Development of an RT-LAMP Assay for the Rapid Detection of SFTS Virus
Abstract
:1. Introduction
2. Materials and Methods
2.1. Primer/Probe for RT-LAMP
2.2. Cell Culture
2.3. Viruses
2.4. Serum Samples
2.5. RNA Extraction
2.6. Standard and Simplified RT-LAMP Assay
2.7. Quantitative Real-Time RT-PCR and Conventional RT-PCR
3. Results
3.1. Detection Limit in the Standard RT-LAMP Assays
3.2. Cross Reactivity in the RT-LAMP Assay
3.3. Simplified RT-LAMP
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Yu, X.-J.; Liang, M.-F.; Zhang, S.-Y.; Liu, Y.; Li, J.-D.; Sun, Y.-L.; Zhang, L.; Zhang, Q.-F.; Popov, V.L.; Li, C.; et al. Fever with Thrombocytopenia Associated with a Novel Bunyavirus in China. N. Engl. J. Med. 2011, 364, 1523–1532. [Google Scholar] [CrossRef] [Green Version]
- International Committee on Taxonomy of Viruses. ICTV Virus Taxonomy: 2019 Release. Available online: https://talk.ictvonline.org/taxonomy/ (accessed on 17 February 2021).
- Li, D. A highly pathogenic new bunyavirus emerged in China. Emerg. Microbes Infect. 2013, 2, 1–4. [Google Scholar] [CrossRef]
- Hu, J.; Li, Z.; Cai, J.; Liu, D.; Zhang, X.; Jiang, R.; Guo, X.; Liu, D.; Zhang, Y.; Cui, L.; et al. A cluster of bunyavirus-associated severe fever with thrombocytopenia syndrome cases in a coastal plain area in China, 2015: Identification of a previously unidentified endemic region for severe fever with thrombocytopenia bunyavirus. Open Forum Infect. Dis. 2019, 6, 209. [Google Scholar] [CrossRef]
- Jung, I.Y.; Choi, W.; Kim, J.; Wang, E.; Park, S.W.; Lee, W.J.; Choi, J.Y.; Kim, H.Y.; Uh, Y.; Kim, Y.K. Nosocomial person-to-person transmission of severe fever with thrombocytopenia syndrome. Clin. Microbiol. Infect. 2019, 25, 633.e1. [Google Scholar] [CrossRef]
- Jia, B.; Wu, W.; Huang, R.; Wang, G.; Song, P.; Li, Y.; Liu, Y.; Xiong, Y.; Yan, X.; Hao, Y.; et al. Characterization of clinical features and outcome for human-to-human transmitted severe fever with thrombocytopenia syndrome. Infect. Dis. 2018, 50, 601–608. [Google Scholar] [CrossRef]
- Zhu, Y.; Wu, H.; Gao, J.; Zhou, X.; Zhu, R.; Zhang, C.; Bai, H.; Abdullah, A.S.; Pan, H. Two confirmed cases of severe fever with thrombocytopenia syndrome with pneumonia: Implication for a family cluster in East China. BMC Infect. Dis. 2017, 17, 1–7. [Google Scholar] [CrossRef] [Green Version]
- Tang, X.; Wu, W.; Wang, H.; Du, Y.; Liu, L.; Kang, K.; Huang, X.; Ma, H.; Mu, F.; Zhang, S.; et al. Human-to-Human Transmission of Severe Fever With Thrombocytopenia Syndrome Bunyavirus Through Contact With Infectious Blood. J. Infect. Dis. 2012, 207, 736–739. [Google Scholar] [CrossRef] [Green Version]
- Chen, H.; Hu, K.; Zou, J.; Xiao, J. A cluster of cases of human-to-human transmission caused by severe fever with thrombo-cytopenia syndrome bunyavirus. Int. J. Infect. Dis. 2013, 17, e206–e208. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kida, K.; Matsuoka, Y.; Shimoda, T.; Matsuoka, H.; Yamada, H.; Saito, T.; Imataki, O.; Kadowaki, N.; Noguchi, K.; Maeda, K.; et al. A Case of Cat-to-Human Transmission of Severe Fever with Thrombocytopenia Syndrome Virus. Jpn. J. Infect. Dis. 2019, 72, 356–358. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yamanaka, A.; Kirino, Y.; Fujimoto, S.; Ueda, N.; Himeji, D.; Miura, M.; Sudaryatma, P.E.; Sato, Y.; Tanaka, H.; Mekata, H.; et al. Direct Transmission of Severe Fever with Thrombocytopenia Syndrome Virus from Domestic Cat to Veterinary Personnel. Emerg. Infect. Dis. 2020, 26, 2994–2998. [Google Scholar] [CrossRef] [PubMed]
- Tsuru, M.; Suzuki, T.; Murakami, T.; Matsui, K.; Maeda, Y.; Yoshikawa, T.; Kurosu, T.; Shimojima, M.; Shimada, T.; Hasegawa, H.; et al. Pathological characteristics of a patient with severe fever with thrombocytopenia syndrome (SFTS) infected with SFTS virus through a sick cat’s bite. Viruses 2021, 13, 204. [Google Scholar] [CrossRef] [PubMed]
- Kim, K.H.; Yi, J.; Kim, G.; Choi, S.J.; Jun, K.I.; Kim, N.H.; Choe, P.G.; Kim, N.J.; Lee, J.K.; Oh, M.D. Severe fever with thrombocytopenia syndrome, South Korea, 2012. Emerg. Infect. Dis. 2013, 19, 1892–1894. [Google Scholar] [CrossRef] [PubMed]
- Takahashi, T.; Maeda, K.; Suzuki, T.; Ishido, A.; Shigeoka, T.; Tominaga, T.; Kamei, T.; Honda, M.; Ninomiya, D.; Sakai, T.; et al. The First Identification and Retrospective Study of Severe Fever with Thrombocytopenia Syndrome in Japan. J. Infect. Dis. 2014, 209, 816–827. [Google Scholar] [CrossRef] [PubMed]
- Tran, X.C.; Yun, Y.; Van An, L.; Kim, S.-H.; Thao, N.T.P.; Man, P.K.C.; Yoo, J.R.; Heo, S.T.; Cho, N.-H.; Lee, K.H. Endemic Severe Fever with Thrombocytopenia Syndrome, Vietnam. Emerg. Infect. Dis. 2019, 25, 1029–1031. [Google Scholar] [CrossRef]
- Lin, T.-L.; Ou, S.-C.; Maeda, K.; Shimoda, H.; Chan, J.P.-W.; Tu, W.-C.; Hsu, W.-L.; Chou, C.-C. The first discovery of severe fever with thrombocytopenia syndrome virus in Taiwan. Emerg. Microbes Infect. 2020, 9, 148–151. [Google Scholar] [CrossRef] [PubMed]
- Fu, Y.; Li, S.; Zhang, Z.; Man, S.; Li, X.; Zhang, W.; Zhang, C.; Cheng, X. Phylogeographic analysis of severe fever with thrombocytopenia syndrome virus from Zhoushan Islands, China: Implication for transmission across the ocean. Sci. Rep. 2016, 6, 19563. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yoshikawa, T.; Shimojima, M.; Fukushi, S.; Tani, H.; Fukuma, A.; Taniguchi, S.; Singh, H.; Suda, Y.; Shirabe, K.; Toda, S.; et al. Phylogenetic and Geographic Relationships of Severe Fever with Thrombocytopenia Syndrome Virus in China, South Korea, and Japan. J. Infect. Dis. 2015, 212, 889–898. [Google Scholar] [CrossRef] [PubMed]
- Yoshikawa, T.; Fukushi, S.; Tani, H.; Fukuma, A.; Taniguchi, S.; Toda, S.; Shimazu, Y.; Yano, K.; Morimitsu, T.; Ando, K.; et al. Sensitive and specific PCR systems for detection of both Chinese and Japanese severe fever with thrombocytopenia syndrome virus strains and prediction of patient survival based on viral load. J. Clin. Microbiol. 2014, 52, 3325–3333. [Google Scholar] [CrossRef] [Green Version]
- Sun, Y.; Liang, M.; Qu, J.; Jin, C.; Zhang, Q.; Li, J.; Jiang, X.; Wang, Q.; Lu, J.; Gu, W.; et al. Early diagnosis of novel SFTS bunyavirus infection by quantitative real-time RT-PCR assay. J. Clin. Virol. 2012, 53, 48–53. [Google Scholar] [CrossRef]
- Oh, S.-S.; Chae, J.-B.; Kang, J.-G.; Kim, H.-C.; Chong, S.-T.; Shin, J.-H.; Hur, M.-S.; Suh, J.-H.; Oh, M.-D.; Jeong, S.-M.; et al. Detection of Severe Fever with Thrombocytopenia Syndrome Virus from Wild Animals and Ixodidae Ticks in the Republic of Korea. Vector Borne Zoonotic Dis. 2016, 16, 408–414. [Google Scholar] [CrossRef]
- Kang, J.-G.; Cho, Y.-K.; Han, S.-W.; Jeon, K.; Choi, H.; Kim, J.-H.; Cho, N.-H.; Choi, K.-S.; Chae, J.-S. Molecular and Serological Investigation of Severe Fever with Thrombocytopenia Syndrome Virus in Cats. Vector Borne Zoonotic Dis. 2020, 20, 916–920. [Google Scholar] [CrossRef]
- Matsuu, A.; Momoi, Y.; Nishiguchi, A.; Noguchi, K.; Yabuki, M.; Hamakubo, E.; Take, M.; Maeda, K. Natural severe fever with thrombocytopenia syndrome virus infection in domestic cats in Japan. Vet. Microbiol. 2019, 236, 108346. [Google Scholar] [CrossRef] [PubMed]
- Park, E.-S.; Fujita, O.; Kimura, M.; Hotta, A.; Imaoka, K.; Shimojima, M.; Saijo, M.; Maeda, K.; Morikawa, S. Diagnostic system for the detection of severe fever with thrombocytopenia syndrome virus RNA from suspected infected animals. PLoS ONE 2021, 16, e0238671. [Google Scholar] [CrossRef]
- Xu, H.; Zhang, L.; Shen, G.; Feng, C.; Wang, X.; Yan, J.; Zhang, Y. Establishment of a novel one-step reverse transcription loop-mediated isothermal amplification assay for rapid identification of RNA from the severe fever with thrombocytopenia syndrome virus. J. Virol. Methods 2013, 194, 21–25. [Google Scholar] [CrossRef]
- Baek, Y.H.; Cheon, H.-S.; Park, S.-J.; Lloren, K.K.S.; Ahn, S.J.; Jeong, J.H.; Choi, W.-S.; Yu, M.-A.; Kwon, H.-I.; Kwon, J.-J.; et al. Simple, Rapid and Sensitive Portable Molecular Diagnosis of SFTS Virus Using Reverse Transcriptional Loop-Mediated Isothermal Amplification (RT-LAMP). J. Microbiol. Biotechnol. 2018, 28, 1928–1936. [Google Scholar] [CrossRef] [PubMed]
- Eiken Primer Explorer Software. Available online: https://primerexplorer.jp/e/ (accessed on 17 February 2021).
- Shirato, K.; Semba, S.; El-Kafrawy, S.A.; Hassan, A.M.; Tolah, A.M.; Takayama, I.; Kageyama, T.; Notomi, T.; Kamitani, W.; Matsuyama, S.; et al. Development of fluorescent reverse transcription loop-mediated isothermal amplification (RT-LAMP) using quenching probes for the detection of the Middle East respiratory syndrome coronavirus. J. Virol. Methods 2018, 258, 41–48. [Google Scholar] [CrossRef]
- Taniguchi, S.; Fukuma, A.; Tani, H.; Fukushi, S.; Saijo, M.; Shimojima, M. A neutralization assay with a severe fever with thrombocytopenia syndrome virus strain that makes plaques in inoculated cells. J. Virol. Methods 2017, 244, 4–10. [Google Scholar] [CrossRef] [PubMed]
- Fukuma, A.; Kurosaki, Y.; Morikawa, Y.; Grolla, A.; Feldmann, H.; Yasuda, J. Rapid detection of Lassa virus by reverse transcription-loop-mediated isothermal amplification. Microbiol. Immunol. 2010, 55, 44–50. [Google Scholar] [CrossRef] [PubMed]
- Kurosaki, Y.; Grolla, A.; Fukuma, A.; Feldmann, H.; Yasuda, J. Development and Evaluation of a Simple Assay for Marburg Virus Detection Using a Reverse Transcription-Loop-Mediated Isothermal Amplification Method. J. Clin. Microbiol. 2010, 48, 2330–2336. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Oloniniyi, O.K.; Kurosaki, Y.; Miyamoto, H.; Takada, A.; Yasuda, J. Rapid detection of all known ebolavirus species by reverse transcription-loop-mediated isothermal amplification (RT-LAMP). J. Virol. Methods 2017, 246, 8–14. [Google Scholar] [CrossRef] [PubMed]
- Osman, H.A.; Eltom, K.H.; Musa, N.O.; Bilal, N.M.; Elbashir, M.I.; Aradaib, I.E. Development and evaluation of loop-mediated isothermal amplification assay for detection of Crimean Congo hemorrhagic fever virus in Sudan. J. Virol. Methods 2013, 190, 4–10. [Google Scholar] [CrossRef]
- Yang, G.; Li, B.; Liu, L.; Huang, W.; Zhang, W.; Liu, Y. Development and evaluation of a reverse transcription loop-mediated isothermal amplification assay for rapid detection of a new SFTS bunyavirus. Arch. Virol. 2012, 157, 1779–1783. [Google Scholar] [CrossRef]
- Huang, X.-Y.; Hu, X.-N.; Ma, H.-X.; Du, Y.-H.; Kang, K.; You, A.-G.; Wang, H.-F.; Zhang, L.; Chen, H.-M.; Dumler, J.S.; et al. Detection of New Bunyavirus RNA by Reverse Transcription-Loop-Mediated Isothermal Amplification. J. Clin. Microbiol. 2014, 52, 531–535. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, J.W.; Won, Y.J.; Kang, L.H.; Lee, S.G.; Park, S.W.; Paik, S.Y. Development of a real-time loop-mediated isothermal amplification method for the detection of severe fever with thrombocytopenia syndrome virus. J. Microbiol. 2020, 58, 711–715. [Google Scholar] [CrossRef] [PubMed]
- Gai, Z.-T.; Zhang, Y.; Liang, M.-F.; Jin, C.; Zhang, S.; Zhu, C.-B.; Li, C.; Li, X.-Y.; Zhang, Q.-F.; Bian, P.-F.; et al. Clinical Progress and Risk Factors for Death in Severe Fever with Thrombocytopenia Syndrome Patients. J. Infect. Dis. 2012, 206, 1095–1102. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, Z.; Cui, L.; Zhou, M.; Qi, X.; Bao, C.; Hu, J.; Shan, J.; Wu, B.; Wang, S.; Guo, X.; et al. Development and application of a one-step real-time RT-PCR using a minor-groove-binding probe for the detection of a novel bunyavirus in clinical specimens. J. Med. Virol. 2012, 85, 370–377. [Google Scholar] [CrossRef]
Name | Primer Sequence (5′-3′) | Position | Final Conc. (pmol/Reaction) |
---|---|---|---|
SFTS_L_F3 | GATGGAGATGGGACTAGCAAC | 5231–5251 | 5 |
SFTS_L_B3-1 | CTTGATCTTGAACCCACTCAG | 5384–5404 | 2.5 |
SFTS_L_B3-2 | CTTGATCTTGAATCCACTCAG | 5384–5404 | 2.5 |
SFTS_L_FIP-1 | CTTCGGATGGATTCAATGAC-TGGCTTGAGGAGATCAGG | 5297–5316(F1c) + 5252–5269 (F2) | 60 |
SFTS_L_FIP-2 | CTCCGGATCGATTCAATGAC-TGGCTTGAGGAGATCAGG | 5297–5316(F1c) + 5252–5269 (F2) | 40 |
SFTS_L_BIP-1 | GTGACGACCTTGGGATCAA-CCTAACCATGCAATGACCTC | 5322–5339(B1c) + 5364–5384(B2) | 60 |
SFTS_L_BIP-2 | GTGATGACCTTGGGATCA-CCTAACCATGCAATGACCTC | 5322–5340(B1c) + 5364–5384(B2) | 40 |
SFTS_L_LF | CATAAAGCCTGGCATCACTAC | 5274–5294 | 20 |
SFTS_L_LB-1 | TAACAGGGTGGCATCTGC | 5341–5358 | 10 |
SFTS_L_LB-2 | CAACAGGGTAGCATCTGC | 5341–5358 | 10 |
SFTS_L_QProbe | CATAAAGCCTGGCATCACTACTGAGCC | 5268–5294 | 1 |
Genotype (L Segment) | Strain | Viral RNA Copy Numbers/Reaction | ||
---|---|---|---|---|
100 | 10 | 1 | ||
J1 | YG1 | +/+/+ | +/+/− | +/−/− |
SPL010 | +/+/+ | −/−/− | −/−/− | |
SPL035 | +/+/+ | +/+/+ | −/−/− | |
J2 | SPL100 | +/+/+ | +/+/− | −/−/− |
SPL057 | +/+/+ | +/−/− | −/−/− | |
J3 | SPL004 | +/+/+ | +/−/− | +/−/− |
SPL230 | +/+/+ | +/−/− | −/−/− | |
C3 | HB29 | +/+/+ | +/+/+ | −/−/− |
C4 | SPL193 | +/+/+ | +/−/− | −/−/− |
C5 | SPL087 | +/+/+ | +/−/− | +/−/− |
SPL179 | +/+/+ | +/+/+ | +/+/− | |
SPL238 | +/+/+ | −/−/− | −/−/− |
Family | Species | Virus Titer (Log10 TCID50 or FFU/mL) | Standard RT-LAMP |
---|---|---|---|
Phenuiviridae | SFTSV SPL004 | 8.0 | + |
Heartland bandavirus | 7.8 | − | |
Palma virus (Bhanja bandavirus) | 7.3 | − | |
Forecariah virus (Bhanja bandavirus) | 7.1 | − | |
Rift Valley fever phlebovirus (MP−12) * | 6.4 | − | |
Nairoviridae | Soft tick bunyavirus (Keterah orthonairovirus) | 5.5 | − |
Issyk-Kul virus (Keterah orthonairovirus) | 5.5 | − | |
Hazara orthonairovirus | 5.9 | − | |
Dugbe orthonairovirus | 6.1 | − | |
Arenaviridae | Mobala mammarenavirus | 6.0 | − |
Mopeia mammarenavirus | 8.4 | − | |
Argentinian mammarenavirus (Candid#1 **) | 6.7 | − | |
Lymphocytic choriomeningitis mammarenavirus | 5.0 | − | |
Paramyxoviridae | Nipah henipavirus | 7.6 | − |
Flaviviridae | Zika virus | 6.9 | − |
Coronaviridae | SARS-related CoV | 7.6 | − |
MERS-related CoV | 7.5 | − |
Genotype (L Segment) | Strain | LAMP Method | Viral Titer (FFU/mL) | |||
---|---|---|---|---|---|---|
1000 | 100 | 10 | 1 | |||
J1 | SPL010 | Standard | +/+/+ | +/+/− | −/−/− | −/−/− |
Simplified | +/+/+ | +/−/− | −/−/− | −/−/− | ||
J2 | SPL100 | Standard | +/+/+ | +/+/+ | +/−/− | −/−/− |
Simplified | +/+/+ | −/−/− | −/−/− | −/−/− | ||
J3 | SPL230 | Standard | +/+/+ | +/+/+ | +/−/− | −/−/− |
Simplified | +/+/+ | +/+/+ | −/−/− | −/−/− | ||
C5 | SPL238 | Standard | +/+/+ | +/+/+ | +/−/− | −/−/− |
Simplified | +/+/+ | +/−/− | −/−/− | −/−/− |
qRT-PCR | ||||
Positive (n = 53) | Negative (n = 19) | |||
LAMP method | Standard | Positive | 49 | 2 * |
Negative | 4 | 17 | ||
Simplified | Positive | 45 | 2 * | |
Negative | 8 | 17 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sano, S.; Fukushi, S.; Yamada, S.; Harada, S.; Kinoshita, H.; Sugimoto, S.; Yoshikawa, T.; Kurosu, T.; Takamatsu, Y.; Shimojima, M.; et al. Development of an RT-LAMP Assay for the Rapid Detection of SFTS Virus. Viruses 2021, 13, 693. https://doi.org/10.3390/v13040693
Sano S, Fukushi S, Yamada S, Harada S, Kinoshita H, Sugimoto S, Yoshikawa T, Kurosu T, Takamatsu Y, Shimojima M, et al. Development of an RT-LAMP Assay for the Rapid Detection of SFTS Virus. Viruses. 2021; 13(4):693. https://doi.org/10.3390/v13040693
Chicago/Turabian StyleSano, Shiori, Shuetsu Fukushi, Souichi Yamada, Shizuko Harada, Hitomi Kinoshita, Satoko Sugimoto, Tomoki Yoshikawa, Takeshi Kurosu, Yuki Takamatsu, Masayuki Shimojima, and et al. 2021. "Development of an RT-LAMP Assay for the Rapid Detection of SFTS Virus" Viruses 13, no. 4: 693. https://doi.org/10.3390/v13040693