enhances antitumor and hepatoprotective actions in a preclinical solid tumor model. These findings support the potential of phytochemical-rich edible oils, enhanced by nanotechnology, for dietary prevention and adjunctive management of cancer.

1. Introduction

Dietary phytochemicals, naturally occurring bioactive compounds in plant-derived foods, have gained increasing recognition for their role in cancer chemoprevention and therapy [1]. Polyphenols, flavonoids, and related compounds modulate redox homeostasis, regulate apoptosis, and influence multiple molecular pathways involved in carcinogenesis [2]. Accumulating evidence supports that phytochemical-rich diets may lower cancer risk and improve disease outcomes [3]. Recent advances in nutrition and pharmaceutical technology have underscored the importance of optimizing the delivery, stability, and bioavailability of these compounds to maximize their therapeutic impact [4,5].

Grape seeds and their extracted oil are valuable agricultural by-products of grape processing, recognized for their high nutritional value and rich phytochemical composition [6]. Grape seed oil (GSO) is obtained mainly by cold pressing or solvent extraction of Vitis vinifera seeds, which contain approximately 8–20% oil. This oil is particularly valued for its delicate flavor, high smoke point, and balanced lipid composition, making it useful for both culinary and therapeutic applications [7,8].

Nutritionally, grape seed oil is rich in polyunsaturated fatty acids (PUFAs), which account for nearly 85–90% of its fatty acid content. Linoleic acid (C18:2, n-6) constitutes around 68–76%, while oleic acid (C18:1, n-9) represents 14–15%, accompanied by small fractions of alpha-linolenic, palmitic, and stearic acids [9]. This lipid profile contributes to maintaining cardiovascular and metabolic health by promoting favorable lipid metabolism and supporting membrane fluidity [7]. GSO is also an exceptional natural source of vitamin E (1–53 mg/100 g), mainly in the form of γ-tocopherol and tocotrienols, compounds known for their potent antioxidant and anti-aging properties [10].

In addition to lipophilic antioxidants, grape seed oil contains trace hydrophilic bioactives such as polyphenols (catechins, epicatechins, procyanidins, and resveratrol derivatives) and phytosterols (β-sitosterol, campesterol, and stigmasterol) [11]. These components contribute synergistically to its broad spectrum of biological activities, including antioxidant, anti-inflammatory, anti-obesity, hepatoprotective, and antitumor effects demonstrated in both in vitro and in vivo models [12,13]. Figure 1 provides an overview of the main classes of bioactive compounds present in grape skins and seeds, and summarizes their documented health-promoting actions.

Beyond its dietary importance, grape seed oil has been incorporated into several pharmaceutical and cosmeceutical formulations, including (a) nanoemulsions and liposomal carriers, which enhance solubility, stability, and absorption of natural antioxidants [14,15], and (b) topical and oral nutraceutical preparations for skin protection, wound healing, lipid regulation, and systemic antioxidant support [16,17,18]. These formulations aim to overcome the poor aqueous solubility and oxidative instability associated with the native oil, thereby improving its therapeutic performance [19,20].

Despite GSO’s diverse health-promoting constituents, its high n-6 PUFA content predisposes it to oxidation, limiting its direct storage and industrial use [21]. Therefore, nanoformulation approaches, such as emulsions and encapsulated systems, have attracted substantial attention for enhancing bioavailability and shelf stability [20,22,23]. In this context, grape seed oil nanoemulsion (GSONE) represents a novel strategy to potentiate the therapeutic effects of dietary phytochemicals while maintaining biocompatibility and safety [24].

Experimental cancer models remain indispensable for preclinical testing of such nutritional interventions. The Ehrlich solid tumor (EST) model, derived from murine mammary adenocarcinoma, closely mimics the clinical and histopathological features of aggressive human breast tumors, such as rapid proliferation, high malignancy, short biological cycles, and lack of tumor-specific transplantation antigens [25]. Both solid and ascitic forms of Ehrlich carcinoma are routinely used to investigate tumor biology and assess novel antitumor strategies [26,27,28]. Tumor progression in the EST model is known to trigger systemic metabolic imbalances and organ dysfunction, notably hepatic and renal oxidative stress, DNA damage, and cellular injury [29]. Such alterations highlight the pivotal role of reactive oxygen species (ROS) in carcinogenic processes and reinforce the protective role of natural antioxidants in maintaining redox balance and genomic stability [30,31]. Dietary antioxidants thus represent a physiologically relevant and ethically sustainable avenue for developing biocompatible cancer-preventive adjuvants [32].

The present study aimed to develop a GSONE to overcome the intrinsic limitations of native GSO and to investigate its chemopreventive, antitumor, and hepatoprotective properties in a murine EST model. We further sought to elucidate the underlying molecular mechanisms by assessing apoptosis-related gene expression, hepatic redox indices, and histopathological alterations following chronic treatment.

2. Materials and Methods

2.1. Preparation of Grape Seed Oil Nanoemulsion

Organic grape seed oil (GSO) was obtained from AB Chem Company (Mansoura City, Egypt). A monolayer nanoemulsion was formulated using 20% GSO. Briefly, the oil phase was gradually mixed with 68 mL of an aqueous phase containing 10% Tween 80 (surfactant) and 2% ethanol (co-surfactant) under gentle stirring at 25 °C. Water was added at a controlled rate of 1.0 mL/min to maintain uniform emulsification. The emulsion was subjected to ultrasonic bath treatment for 30 min, followed by final homogenization with a probe-type ultrasonic homogenizer (Sonics Vibra-Cell, VC 505, Newtown, CT, USA) at 60% amplitude for 5 min, with a one-second on and one-second off cycle. This process yielded a stable GSO nanoemulsion (GSONE).

For morphological analysis, freshly prepared GSONE samples were visualized using a 160 kV transmission electron microscope (JEOL JEM-2100, Akishima, Japan). Image acquisition and processing were performed with Soft Imaging Viewer and Digital Micrograph (Gatan Microscopy Suite, version 2.11.1404.0). Particle size distribution (Z-average), polydispersity index (PDI), and zeta potential were determined using a Zeta sizer Nano ZS analyzer (Malvern Instruments, Malvern, UK).

2.2. Induction of EAC in Mice

The Ehrlich Ascites Carcinoma (EAC) cell line was obtained from the National Cancer Institute (NCI), Cairo, Egypt. To preserve cell viability, EAC cells were serially passaged in vivo by intraperitoneal injection of 2.5 × 10⁶ cells into female Swiss albino mice every 10 days, following the protocol described by Yılmaz et al. [33].

Only female mice were selected for this study because the EAC model originates from murine mammary tissue and most closely simulates the biological behavior, treatment response, and progression patterns of breast cancer seen in women. Utilizing females not only reflects the clinical distribution of breast cancer but also conforms to standard EAC experimental practices, thereby enhancing the translational relevance and scientific rigor of antitumor investigations [25,34].

Mice were anesthetized with intraperitoneal administration of ketamine (80 mg/kg) and xylazine (10 mg/kg). Ascitic fluid was collected from EAC-bearing donor mice on days 7 or 8 post-inoculation under identical anesthesia conditions. Cell viability was assessed using a hemocytometer and 0.4% trypan blue dye exclusion, as described previously [35]. The viable cell suspension was then adjusted to 2.5 × 10⁶ cells in 0.2 mL phosphate-buffered saline (PBS) for subsequent inoculation into experimental mice.

2.3. Animal Handling and Experimental Protocol

A total of ninety healthy female Swiss albino mice (Mus musculus; mean body weight: 21.61 g) were provided by the Faculty of Medicine, Mansoura University, Egypt. Animals were housed in plastic cages under controlled laboratory conditions (25 °C, 45% relative humidity, 12 h light/dark cycle) with ad libitum access to food and water. Mice were allowed to acclimate for one week under these standardized conditions. The overall experiment timeline is summarized in Figure 2.

All animal care and procedures were conducted in accordance with the “Guide for the Care and Use of Laboratory Animals (8th edition, NRC, 2011) and the International Guiding Principles for Biomedical Research Involving Animals (1985).” All animal procedures were reviewed and approved by the “Research Ethics Committee of the Faculty of Veterinary Medicine, Mansoura University, Egypt (approval code: MU-ACUC; VM.R.25.10.247).”

A preliminary pilot study was conducted to assess the safety margin of grape seed oil (GSO) in healthy mice, with oral doses of 1, 2, 3, and 4 mL/kg/day administered for 30 consecutive days. The upper dose limit was selected based on previous reports of hepatoprotective efficacy in mice [36]. Throughout, animals were monitored for mortality, behavior, and toxicity. As no adverse effects were observed at 4 mL/kg/day, this dose was used for all subsequent experiments.

Mice were randomly allocated into six groups (n = 15 each):

• Group 1 (Control): received no treatment.
• Group 2 (GSO): received GSO orally at 4 mL/kg/day for 30 days.
• Group 3 (GSONE): received GSO nanoemulsion (GSONE) orally at the same dose.
• Group 4 (EST): inoculated intramuscularly with 0.2 mL of EAC cell suspension (2.5 × 10⁶ cells) in the right thigh on day 1 and left untreated thereafter.
• Group 5 (EST + GSO): received daily oral GSO (4 mL/kg) for 30 days following EAC inoculation.
• Group 6 (EST + GSONE): received daily oral GSONE (4 mL/kg) for 30 days following EAC inoculation.

The sample size for each group was determined with reference to previous EAC murine studies, in which group sizes of 10–12 animals were found sufficient to detect biological and tumor-related differences. To achieve a statistical power of at least 80% for pairwise group comparisons at a significance level of α = 0.05, and to accommodate potential attrition due to post-inoculation mortality (anticipated at 10–20%), the group size was set at 15. This design provides adequate power for one-way ANOVA analysis across six groups (total n = 90), aligning with established international standards for rigor and ethical animal use in preclinical research [37,38]. No specific pre-established inclusion or exclusion criteria were applied in this study; all animals enrolled in the study completed the experimental protocol.

2.4. Assessment of Body Weight, Tumor Weight, and Tumor Volume

Body weights were recorded for all animals at baseline (day 0) and at the conclusion of the experimental period. Net final body weight was determined by subtracting the excised tumor mass from the final body weight. Tumor volume was measured at regular intervals from day 8 to day 30 in the EST, EST + GSO, and EST + GSONE groups using digital Vernier calipers. Tumor dimensions (major axis, B; minor axis, A) were used to calculate volume according to the formula: TV (mm³) = 0.52 × A × B² [39]. On day 30, animals were euthanized, and tumors were excised and weighed to determine the final tumor weight.

2.5. Sample Collection

At the end of the experimental period, 10 randomly selected mice from each group were fasted for 10 h and anesthetized with inhaled tetrahydrofuran to minimize distress and ensure consistent blood collection. The remaining mice (n = 5 for each group) served as contingency reserves in case of mortality, unavailable samples, or insufficient tissue/RNA yields. Animals were euthanized by cervical dislocation. Blood was collected from the retro-orbital venous sinus into non-heparinized tubes, allowed to clot at room temperature, and centrifuged at 3000× g for 10 min. Serum was separated and immediately stored in 0.5 mL Eppendorf tubes for subsequent biochemical analyses.

2.6. Serum Biochemical Analysis

Serum biochemical parameters were measured using commercially available diagnostic kits, according to the manufacturers’ protocols. Analytes included total protein (TP; CBP007-K), albumin (MET-5017), total bilirubin (TB; BR 1001), alkaline phosphatase (ALP; CBA-301), alanine aminotransferase (ALT; MET-5123), and aspartate aminotransferase (AST; MET-5127); globulin was calculated as the difference between total protein and albumin. Alpha-fetoprotein (AFP) was quantified using the mini-VIDAS^® automated ELFA system (Biomerieux, Marcy-L’Étoile, France), while carcinoembryonic antigen (CEA) was measured with a Mouse CEA ELISA Kit (MyBioSource, San Diego, CA, USA), both per manufacturers’ instructions.

2.7. Assessment of Antioxidant Status and DNA Oxidative Damage

Liver samples were washed in 1.15% ice-cold potassium chloride to remove blood residue. Specimens destined for biochemical assays were rapidly frozen at −20 °C, and others were fixed in 10% neutral-buffered formalin for microscopy. Homogenization was performed in ice-cold phosphate buffer (pH 7.4), followed by centrifugation at 4000 rpm (4 °C, 15 min). Supernatants were used to determine activities of superoxide dismutase (SOD; Cat. No. SD 2521), catalase (CAT; CA 2517), glutathione peroxidase (GSH-Px; GP 2524), and reduced glutathione (GSH; GR 2511). Lipid peroxidation was measured as malondialdehyde (MDA) by TBARS assay (MDA; MD 2529). DNA oxidative damage was assessed by quantifying 8-hydroxy-2′-deoxyguanosine (8-OHdG) using a competitive ELISA kit (Trevigen, Gaithersburg, MD, USA). Absorbance was measured at 450 nm, and results were calculated from a standard curve, expressed as nanograms per milligram of tissue protein.

2.8. Gene Expression Analysis of Apoptotic Markers

Total RNA was extracted from tumor tissues of mice bearing EST using the Gene JET™ RNA Purification Kit (Thermo Scientific, Waltham, MA, USA) according to the manufacturer’s protocol. RNA concentration and purity were quantified by spectrophotometry (NanoDrop, Wilmington, DE, USA), and integrity was confirmed by agarose gel electrophoresis, which showed distinct 28S and 18S rRNA bands with a 2:1 intensity ratio. First-strand complementary DNA (cDNA) was synthesized from 5 µg of total RNA using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific). Gene-specific primers for Bax, Bcl-2, TP53, Caspase-3, Caspase-9, and the housekeeping gene Glyceraldehyde phosphate dehydrogenase (GAPDH) (

Table 1. Sequences of Primers Employed in qRT-PCR for Target Gene Amplification.

Gene	Sequences (5′-3′)	Length (bp)
Bax	F: GTCTCCGGCGAATTGGAGAT R: ACCCGGAAGAAGACCTCTCG	100
Bcl-2	F: CATCGCCCTGTGGATGACTG R: GGCCATATAGTTCCACAAAGGC	95
TP53	F: CCCCTGTCATCTTTTGTCCCT R: AGCTGGCAGAATAGCTTATTGAG	137
Caspase-3	F: ACTGGAATGTCAGCTCGCAA R: GCAGTAGTCGCCTCTGAAGA	270
Caspase-9	F: ACGTGAACTTCTGCCCTTCC R: GGTCGTTCTTCACCTCCACC	117
GAPDH	F: GTATCGGACGCCTGGTTAC R: CTTGCCGTGGGTAGAGTCAT	128

F: Forward; R: Reverse; bp: base pair; Bax: Bcl-2-associated X protein; Bcl-2: B-cell lymphoma 2; TP53: Tumor Protein 53; Caspase-3/9: Cysteine-aspartic acid protease-3/9; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase.

) were designed with NCBI Primer-BLAST and synthesized by Invitrogen (Carlsbad, CA, USA). GAPDH served as the internal control for normalization. Primer sequences were based on methodologies reported by Mohamed et al. [40] and Gencer et al. [41].

2.9. Flow Cytometric Analysis of p53 and Caspase-3 Expression

Single-cell suspensions were prepared from EST of control and treated mice (GSO, GSONE) to assess apoptotic pathway activation by quantifying Tp53 and cleaved caspase-3 expression. Excised tumor tissues were minced under sterile conditions, enzymatically dissociated in 1 mg/mL collagenase type I (Sigma-Aldrich, St. Louis, MO, USA) in PBS (pH 7.4) at 37 °C with gentle agitation for 30 min, and then filtered through a 70 µm nylon mesh. Cells were washed twice in ice-cold PBS (centrifuged at 300× g for 5 min), then fixed and permeabilized using the Cytofix/Cytoperm kit (BD Biosciences, Franklin Lakes, NJ, USA). For p53 detection, permeabilized cells were incubated with an Alexa Fluor 488-conjugated anti-p53 antibody (Abcam, ab225239) according to the manufacturer’s protocol. Cleaved caspase-3 was detected with a phycoerythrin (PE)-conjugated anti-cleaved caspase-3 antibody (Abcam, ab32042).

To ensure analytical rigor and reproducibility, cell viability was monitored throughout the sample preparation process. Appropriate controls, including unstained, isotype-matched, and single-color compensation controls, were used to gate the data and confirm antibody specificity accurately. Instrument calibration was performed daily using standardized fluorescent beads, and acquisition and compensation settings were standardized for all samples. Each analysis included at least 10,000 single, viable cell events, and doublet discrimination was routinely applied during gating. Data were collected on a BD FACSCanto™ II flow cytometer (BD Biosciences) and analyzed with FlowJo™ software (version 10.8.1). Mean fluorescence intensity (MFI) and the percentage of positively stained cells were determined for each marker, enabling comparisons among the study groups.

2.10. Histopathological Analysis

After fixation in 10% neutral-buffered formalin, liver tissues were dehydrated using a graded ethanol series (70%, 80%, 90%, and 100%, one hour per step), then cleared in two successive xylene baths before paraffin embedding. Specimen identity was carefully maintained throughout processing, and all samples were checked at receipt for correct labeling and presence of adequate fixative to avoid pre-analytic errors. Paraffin blocks were sectioned using a rotary microtome at an approximate thickness of 5 µm. Serial sections were mounted, stained with hematoxylin and eosin (H&E), and examined microscopically. Each batch of staining included an established normal liver tissue section as an internal control to ensure consistency of stain quality and interpretation.

Microscopic evaluation was performed using a high-resolution digital camera to document representative fields of interest. For semi-quantitative assessment, liver lesions were graded in three mice per group, analyzing three sections per slide and four randomly selected fields per section at 400× magnification (totaling 12 fields per animal). All fields were scored independently by a blinded observer using a standardized four-grade histopathological scoring system (0 = none, 1 = mild, 2 = moderate, 3 = severe; see

Table 2. Semi-quantitative scoring of hepatic damage was based on a four-point grading scale.

Score	Hepatic Lesions Were Graded Using an Integrated Semi-Quantitative Scoring System.
0 (none)	Histological analysis revealed normal architecture.
1 (mild)	Hepatocellular degeneration and necrosis were occasionally observed, accompanied by minimal or absent inflammatory infiltration and rare vascular congestion.
2 (moderate)	Moderate vacuolar degeneration, scattered inflammatory cell infiltration, multifocal hepatocellular necrosis, and mild blood vessel congestion were shown in the hepatic tissue.
3 (severe)	Diffuse and severe degenerative alterations were shown in hepatic tissue, along with widespread infiltration of leukocytes, extensive hepatocellular necrosis, and moderate to severe congestion of the hepatic vasculature.

), and the mean lesion score for each mouse was calculated by averaging across all examined fields. Quality of tissue sections and staining was monitored throughout, and any slide with a technical artifact or inadequate staining was reprocessed and reassessed to maintain high analytical standards.

2.11. Transmission Electron Microscopy (TEM)

Liver samples were fixed in 2.5% glutaraldehyde (0.1 M phosphate buffer, pH 7.4) at 4 °C for 24 h to preserve their ultrastructure. Following thorough rinsing, specimens were post-fixed in 1% osmium tetroxide for 2 h. Tissues were dehydrated through a graded ethanol series (50–100%) and cleared in acetone before being embedded in epoxy resin. Ultrathin sections (60–70 nm) were cut using a diamond knife on an ultramicrotome. Sections were mounted on copper grids, stained with uranyl acetate and lead citrate, and examined with a JEOL 2100 transmission electron microscope (Japan) operated at 160 kV. Each processing batch included internal controls, and section quality was confirmed before imaging. Representative regions were selected for examinations, and digital images were acquired to minimize operator bias.

2.12. Statistical Analysis

Before analysis, the normality of data distribution and homogeneity of variances were verified using the Shapiro–Wilk and Levene’s tests, respectively. One-way ANOVA (SAS Institute, 2012, Proc ANOVA) was performed to compare means among experimental groups, and Tukey’s post hoc test was employed for multiple comparisons. Results are reported as mean ± standard error (SE), with statistical significance set at p < 0.05. Data visualization was performed with GraphPad Prism 9.0, and multivariate analyses (principal component analysis (PCA) and heatmap clustering) were conducted with SRplot.

3. Results

3.1. Characterization of Grape Seed Oil Nanoemulsion (GSONE)

Transmission electron microscopy revealed that GSONE particles were spherical and uniform in morphology (Figure 3A) and ranged in diameter from 20 to 47 nm (Figure 3B). Dynamic light scattering (DLS) analysis yielded a hydrodynamic diameter of 88 nm, which is larger than the TEM values, reflecting particle-solvent interactions and hydration shell formation. The PDI was 0.542, suggesting moderate size dispersion within the formulation (Figure 3C). The zeta potential was measured at −28 mV, confirming good electrostatic stability of the nanoemulsion suspension (Figure 3D). All measurements were performed on freshly prepared samples and independently verified in replicate runs to ensure consistency and accuracy.

3.2. Growth Performance and Tumor Weight/Volume Changes

Treatment effects on growth performance and tumor burden were quantified in mice bearing EST following administration of either crude GSO or its nanoemulsion form (

Table 3. Growth performance and tumor weight changes induced by grape seed oil nanoemulsion compared to raw grape seed oil in mice bearing Ehrlich solid carcinoma.

Parameters	Control	GSO	GSONE	EST	EST/GSO	EST/GSONE	p-Values
IBW (g)	21.86 ± 0.33	21.69 ± 0.29	21.44 ± 0.26	21.93 ± 0.38	21.56 ± 0.37	21.38 ± 0.48	0.746
FBW (g)	27.46 ± 0.24	27.86 ± 0.31	27.93 ± 0.22	27.38 ± 0.19	26.87 ± 0.25	27.34 ± 0.18	0.041
NW(g)	27.46 ± 0.24	27.86 ± 0.31	27.93 ± 0.22	20.62 ± 0.19 *	22.43 ± 0.25 *#	24.16 ± 0.12 *#†	0.003
BWG (g)	5.60 ± 0.09	6.17 ± 0.02	6.49 ± 0.04	−1.30 ± 0.19 *	0.87 ± 0.12 *#	2.79 ± 0.37 *#†	<0.0001

GSO: Grape seed oil (4 mg/kg body weight); GSONE: Grape seed oil nanoemulsion (4 mg/kg body weight); EST: Inoculated with Ehrlich Ascites Carcinoma (EAC) cells (0.2 mL); EST/GSO: Grape seed oil (4 mg/kg body weight) + EAC cells (0.2 mL); EST/GSONE: Grape seed oil nanoemulsion (4 mg/kg body weight) + EAC cells (0.2 mL) (each group n = 15). IBW: Initial body weight; FBW: Final body weight; NW: Net Weight (g); body weight after subtraction of tumor mass in tumor-bearing groups; BWG: Body Weight Gain (g); calculated as NW—IBW to reflect net gain or loss excluding tumor weight; TM: Tumor. Values are presented as mean ± SE. * Significantly different from the control group; # Significantly different from the EST group; † Significantly different from the EST/GSO group. The significance level is p < 0.05.

). The EST group displayed a significant reduction in net body weight relative to all controls. Both GSO and GSONE therapies improved body weight, with the EST/GSONE group demonstrating a greater reversal of cachexia than the EST/GSO group. Tumor weight was highest in the untreated EST group, while both treatments led to marked reductions; notably, GSONE yielded the most significant effect, achieving a 52.89% decrease in tumor mass compared to the untreated EST group. Across all measurement time points, tumor volume was lowest in the EST/GSONE group, intermediate in the EST/GSO group, and highest in the untreated EST group, with nanoemulsion consistently outperforming crude oil (Figure 4).

3.3. Tumor Histopathology

Representative hematoxylin and eosin (H&E)-stained sections of tumor tissues from each experimental group are shown in Figure 5. Distinct histopathological features were evident among the groups. The control group displayed uniform, densely packed tumor cells with occasional necrotic foci. In contrast, treatment with GSO (Panel B) and, particularly, GSONE (Panel C) resulted in marked changes in tumor architecture, including reduced cellular density, prominent areas of necrosis, and greater stromal separation. These morphological changes underscore the modulatory effects of GSO and GSONE on tumor tissue structure and are consistent with reduced tumor aggressiveness and enhanced therapeutic response.

3.4. Blood Biochemical Parameters

Blood biochemical profiling revealed pronounced disruptions in protein metabolism and liver function in mice bearing EST (

Table 4. Blood biochemical changes induced by grape seed oil nanoemulsion compared to raw grape seed oil in mice bearing Ehrlich solid carcinoma.

Parameters	Control	GSO	GSONE	EST	EST/GSO	EST/GSONE	p-Values
TP (g/dL)	6.88 ± 0.29	6.90 ± 0.31	6.92 ± 0.19	4.13 ± 0.13 *	5.38 ± 0.32 *#	6.19 ± 0.27 #†	0.0146
Alb (g/dL)	3.79 ± 0.13	3.93 ± 0.17	3.98 ± 0.21	2.16 ± 0.07 *	2.71 ± 0.12 *#	3.53 ± 0.18 #†	0.0273
Glo (g/dL)	3.09 ± 0.16	2.97 ± 0.14	2.94 ± 0.06	1.97 ± 0.06 *	2.67 ± 0.10 #	2.66 ± 0.09 #	0.0047
TB (mg/dL)	0.42 ± 0.09	0.38 ± 0.07	0.36 ± 0.06	1.32 ± 0.25 *	0.86 ± 0.03 *#	0.58 ± 0.10 #	<0.0001
ALP (U/L)	88.32 ± 4.26	86.25 ± 5.18	85.41 ± 6.22	128.14 ± 7.52 *	101.21 ± 6.91 #	95.33 ± 4.93 #	0.0026
ALT (U/L)	46.26 ± 3.24	45.21 ± 4.35	45.03 ± 5.11	89.25 ± 4.89 *	78.29 ± 6.23 *	54.26 ± 5.39 #†	0.0001
AST (U/L)	76.32 ± 6.66	73.41 ± 4.20	72.27 ± 5.38	118.39 ± 6.15 *	96.20 ± 4.44 *#	84.06 ± 5.93 #	0.0001

GSO: Grape seed oil (4 mg/kg body weight); GSONE: Grape seed oil nanoemulsion (4 mg/kg body weight); EST: Inoculated with Ehrlich Ascites Carcinoma (EAC) cells (0.2 mL); EST/GSO: Grape seed oil (4 mg/kg body weight) + EAC cells (0.2 mL); EST/GSONE: Grape seed oil nanoemulsion (4 mg/kg body weight) + EAC cells (0.2 mL). Values are presented as mean ± SE, with each group (n = 10). TP: Total protein; Alb: Albumin; Glo: Globulin; TB: Total Bilirubin; ALP: Alkaline phosphatase; ALT: Alanine transaminase; AST: Aspartate transaminase. * Significantly different from the control group; # Significantly different from the EST group; † Significantly different from the EST/GSO group. The significance level is p < 0.05.

). The EST group showed significant reductions in serum total protein, albumin, and globulin levels compared with controls. Administration of GSONE significantly improved these parameters, normalizing values to levels indistinguishable from those of the control group. Globulin concentrations remained similar between the EST/GSO and EST/GSONE treated groups. Markers of hepatic injury, including AST, ALT, ALP, and total bilirubin, were significantly elevated in the EST group compared to controls. Both GSO and GSONE treatments significantly attenuated these elevations, with the most significant restorative effect observed in the EST/GSONE cohort, whose values approached those of healthy controls.

3.5. Tumor-Associated Biomarkers

Serum concentrations of AFP and CEA were markedly elevated in mice bearing EST compared with all control groups, indicating a higher tumor burden. Upon treatment with crude GSO or its nanoemulsion counterpart (GSONE), both AFP and CEA levels were significantly reduced. Notably, the EST/GSONE group showed a more pronounced decrease in tumor markers than the EST/GSO group, supporting the enhanced antitumor efficacy of the nanoemulsion formulation (Figure 6A,B). These findings support the value of AFP and CEA as sensitive indicators of therapeutic response and tumor suppression in this model.

3.6. Redox Status and DNA Oxidative Damage

Mice bearing EST exhibited significantly decreased hepatic antioxidant defenses, as evidenced by lower levels of reduced GSH, SOD, CAT, and GSH-Px compared to healthy controls. Treatment with either crude GSO or its nanoemulsion (GSONE) markedly restored these antioxidant parameters, with the EST/GSONE group demonstrating the most robust recovery across all markers (Figure 7A–D). Tumor-induced oxidative stress, as reflected by elevated MDA concentrations, was significantly reduced after intervention, with GSONE showing superior efficacy and restoring MDA levels to those of the control group (Figure 7E). Furthermore, DNA oxidative damage, assessed by hepatic 8-hydroxy-2′-deoxyguanosine (8-OHdG), was highest in the EST group and effectively minimized following treatment, with the lowest 8-OHdG values observed in the EST/GSONE cohort (Figure 7F). These data underscore the potent antioxidant and protective effects of GSONE against tumor-induced oxidative stress and genotoxicity.

3.7. Apoptotic Gene Expression Profiles

Expression analysis revealed that pro-apoptotic genes, including Bax, TP53, caspase-3, and caspase-9, were significantly affected by GSO administration (Figure 8). Treatment with either crude grape seed oil (GSO) or its nanoemulsion (GSONE) restored the expression of these markers, with Bax, TP53, and caspase-3 levels significantly higher in the EST/GSONE group compared to EST/GSO. At the same time, caspase-9 did not show a statistically significant difference between the two treated groups. Conversely, the anti-apoptotic gene Bcl-2 was markedly suppressed by both treatments, with no significant difference between the EST/GSO and EST/GSONE-treated groups.

Flow cytometric analysis (Figure 9A–C) further confirmed these findings at the cellular level: untreated ESTs demonstrated only 6.0% p53-positive cells, indicating minimal apoptosis. Treatment with GSO increased p53 positivity to 44.1%, while GSONE elevated this fraction to 71.0%, demonstrating significantly greater apoptotic activation than in both the EST and EST/GSO groups. Quantitative assessment (Figure 9D) showed that GSONE therapy was most effective at augmenting p53 expression and apoptotic cell frequency in tumor tissues.

Flow cytometric assessment of cleaved caspase-3 in EST cells revealed a marked enhancement of apoptotic execution following treatment with grape seed oil formulations (Figure 10A–D). In the untreated EST group, only 7.7% of cells were positive for cleaved caspase-3, indicating minimal basal apoptotic activity. Administration of crude grape seed oil (EST/GSO) increased the proportion of cleaved caspase-3-positive cells to 26.6% (p < 0.05 vs. EST), suggesting moderate induction of apoptosis. Treatment with grape seed oil nanoemulsion (EST/GSONE) significantly elevated cleaved caspase-3 expression to 69.1% (p < 0.05 vs. both EST and EST/GSO), reflecting robust activation of the caspase-dependent apoptotic pathway. Quantitative analysis (Figure 10D) confirmed that GSONE conferred the highest apoptotic index, followed by GSO and the untreated control, highlighting the superior pro-apoptotic efficacy of nanoemulsion formulation.

3.8. Liver Histopathology and Ultrastructural Changes

Histological evaluation of liver tissue showed that mice treated with either crude grape seed oil (GSO) or its nanoemulsion form (GSONE) exhibited normal hepatic architecture, including intact central veins, well-organized lobular structures, and healthy hepatocytes with centrally positioned nuclei and uniform cytoplasmic morphology (Figure 11A–C). In contrast, hepatic tissue from mice bearing Ehrlich solid tumors (EST) demonstrated pronounced pathological changes, vacuolar degeneration, central vein congestion, and severe nuclear necrosis (Figure 11D). Treatment with GSO or GSONE in EST-bearing mice restored liver architecture, evidenced by well-formed hepatic cords and lobular structures (Figure 11E,F), indicating notable protection against tumor-induced damage. Quantitative scoring of liver injury confirmed marked injury in the EST group compared with controls. At the same time, GSONE treatment was particularly effective at alleviating tissue injury severity, with no significant difference in histopathological scores between the EST/GSO and EST/GSONE groups (Figure 12).

Ultrastructural analysis further supported these findings. Normal hepatocyte ultrastructure, including organized mitochondria, rough endoplasmic reticulum, and nuclei with distinct nucleoli, was maintained in control, GSO, and GSONE groups (Figure 13A–C). EST-bearing mice showed classic signs of cellular necrosis, irregular nuclei, chromatin condensation, extensive vacuolation, cytoplasmic degeneration, and disrupted mitochondrial cristae (Figure 13D). Restoration of near-normal ultrastructure, characterized by limited mitochondrial degeneration and preservation of organelle integrity, was observed in mice treated with either GSO or GSONE after EST induction (Figure 13E,F), highlighting the treatments’ hepatoprotective effects.

3.9. Multivariable Analyses

Hierarchical clustering heatmap analysis (Figure 14) delineated distinct biochemical and molecular expression profiles across experimental groups. The control and non-tumor treatment groups (Control/GSO, Control/GSONE) clustered together, characterized by elevated antioxidant enzyme activities (SOD, CAT, GSHP-x, GSH), albumin (ALB), and total protein (TP), alongside lower levels of pro-apoptotic and oxidative stress markers. In contrast, the EST group formed a separate cluster, characterized by diminished antioxidant parameters and elevated liver enzymes (AST, ALT, ALP), oxidative stress indices, and apoptotic markers, reflecting the metabolic and cellular disruption induced by tumor burden. Groups treated post-tumor induction (EST/GSO, EST/GSONE) occupied intermediate positions in the heatmap, demonstrating partial restoration of antioxidant status and suppression of tumor-related markers. Notably, the EST/GSONE group exhibited a more pronounced shift toward the healthy control profile than the EST/GSO group, highlighting the superior modulatory and therapeutic efficacy of the grape seed oil nanoemulsion formulation.

Principal component analysis (Figure 15) was performed to visualize multivariate differentiation among experimental groups based on biochemical and molecular features. The first principal component (PC1) accounted for 89.3% of the total variance (Figure 15A), clearly separating the tumor-bearing EST group from control and treatment-only cohorts, with healthy animals treated with GSO or GSONE clustering closely with controls. Pairwise PCA comparisons reinforced these distinctions: Figure 15B demonstrates near-complete segregation between the control and EST groups along PC1 (94.1%), indicating substantial tumor-induced biochemical shifts. Comparison of EST and EST/GSO (Figure 15C) revealed distinct clusters. Collectively, these multivariate results demonstrate that both GSO and GSONE confer biochemical protection in tumor-bearing mice, with the nanoemulsion formulation exhibiting superior restorative capacity.

4. Discussion

Ehrlich carcinoma remains a robust and widely used experimental tumor model that effectively mimics several biological and histopathological features of aggressive human cancers, notably rapid proliferation, low differentiation, and high responsiveness to antitumor intervention [25]. The evolution of this tumor model is known to induce oxidative stress, a hallmark of many malignancies, where an imbalance between oxidant production and antioxidant defenses results in DNA damage, lipid peroxidation, and mitochondrial dysfunction [42]. Such a redox imbalance not only promotes mutagenesis but also contributes to liver injury and systemic metabolic disruption. Therefore, counteracting oxidative stress using dietary antioxidants and phytochemicals represents a promising strategy for both cancer prevention and supportive therapy [43]. Therefore, counteracting oxidative stress using dietary antioxidants and phytochemicals represents a promising strategy for both cancer prevention and supportive therapy [44].

Extensive evidence has established the chemopreventive and therapeutic effects of grape seed–derived compounds in different cancer models [45,46]. Studies in colon, prostate, lung, and skin cancer models have demonstrated that grape seed extracts (GSEs) rich in polyphenols and proanthocyanidins inhibit proliferation, induce apoptosis, and suppress angiogenesis through pathways involving PI3K/Akt, MAPK, and NF-κB signaling [47,48,49,50,51,52,53,54]. GSO shares similar bioactivity, attributed to its unique composition of linoleic acid, tocopherols, phytosterols, and polyphenols, which exhibit pro-apoptotic and antioxidant mechanisms [55]. However, despite its promising biological activity, GSO’s poor aqueous solubility and oxidative instability have limited its practical use in biomedical formulations [23].

The incorporation of GSO into a nanoemulsion (GSONE) provides clear advantages in improving its stability, dispersion, and bioavailability [56,57]. Nanocarrier-based systems, including oil-in-water nanoemulsions, have demonstrated enhanced anticancer efficacy by facilitating cellular uptake and controlled release of hydrophobic phytochemicals [58]. In the present study, the nanoformulation exhibited a mean particle size of ~88 nm and zeta potential of −28 mV, parameters reported to favor intestinal permeability and cellular internalization [59,60,61,62,63]. These physicochemical characteristics are consistent with earlier nanoemulsion studies that improved the antitumor activity of other natural oils by enhancing free radical scavenging and mitochondrial uptake [64,65,66,67].

This study’s findings that GSONE reduced tumor volume and weight more effectively than crude GSO are in agreement with reports demonstrating that nanoencapsulation potentiates the cytotoxic and apoptotic actions of grape polyphenols [68,69]. Zhu et al. and Al-Ashmawy et al. similarly observed that GSO and proanthocyanidin-rich extracts decreased tumor cell viability by modulating caspase-dependent apoptosis and VEGF-linked angiogenesis [46,70]. The improved therapeutic activity of GSONE may therefore result from enhanced intracellular delivery of active lipophilic constituents that upregulate pro-apoptotic signals (Bax, TP53, caspase-3, caspase-9) and downregulate anti-apoptotic markers (Bcl-2), thereby promoting the intrinsic apoptotic cascade. Comparable mitochondrial apoptotic activation has been described for GSE, where proanthocyanidins increased cytochrome c release and stimulated caspase-3 cleavage in cervical cancer and colon cancer cells [71,72].

Biochemical restoration observed in this study also supports the hepatoprotective potential of GSONE. Elevated AST, ALT, ALP, and bilirubin levels are hallmarks of hepatic stress in tumor-bearing mice. Normalization of these parameters after GSONE treatment mirrors earlier findings, demonstrating that GSO restores hepatic antioxidant capacity in hepatotoxic models [73]. Moreover, the observed reductions in tumor biomarkers AFP and CEA are consistent with previous studies showing that polyphenolic grape derivatives improve liver integrity and reduce systemic oxidative stress [36,74,75].

Reduction in oxidative stress biomarkers (MDA, 8-OHdG) and concomitant elevation of endogenous antioxidants (SOD, CAT, GPx, GSH) demonstrate the enhancement of antioxidant defense mechanisms by GSONE, reinforcing the activation of Nrf2/ARE signaling known from other grape-derived interventions [76,77]. Similar redox modulation has been observed in GSE-treated models of head/neck and colon cancer, where reduced ROS generation coincided with improved mitochondrial function and DNA repair [78,79]. These antioxidant responses not only mitigate tumor-associated metabolic disturbance but also limit damage to hepatic and systemic tissues [80].

The multivariate analysis further consolidated the superiority of the nanoemulsion system relative to crude oil, showing distinct clustering toward healthy control profiles. Such global biochemical normalization underscores the systemic benefits of improved delivery systems in functional nutrient-based chemoprevention [81,82]. Comparable behavior has been reported in studies utilizing lipid-based nanoparticles containing grape seed bioactives, which demonstrated selective cytotoxicity toward tumor cells while sparing normal cell lines [83,84,85].

Collectively, this work situates GSONE within the broader context of grape-derived phytochemicals and nanotechnology-based delivery systems for cancer management. Previous investigations have confirmed that grape seed components act through multiple converging mechanisms, including antioxidant, anti-inflammatory, pro-apoptotic, and antiangiogenic effects. The present findings add value by demonstrating that nanoformulation magnifies these effects in vivo, producing superior restoration of hepatic and systemic homeostasis.

Several limitations should be acknowledged. The EST model, while well-validated, represents a single aggressive tumor type that may not fully reflect the heterogeneity of human cancers. The present study focused on one specific nanoemulsion formulation; variations in particle size, surfactant composition, or preparation methods could yield different outcomes. The short observation period assessed acute effects but precluded evaluation of long-term safety and sustained therapeutic benefits. Additionally, a direct comparison with standard chemotherapeutic agents was not conducted, limiting the assessment of relative therapeutic potential. While enhanced bioavailability was demonstrated, the precise mechanisms underlying nanoemulsion-mediated tissue distribution and cellular uptake remain to be fully elucidated. Another important limitation is that the phytochemical composition of the grape seed oil (GSO) used in this study was not experimentally analyzed in our laboratory. The interpretation of its chemical profile and bioactive constituents was based on previously published data rather than direct analysis, which may introduce minor variations in reproducibility or compositional consistency. Also, the transcriptomic changes underlying the effects of grape seed oil and nanoemulsion were evaluated using targeted qPCR rather than RNA sequencing (RNA-seq). Although qPCR provided specific mechanistic insights into apoptosis and oxidative stress regulation, RNA-seq would offer a comprehensive, genome-wide view of the signaling pathways modulated by the treatments. Due to current budgetary and time constraints, this approach was not pursued, but it remains an essential future direction for validating and extending the present findings.

Similarly, flow cytometric analysis of apoptosis markers (p53, cleaved caspase-3) was performed on dispersed tumor cells without additional gating for epithelial markers such as EpCAM or cytokeratin, thereby restricting analysis to tumor cell populations. Moreover, while the observed loss of viable cells reflected the cytotoxic effects of GSO and GSONE, immunohistochemistry (IHC) or immunofluorescence (IF) could provide improved spatial localization and quantitative confirmation of apoptotic marker expression in tumor tissues.

Future research should aim to integrate omics-based profiling, long-term safety assessments, and direct mapping of nanocarrier-tumor interactions to fully delineate the molecular pathways engaged by grape seed oil nanoemulsions. By bridging nutrition, nanotechnology, and oncology, such approaches will advance the translational potential of dietary phytochemical nanoformulations for cancer prevention and adjunctive therapy.

5. Conclusions

This study demonstrates that GSONE confers greater protection against systemic oxidative stress and secondary hepatic injury induced by EST than crude GSO. The superior efficacy of GSONE can be attributed to its enhanced physicochemical properties, including improved stability, water solubility, and bioavailability, afforded by its nanoformulation. Mechanistically, GSONE acts through multiple complementary pathways, exerting potent antioxidant effects, restoring cellular redox balance, modulating oxidative stress-related biochemical parameters, and preserving liver histoarchitecture during tumor challenge. Importantly, GSONE also exhibits pronounced anti-apoptotic activity in tumor cells by downregulating some pro-apoptotic players and mitigating apoptosis-associated molecular disruptions, thereby highlighting its therapeutic promise for the management of malignancies driven by oxidative and metabolic stress.

These findings underscore the potential of nanoemulsion-based delivery systems to enhance the clinical utility of natural bioactives, such as grape seed oil, and support further translational investigation of GSONE as a novel adjunct in cancer therapy.