Interferon Inhibition Enhances the Pilot-Scale Production of Rabies Virus in Human Diploid MRC-5 Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture, Virus, IFN Inhibitors, and Antibodies
2.2. RABV Infection
2.3. RNA Extraction and Quantitative RT-PCR
2.4. Virus Production Assays
2.5. FFU Assays
2.6. MRC-5IFNAR1− Cell Line Construction by GenCRISPR™ System
2.7. Pilot Experiments
2.8. Statistical Analysis
3. Results
3.1. RABV Infection Activated IFN and IFN-Related Signaling Pathway in MRC-5 Cells
3.2. IFN Pathway Inhibitors Enhanced RABV Production in MRC-5 Cells
3.3. Utilization of IFNAR1 Antibodies Enhanced RABV Production in MRC-5 Cells
3.4. RABV Production Was Higher in MRC-5IFNAR1− Cell Line
3.5. Use of IFN Inhibitor or MRC-5IFNAR1− Cell Lines Enhanced RABV Production in Pilot Scale-Up Experiments
4. Discussion
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Plotkin, S. History of vaccination. Proc. Natl. Acad. Sci. USA 2014, 111, 12283–12287. [Google Scholar] [CrossRef] [Green Version]
- Warren-Gash, C.; Forbes, H.; Breuer, J. Varicella and herpes zoster vaccine development: Lessons learned. Expert Rev. Vaccines 2017, 16, 1191–1201. [Google Scholar] [CrossRef] [Green Version]
- Bell, B. Hepatitis A vaccine. Semin. Pediatric Infect. Dis. 2002, 13, 165–173. [Google Scholar] [CrossRef]
- Fisher, C.; Schnell, M. New developments in rabies vaccination. Rev. Sci. Tech. 2018, 37, 657–672. [Google Scholar] [CrossRef]
- Gao, Q.; Bao, L.; Mao, H.; Wang, L.; Xu, K.; Yang, M.; Li, Y.; Zhu, L.; Wang, N.; Lv, Z.; et al. Development of an inactivated vaccine candidate for SARS-CoV-2. Science 2020, 369, 77–81. [Google Scholar] [CrossRef]
- Cohen, J.I.; Nguyen, H. Varicella-zoster virus glycoprotein I is essential for growth of virus in Vero cells. J. Virol. 1997, 71, 6913–6920. [Google Scholar] [CrossRef] [Green Version]
- Montagnon, B.J.; Fanget, B.; Nicolas, A.J. The large-scale cultivation of VERO cells in micro-carrier culture for virus vaccine production. Preliminary results for killed poliovirus vaccine. Dev. Biol. Stand. 1981, 47, 55–64. [Google Scholar]
- Trabelsi, K.; Ben Zakour, M.; Kallel, H. Purification of rabies virus produced in Vero cells grown in serum free medium. Vaccine 2019, 37, 7052–7060. [Google Scholar] [CrossRef] [PubMed]
- Huang, Z.; Jiang, Q.; Wang, Y.; Yang, J.; Du, T.; Yi, H.; Li, C.; Li, Y.; Wu, Z.; Fan, S.; et al. SARS-CoV-2 inactivated vaccine (Vero cells) shows good safety in repeated administration toxicity test of Sprague Dawley rats. Food Chem. Toxicol. 2021, 152, 112239. [Google Scholar] [CrossRef] [PubMed]
- Vidor, E.; Meschievitz, C.; Plotkin, S. Fifteen years of experience with Vero-produced enhanced potency inactivated poliovirus vaccine. Pediatr. Infect. Dis. J. 1997, 16, 312–322. [Google Scholar] [CrossRef] [PubMed]
- Barrett, P.N.; Mundt, W.; Kistner, O.; Howard, M.K. Vero cell platform in vaccine production: Moving towards cell culture-based viral vaccines. Expert Rev. Vaccines 2009, 8, 607–618. [Google Scholar] [CrossRef]
- Niu, X.; Tang, L.; Tseggai, T.; Guo, Y.; Fu, Z.F. Wild-type rabies virus phosphoprotein is associated with viral sensitivity to type I interferon treatment. Arch. Virol. 2013, 158, 2297–2305. [Google Scholar] [CrossRef]
- Li, R.; Huang, L.; Li, J.; Mo, Z.; He, B.; Wang, Y.; Wu, X.; Minutello, M.; Guinet-Morlot, F.; Pichon, S. A next-generation, serum-free, highly purified Vero cell rabies vaccine is safe and as immunogenic as the reference vaccine Verorab® when administered according to a post-exposure regimen in healthy children and adults in China. Vaccine 2013, 31, 5940–5947. [Google Scholar] [CrossRef] [Green Version]
- WHO. WHO Expert Consultation on Rabies. 2018. Available online: https://apps.who.int/iris/bitstream/handle/10665/272364/9789241210218-eng.pdf?sequence=1&isAllowed=y (accessed on 25 November 2021).
- Müller, F.T.; Freuling, C.M. Rabies control in Europe: An overview of past, current and future strategies. Rev. Sci. Tech. 2018, 37, 409–419. [Google Scholar] [CrossRef]
- Fishbein, D.B.; Yenne, K.M.; Dreesen, D.W.; Teplis, C.F.; Mehta, N.; Briggs, D.J. Risk factors for systemic hypersensitivity reactions after booster vaccinations with human diploid cell rabies vaccine: A nationwide prospective study. Vaccine 1993, 11, 1390–1394. [Google Scholar] [CrossRef]
- Fayaz, A.; Simani, S.; Janani, A.; Farahtaj, F.; Biglari, P.; Howeizi, N.; Eslami, N. Antibody persistence, 32 years after post-exposure prophylaxis with human diploid cell rabies vaccine (HDCV). Vaccine 2011, 29, 3742–3745. [Google Scholar] [CrossRef] [PubMed]
- Aggarwal, R.; Goel, A. Hepatitis A: Epidemiology in resource-poor countries. Curr. Opin. Infect. Dis. 2015, 28, 488–496. [Google Scholar] [CrossRef] [PubMed]
- Dietzschold, B.; Schnell, M.; Koprowski, H. Pathogenesis of rabies. Curr. Top. Microbiol. Immunol. 2005, 292, 45–56. [Google Scholar] [CrossRef] [PubMed]
- WHO 2021. Available online: https://www.who.int/health-topics/rabies#tab=tab_1 (accessed on 8 October 2021).
- Hemachudha, T.; Laothamatas, J.; Rupprecht, C.E. Human rabies: A disease of complex neuropathogenetic mechanisms and diagnostic challenges. Lancet Neurol. 2002, 1, 101–109. [Google Scholar] [CrossRef]
- Etessami, R.; Conzelmann, K.K.; Fadai-Ghotbi, B.; Natelson, B.; Tsiang, H.; Ceccaldi, P.E. Spread and pathogenic characteristics of a G-deficient rabies virus recombinant: An in vitro and in vivo study. J. Gen. Virol. 2000, 81, 2147–2153. [Google Scholar] [CrossRef]
- Fehlner-Gardiner, C. Rabies control in North America-past, present and future. Rev. Sci. Tech. 2018, 37, 421–437. [Google Scholar] [CrossRef] [PubMed]
- Astray, R.; Jorge, S.; Pereira, C. Rabies vaccine development by expression of recombinant viral glycoprotein. Arch. Virol. 2017, 162, 323–332. [Google Scholar] [CrossRef] [PubMed]
- Koraka, P.; Bosch, B.; Cox, M.; Chubet, R.; Amerongen, G.; Lövgren-Bengtsson, K.; Martina, B.; Roose, J.; Rottier, P.; Osterhaus, A. A recombinant rabies vaccine expressing the trimeric form of the glycoprotein confers enhanced immunogenicity and protection in outbred mice. Vaccine 2014, 32, 4644–4650. [Google Scholar] [CrossRef] [Green Version]
- Shah, M.; Khan, S.; Ali, Z.; Yang, H.; Liu, K.; Mao, L. Applications of nanoparticles for DNA based rabies vaccine. J. Nanosci. Nanotechnol. 2014, 14, 881–891. [Google Scholar] [CrossRef] [PubMed]
- Schnee, M.; Vogel, A.; Voss, D.; Petsch, B.; Baumhof, P.; Kramps, T.; Stitz, L. An mRNA Vaccine Encoding Rabies Virus Glycoprotein Induces Protection against Lethal Infection in Mice and Correlates of Protection in Adult and Newborn Pigs. PLoS Negl. Trop. Dis. 2016, 10, e0004746. [Google Scholar] [CrossRef] [PubMed]
- Goodbourn, S.; Didcock, L.; Randall, R. Interferons: Cell signalling, immune modulation, antiviral response and virus countermeasures. J. Gen. Virol. 2000, 81, 2341–2364. [Google Scholar] [CrossRef]
- Randall, R.; Goodbourn, S. Interferons and viruses: An interplay between induction, signalling, antiviral responses and virus countermeasures. J. Gen. Virol. 2008, 89, 1–47. [Google Scholar] [CrossRef]
- Cheng, L.; Ma, J.; Li, J.; Li, D.; Li, G.; Li, F.; Zhang, Q.; Yu, H.; Yasui, F.; Ye, C.; et al. Blocking type I interferon signaling enhances T cell recovery and reduces HIV-1 reservoirs. J. Clin. Investig. 2017, 127, 269–279. [Google Scholar] [CrossRef] [Green Version]
- Chiu, Y.; Macmillan, J.; Chen, Z. RNA polymerase III detects cytosolic DNA and induces type I interferons through the RIG-I pathway. Cell 2009, 138, 576–591. [Google Scholar] [CrossRef] [Green Version]
- Kim, S.; Sze, L.; Liu, C.; Lam, K. The stress granule protein G3BP1 binds viral dsRNA and RIG-I to enhance interferon-β response. J. Biol. Chem. 2019, 294, 6430–6438. [Google Scholar] [CrossRef] [Green Version]
- Huang, H.; Cai, B.; Suen, C.; Lee, H.; Hwang, M.; Liu, F.; Kannagi, R. BGN/TLR4/NF-B Mediates Epigenetic Silencing of Immunosuppressive Siglec Ligands in Colon Cancer Cells. Cells 2020, 9, 397. [Google Scholar] [CrossRef] [Green Version]
- Jayavelu, A.; Schnöder, T.; Perner, F.; Herzog, C.; Meiler, A.; Krishnamoorthy, G.; Huber, N.; Mohr, J.; Edelmann-Stephan, B.; Austin, R.; et al. Splicing factor YBX1 mediates persistence of JAK2-mutated neoplasms. Nature 2020, 588, 157–163. [Google Scholar] [CrossRef]
- Guo, Y.; Duan, M.; Wang, X.; Gao, J.; Guan, Z.; Zhang, M. Early events in rabies virus infection-Attachment, entry, and intracellular trafficking. Virus Res. 2019, 263, 217–225. [Google Scholar] [CrossRef]
- Lindeboom, R.G.; Supek, F.; Lehner, B. The rules and impact of nonsense-mediated mRNA decay in human cancers. Nat. Genet. 2016, 48, 1112–1118. [Google Scholar] [CrossRef] [Green Version]
- Smits, A.H.; Ziebell, F.; Joberty, G.; Zinn, N.; Mueller, W.F.; Clauder-Münster, S.; Eberhard, D.; Fälth Savitski, M.; Grandi, P.; Jakob, P.; et al. Biological plasticity rescues target activity in CRISPR knock outs. Nat. Methods 2019, 16, 1087–1093. [Google Scholar] [CrossRef]
- Lykke-Andersen, J.; Bennett, E.J. Protecting the proteome: Eukaryotic cotranslational quality control pathways. J. Cell Biol. 2014, 204, 467–476. [Google Scholar] [CrossRef] [Green Version]
- Huang, S.; Zhu, Z.; Hu, Q. Response to letter to the editor on analysis. Hum. Vaccines Immunother. 2019, 15, 2127–2128. [Google Scholar] [CrossRef] [PubMed]
- Zhu, S.; Guo, C. Rabies Control and Treatment: From Prophylaxis to Strategies with Curative Potential. Viruses 2016, 8, 279. [Google Scholar] [CrossRef] [PubMed]
- Thoulouze, M.I.; Lafage, M.; Schachner, M.; Hartmann, U.; Cremer, H.; Lafon, M. The neural cell adhesion molecule is a receptor for rabies virus. J. Virol. 1998, 72, 7181–7190. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Majer, M.; Herrmann, A.; Hilfenhaus, J.; Mauler, R.; Lehmann, H.G.; Hennessen, W.; Kuwert, E.K. A comparison of the Pasteur and Pitman-Moore strains of rabies virus for the production of rabies vaccine in human diploid cells. J. Biol. Stand. 1977, 5, 249–256. [Google Scholar] [CrossRef]
- Nikolic, J.; Civas, A.; Lama, Z.; Lagaudriere-Gesbert, C.; Blondel, D. Rabies Virus Infection Induces the Formation of Stress Granules Closely Connected to the Viral Factories. PLoS Pathog. 2016, 12, e1005942. [Google Scholar] [CrossRef] [Green Version]
- Beutler, B.; Jiang, Z.; Georgel, P.; Crozat, K.; Croker, B.; Rutschmann, S.; Du, X.; Hoebe, K. Genetic analysis of host resistance: Toll-like receptor signaling and immunity at large. Annu. Rev. Immunol. 2006, 24, 353–389. [Google Scholar] [CrossRef] [Green Version]
- Kim, B.; Shenoy, A.; Kumar, P.; Bradfield, C.; MacMicking, J. IFN-inducible GTPases in host cell defense. Cell Host Microbe 2012, 12, 432–444. [Google Scholar] [CrossRef] [Green Version]
- Brzozka, K.; Finke, S.; Conzelmann, K.K. Identification of the rabies virus alpha/beta interferon antagonist: Phosphoprotein P interferes with phosphorylation of interferon regulatory factor 3. J. Virol. 2005, 79, 7673–7681. [Google Scholar] [CrossRef] [Green Version]
- Hossain, M.A.; Larrous, F.; Rawlinson, S.M.; Zhan, J.; Sethi, A.; Ibrahim, Y.; Aloi, M.; Lieu, K.G.; Mok, Y.F.; Griffin, M.D.W.; et al. Structural Elucidation of Viral Antagonism of Innate Immunity at the STAT1 Interface. Cell Rep. 2019, 29, 1934–1945.e8. [Google Scholar] [CrossRef] [Green Version]
- Young, D.F.; Andrejeva, L.; Livingstone, A.; Goodbourn, S.; Lamb, R.A.; Collins, P.L.; Elliott, R.M.; Randall, R.E. Virus replication in engineered human cells that do not respond to interferons. J. Virol. 2003, 77, 2174–2181. [Google Scholar] [CrossRef] [Green Version]
- Lin, F.; Zeng, F.; Lu, L.; Lu, X.; Zen, R.; Yu, Y.; Chen, N. The primary hamster kidney cell rabies vaccine: Adaptation of viral strain, production of vaccine, and pre- and postexposure treatment. J. Infect. Dis. 1983, 147, 467–473. [Google Scholar] [CrossRef]
- Wu, X.; Smith, T.G.; Rupprecht, C.E. From brain passage to cell adaptation: The road of human rabies vaccine development. Expert Rev. Vaccines 2011, 10, 1597–1608. [Google Scholar] [CrossRef]
- Jacobs, J.P.; Jones, C.M.; Baille, J.P. Characteristics of a human diploid cell designated MRC-5. Nature 1970, 227, 168–170. [Google Scholar] [CrossRef]
- Kitala, P.; Lindqvist, K.; Koimett, E.; Johnson, B.; Chunge, C.; Perrin, P.; Olsvik, O. Comparison of human immune responses to purified Vero cell and human diploid cell rabies vaccines by using two different antibody titration methods. J. Clin. Microbiol. 1990, 28, 1847–1850. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stewart, C.E.; Randall, R.E.; Adamson, C.S. Inhibitors of the interferon response enhance virus replication in vitro. PLoS ONE 2014, 9, e112014. [Google Scholar] [CrossRef]
- Hamamoto, I.; Takaku, H.; Tashiro, M.; Yamamoto, N. High yield production of influenza virus in Madin Darby canine kidney (MDCK) cells with stable knockdown of IRF7. PLoS ONE 2013, 8, e59892. [Google Scholar] [CrossRef] [PubMed]





| Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
|---|---|---|
| Rabies virus N protein | CAAGATGTGTGCYAAYTGGAG | AGCCCTGGTTCGAACATTCT |
| IFN-α | TTAGGATCCATGGCCTCGCCCTTT | CGCGAATTCGTTATTCCTTCCTCC |
| IFN-β | GTCTCCTCCAAATTGCTCTC | ACAGGAGCTTCTGACACTGA |
| STAT1 | TTCTGTGTCTGAAGTGTAAGTGAA | TAACACGGGGATCTCAACAAGTTC |
| OAS1 | AGAAGGCAGCTCACGAAACC | CCACCACCCAAGTTTCCTGTA |
| IRF7 | GAGCCCTTACCTCCCCTGTTAT | CCACTGCAGCCCCTCATAG |
| 18S | CTTAGAGGGACAAGTGGCG | ACGCTGAGCCAGTCAGTGTA |
| IFNAR1 | GTAGAGGGGCGGTGAGAGCTA | CGCCATCGCCCCGTCCTAAG |
| Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
|---|---|---|
| IFNAR1 gRNA T1 | TGCGAGCCTTTATCTTCTTGCC | CTGGCAGAACTGGGGTTAGA |
| IFNAR1 gRNA T2 | TCTGTAACCTTAGCCCC | GACTGTTTTGGAGCACC |
| IFNAR1 gRNA T3 | AACTACCCAGTGTGTCTT | CTCAAACCCTTAGGCTCA |
| MOI | 96 hpi | 168 hpi | 240 hpi | |||||||
|---|---|---|---|---|---|---|---|---|---|---|
| IU/mL | 0.05 | 0.1 | 0.5 | 0.05 | 0.1 | 0.5 | 0.05 | 0.1 | 0.5 | |
| MRC-5+ | 2.22 ± 0.30 | 2.23 ± 0.27 | 2.76 ± 0.11 | 2.76 ± 0.11 | 2.26 ± 0.26 | 2.32 ± 0.13 | 2.32 ± 0.10 | 2.61 ± 0.29 | 3.36 ± 0.14 | |
| MRC-5+ + TPCA-1 (0.5 μM) | 2.58 ± 0.22 | 2.09 ± 0.21 | 2.67 ± 0.12 | 2.87 ± 0.18 | 3.93 ± 0.19 | 4.49 ± 0.28 | 4.97 ± 0.25 | 4.81 ± 0.29 | 3.26 ± 0.34 | |
| MRC-5+ + TPCA-1 (1 μM) | 2.36 ± 0.10 | 3.07 ± 0.17 | 2.76 ± 0.04 | 4.74 ± 0.11 | 4.85 ± 0.23 | 4.44 ± 0.38 | 6.94 ± 0.19 | 7.19 ± 0.50 | 4.13 ± 0.36 | |
| MRC-5+ + TPCA-1 (4 μM) | 5.09 ± 0.40 | 4.74 ± 0.33 | 3.59 ± 0.38 | 7.12 ± 0.42 | 6.96 ± 0.44 | 4.27 ± 0.24 | 6.64 ± 0.56 | 5.78 ± 0.44 | 4.11 ± 0.22 | |
| gRNAs | Sequence | Cleavage Efficiency |
|---|---|---|
| MRC-5IFNAR1−-1 | CTGGAGCCACTGAACTTGAA | 44% |
| MRC-5IFNAR1−-2 | TTCCATCAGATGCTTGTACG | 40% |
| MRC-5IFNAR1−-3 | AGTGGATAATCCTGGATCAC | 48% |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, X.; Wan, M.; Cai, L.; Hou, A.; Sun, B.; Zhou, Y.; Gao, F.; Su, W.; Jiang, C. Interferon Inhibition Enhances the Pilot-Scale Production of Rabies Virus in Human Diploid MRC-5 Cells. Viruses 2022, 14, 49. https://doi.org/10.3390/v14010049
Yang X, Wan M, Cai L, Hou A, Sun B, Zhou Y, Gao F, Su W, Jiang C. Interferon Inhibition Enhances the Pilot-Scale Production of Rabies Virus in Human Diploid MRC-5 Cells. Viruses. 2022; 14(1):49. https://doi.org/10.3390/v14010049
Chicago/Turabian StyleYang, Xiao, Mingming Wan, Linjun Cai, Ali Hou, Bo Sun, Yan Zhou, Feng Gao, Weiheng Su, and Chunlai Jiang. 2022. "Interferon Inhibition Enhances the Pilot-Scale Production of Rabies Virus in Human Diploid MRC-5 Cells" Viruses 14, no. 1: 49. https://doi.org/10.3390/v14010049
APA StyleYang, X., Wan, M., Cai, L., Hou, A., Sun, B., Zhou, Y., Gao, F., Su, W., & Jiang, C. (2022). Interferon Inhibition Enhances the Pilot-Scale Production of Rabies Virus in Human Diploid MRC-5 Cells. Viruses, 14(1), 49. https://doi.org/10.3390/v14010049

