The 40 kDa Linear Polyethylenimine Inhibits Porcine Reproductive and Respiratory Syndrome Virus Infection by Blocking Its Attachment to Permissive Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cells, Viruses, and Chemicals
2.2. Cell Viability and Cytotoxicity
2.3. PRRSV Inhibition Assay
2.4. Immunofluorescence Assay (IFA)
2.5. Reverse Transcription and Quantitative PCR (RT-qPCR)
2.6. Western Blot Analysis
2.7. Analysis of Virus Attachment and Internalization
2.8. Statistical Analysis
3. Result
3.1. Evaluation of Cytotoxicity of Polyethylenimine in MARC-145 and PAM Cells
3.2. The 40 KDa Linear PEI Effectively Inhibits PRRSV Replication in MARC-145 Cells
3.3. The PEI-linear Demonstrates Broad inhibition of Heterogeneous PRRSV-2 Isolates
3.4. The PEI-Linear Blocks PRRSV Replication in PAMs
3.5. The PEI-Linear Blocks the Attachment of PRRSV Virions but Not Internalization in MARC-145 Cells
3.6. The 40 kDa Linear PEI Blocks the Attachment of PRRSV Virions to PAMs via Acting on the Virus but Not Cells
4. Discussion
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Kuhn, J.H.; Lauck, M.; Bailey, A.L.; Shchetinin, A.M.; Vishnevskaya, T.V.; Bao, Y.; Ng, T.F.; LeBreton, M.; Schneider, B.S.; Gillis, A.; et al. Reorganization and expansion of the nidoviral family Arteriviridae. Arch. Virol. 2016, 161, 755–768. [Google Scholar] [CrossRef] [PubMed]
- Adams, M.J.; Lefkowitz, E.J.; King, A.M.; Harrach, B.; Harrison, R.L.; Knowles, N.J.; Kropinski, A.M.; Krupovic, M.; Kuhn, J.H.; Mushegian, A.R.; et al. Ratification vote on taxonomic proposals to the International Committee on Taxonomy of Viruses (2016). Arch. Virol. 2016, 161, 2921–2949. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lunney, J.K.; Fang, Y.; Ladinig, A.; Chen, N.; Li, Y.; Rowland, B.; Renukaradhya, G.J. Porcine Reproductive and Respiratory Syndrome Virus (PRRSV): Pathogenesis and Interaction with the Immune System. Annu. Rev. Anim. Biosci. 2016, 4, 129–154. [Google Scholar] [CrossRef] [PubMed]
- Forsberg, R. Divergence time of porcine reproductive and respiratory syndrome virus subtypes. Mol. Biol. Evol. 2005, 22, 2131–2134. [Google Scholar] [CrossRef]
- Van Woensel, P.A.; Liefkens, K.; Demaret, S. Effect on viraemia of an American and a European serotype PRRSV vaccine after challenge with European wild-type strains of the virus. Vet. Rec. 1998, 142, 510–512. [Google Scholar] [CrossRef] [PubMed]
- Morgan, S.B.; Frossard, J.P.; Pallares, F.J.; Gough, J.; Stadejek, T.; Graham, S.P.; Steinbach, F.; Drew, T.W.; Salguero, F.J. Pathology and Virus Distribution in the Lung and Lymphoid Tissues of Pigs Experimentally Inoculated with Three Distinct Type 1 PRRS Virus Isolates of Varying Pathogenicity. Transbound. Emerg. Dis. 2016, 63, 285–295. [Google Scholar] [CrossRef] [PubMed]
- Albina, E.; Carrat, C.; Charley, B. Interferon-alpha response to swine arterivirus (PoAV), the porcine reproductive and respiratory syndrome virus. J. Interferon Cytokine Res. 1998, 18, 485–490. [Google Scholar] [CrossRef]
- Shi, C.; Liu, Y.; Ding, Y.; Zhang, Y.; Zhang, J. PRRSV receptors and their roles in virus infection. Arch. Microbiol. 2015, 197, 503–512. [Google Scholar] [CrossRef]
- Delputte, P.L.; Vanderheijden, N.; Nauwynck, H.J.; Pensaert, M.B. Involvement of the matrix protein in attachment of porcine reproductive and respiratory syndrome virus to a heparinlike receptor on porcine alveolar macrophages. J. Virol. 2002, 76, 4312–4320. [Google Scholar] [CrossRef]
- Kim, J.K.; Fahad, A.M.; Shanmukhappa, K.; Kapil, S. Defining the cellular target(s) of porcine reproductive and respiratory syndrome virus blocking monoclonal antibody 7G10. J. Virol. 2006, 80, 689–696. [Google Scholar] [CrossRef]
- Wu, J.; Peng, X.; Zhou, A.; Qiao, M.; Wu, H.; Xiao, H.; Liu, G.; Zheng, X.; Zhang, S.; Mei, S. MiR-506 inhibits PRRSV replication in MARC-145 cells via CD151. Mol. Cell. Biochem. 2014, 394, 275–281. [Google Scholar] [CrossRef]
- Guo, L.; Niu, J.; Yu, H.; Gu, W.; Li, R.; Luo, X.; Huang, M.; Tian, Z.; Feng, L.; Wang, Y. Modulation of CD163 expression by metalloprotease ADAM17 regulates porcine reproductive and respiratory syndrome virus entry. J. Virol. 2014, 88, 10448–10458. [Google Scholar] [CrossRef] [PubMed]
- Delputte, P.L.; van Breedam, W.; Delrue, I.; Oetke, C.; Crocker, P.R.; Nauwynck, H.J. Porcine arterivirus attachment to the macrophage-specific receptor sialoadhesin is dependent on the sialic acid-binding activity of the N-terminal immunoglobulin domain of sialoadhesin. J. Virol. 2007, 81, 9546–9550. [Google Scholar] [CrossRef] [PubMed]
- Pineyro, P.E.; Subramaniam, S.; Kenney, S.P.; Heffron, C.L.; Gimenez-Lirola, L.G.; Meng, X.J. Modulation of Proinflammatory Cytokines in Monocyte-Derived Dendritic Cells by Porcine Reproductive and Respiratory Syndrome Virus Through Interaction with the Porcine Intercellular-Adhesion-Molecule-3-Grabbing Nonintegrin. Viral Immunol. 2016, 29, 546–556. [Google Scholar] [CrossRef] [PubMed]
- Gao, J.; Xiao, S.; Xiao, Y.; Wang, X.; Zhang, C.; Zhao, Q.; Nan, Y.; Huang, B.; Liu, H.; Liu, N.; et al. MYH9 is an Essential Factor for Porcine Reproductive and Respiratory Syndrome Virus Infection. Sci. Rep. 2016, 6, 25120. [Google Scholar] [CrossRef] [PubMed]
- Burkard, C.; Lillico, S.G.; Reid, E.; Jackson, B.; Mileham, A.J.; Ait-Ali, T.; Whitelaw, C.B.; Archibald, A.L. Precision engineering for PRRSV resistance in pigs: Macrophages from genome edited pigs lacking CD163 SRCR5 domain are fully resistant to both PRRSV genotypes while maintaining biological function. PLoS Pathog. 2017, 13, e1006206. [Google Scholar] [CrossRef] [PubMed]
- Rowland, R.R.; Lunney, J.; Dekkers, J. Control of porcine reproductive and respiratory syndrome (PRRS) through genetic improvements in disease resistance and tolerance. Front. Genet. 2012, 3, 260. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tian, K.; Yu, X.; Zhao, T.; Feng, Y.; Cao, Z.; Wang, C.; Hu, Y.; Chen, X.; Hu, D.; Tian, X.; et al. Emergence of fatal PRRSV variants: Unparalleled outbreaks of atypical PRRS in China and molecular dissection of the unique hallmark. PLoS ONE 2007, 2, e526. [Google Scholar] [CrossRef] [PubMed]
- Butler, J.E.; Lager, K.M.; Golde, W.; Faaberg, K.S.; Sinkora, M.; Loving, C.; Zhang, Y.I. Porcine reproductive and respiratory syndrome (PRRS): An immune dysregulatory pandemic. Immunol. Res. 2014, 59, 81–108. [Google Scholar] [CrossRef]
- Zhang, C.; Ji, J.; Shi, X.; Zheng, X.; Wang, X.; Feng, F. Synthesis of Structurally Defined Cationic Polythiophenes for DNA Binding and Gene Delivery. ACS Appl. Mater. Interfaces 2018, 10, 4519–4529. [Google Scholar] [CrossRef]
- Zhao, L.; Li, Y.; Pei, D.; Huang, Q.; Zhang, H.; Yang, Z.; Li, F.; Shi, T. Glycopolymers/PEI complexes as serum-tolerant vectors for enhanced gene delivery to hepatocytes. Carbohydr. Polym. 2019, 205, 167–175. [Google Scholar] [CrossRef] [PubMed]
- Park, D.; Wang, J.; Klibanov, A.M. One-step, painting-like coating procedures to make surfaces highly and permanently bactericidal. Biotechnol. Prog. 2006, 22, 584–589. [Google Scholar] [CrossRef] [PubMed]
- Santos, M.R.E.; Mendonca, P.V.; Almeida, M.C.; Branco, R.; Serra, A.C.; Morais, P.V.; Coelho, J.F.J. Increasing the Antimicrobial Activity of Amphiphilic Cationic Copolymers by the Facile Synthesis of High Molecular Weight Stars by Supplemental Activator and Reducing Agent Atom Transfer Radical Polymerization. Biomacromolecules 2019, 20, 1146–1156. [Google Scholar] [CrossRef] [PubMed]
- Haldar, J.; Chen, J.; Tumpey, T.M.; Gubareva, L.V.; Klibanov, A.M. Hydrophobic polycationic coatings inactivate wild-type and zanamivir- and/or oseltamivir-resistant human and avian influenza viruses. Biotechnol. Lett. 2008, 30, 475–479. [Google Scholar] [CrossRef] [PubMed]
- Larson, A.M.; Oh, H.S.; Knipe, D.M.; Klibanov, A.M. Decreasing herpes simplex viral infectivity in solution by surface-immobilized and suspended N,N-dodecyl,methyl-polyethylenimine. Pharm. Res. 2013, 30, 25–31. [Google Scholar] [CrossRef]
- Spoden, G.A.; Besold, K.; Krauter, S.; Plachter, B.; Hanik, N.; Kilbinger, A.F.; Lambert, C.; Florin, L. Polyethylenimine is a strong inhibitor of human papillomavirus and cytomegalovirus infection. Antimicrob. Agents Chemother. 2012, 56, 75–82. [Google Scholar] [CrossRef] [PubMed]
- Owada, T.; Miyashita, Y.; Motomura, T.; Onishi, M.; Yamashita, S.; Yamamoto, N. Enhancement of human immunodeficiency virus type 1 (HIV-1) infection via increased membrane fluidity by a cationic polymer. Microbiol. Immunol. 1998, 42, 97–107. [Google Scholar] [CrossRef] [PubMed]
- Xiao, S.; Zhang, A.; Zhang, C.; Ni, H.; Gao, J.; Wang, C.; Zhao, Q.; Wang, X.; Ma, C.; Liu, H.; et al. Heme oxygenase-1 acts as an antiviral factor for porcine reproductive and respiratory syndrome virus infection and over-expression inhibits virus replication in vitro. Antivir. Res. 2014, 110C, 60–69. [Google Scholar] [CrossRef]
- Zhang, Y.J.; Stein, D.A.; Fan, S.M.; Wang, K.Y.; Kroeker, A.D.; Meng, X.J.; Iversen, P.L.; Matson, D.O. Suppression of porcine reproductive and respiratory syndrome virus replication by morpholino antisense oligomers. Vet. Microbiol. 2006, 117, 117–129. [Google Scholar] [CrossRef]
- Li, Q.; Wang, X.; Wang, C.; Yu, Y.; Wang, G.; Gao, J.; Liu, H.; Xie, H.; Huang, B.; Li, Z.; et al. Intracellular expression of an anti-idiotypic antibody single-chain variable fragment reduces porcine reproductive and respiratory syndrome virus infection in MARC-145 cells. Antivir. Ther. 2016, 21, 161–170. [Google Scholar] [CrossRef]
- Mu, Y.; Li, L.; Zhang, B.; Huang, B.; Gao, J.; Wang, X.; Wang, C.; Xiao, S.; Zhao, Q.; Sun, Y.; et al. Glycoprotein 5 of porcine reproductive and respiratory syndrome virus strain SD16 inhibits viral replication and causes G2/M cell cycle arrest, but does not induce cellular apoptosis in Marc-145 cells. Virology 2015, 484, 136–145. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nauwynck, H.J.; Duan, X.; Favoreel, H.W.; van Oostveldt, P.; Pensaert, M.B. Entry of porcine reproductive and respiratory syndrome virus into porcine alveolar macrophages via receptor-mediated endocytosis. J. Gen. Virol. 1999, 80, 297–305. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Li, J.; Wang, N.; Wu, C. Northwest A&F University, Yangling, Shannxi, China. Material and Methods used in the same way as Section 2.7 of this manuscript, 2019, (Material not intended for publication).
- Yemul, O.; Imae, T. Synthesis and characterization of poly(ethyleneimine) dendrimers. Colloid Polym. Sci. 2008, 286, 747–752. [Google Scholar] [CrossRef]
- Longo, P.A.; Kavran, J.M.; Kim, M.S.; Leahy, D.J. Transient mammalian cell transfection with polyethylenimine (PEI). Methods Enzym. 2013, 529, 227–240. [Google Scholar]
- He, B.; Fu, Y.; Xia, S.; Yu, F.; Wang, Q.; Lu, L.; Jiang, S. Intranasal application of polyethyleneimine suppresses influenza virus infection in mice. Emerg. Microbes Infect. 2016, 5, e41. [Google Scholar] [CrossRef] [PubMed]
- Maitani, Y.; Ishigaki, K.; Nakazawa, Y.; Aragane, D.; Akimoto, T.; Iwamizu, M.; Kai, T.; Hayashi, K. Polyethylenimine combined with liposomes and with decreased numbers of primary amine residues strongly enhanced therapeutic antiviral efficiency against herpes simplex virus type 2 in a mouse model. J. Control. Release 2013, 166, 139–146. [Google Scholar] [CrossRef]
- Rudolph, C.; Lausier, J.; Naundorf, S.; Muller, R.H.; Rosenecker, J. In vivo gene delivery to the lung using polyethylenimine and fractured polyamidoamine dendrimers. J. Gene Med. 2000, 2, 269–278. [Google Scholar] [CrossRef]
- Akinc, A.; Thomas, M.; Klibanov, A.M.; Langer, R. Exploring polyethylenimine-mediated DNA transfection and the proton sponge hypothesis. J. Gene Med. 2005, 7, 657–663. [Google Scholar] [CrossRef]
- Wang, T.; Fang, L.; Zhao, F.; Wang, D.; Xiao, S. Exosomes Mediate Intercellular Transmission of Porcine Reproductive and Respiratory Syndrome Virus. J. Virol. 2018, 92. [Google Scholar] [CrossRef]
- Vanderheijden, N.; Delputte, P.L.; Favoreel, H.W.; Vandekerckhove, J.; van Damme, J.; van Woensel, P.A.; Nauwynck, H.J. Involvement of sialoadhesin in entry of porcine reproductive and respiratory syndrome virus into porcine alveolar macrophages. J. Virol. 2003, 77, 8207–8215. [Google Scholar] [CrossRef]
- Moghimi, S.M.; Symonds, P.; Murray, J.C.; Hunter, A.C.; Debska, G.; Szewczyk, A. A two-stage poly(ethylenimine)-mediated cytotoxicity: Implications for gene transfer/therapy. Mol. Ther. 2015, 11, 990–995. [Google Scholar] [CrossRef] [PubMed]
- Wells, K.D.; Bardot, R.; Whitworth, K.M.; Trible, B.R.; Fang, Y.; Mileham, A.; Kerrigan, M.A.; Samuel, M.S.; Prather, R.S.; Rowland, R.R. Replacement of Porcine CD163 Scavenger Receptor Cysteine-Rich Domain 5 with a CD163-Like Homolog Confers Resistance of Pigs to Genotype 1 but Not Genotype 2 Porcine Reproductive and Respiratory Syndrome Virus. J. Virol. 2017, 91, e01521-16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene | Forward Primer (5′–3′) | Reverse Primer (5′–3′) |
---|---|---|
PRRSV-M | TGGGGAGTGTACTCAGCCAT | AATGTACTTGCGGCCTAGCA |
β-actin | GGCATCCACGAAACTACCTT | TGATCTCCTTCTGCATCCTG |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, J.; Li, J.; Wang, N.; Ji, Q.; Li, M.; Nan, Y.; Zhou, E.-M.; Zhang, Y.; Wu, C. The 40 kDa Linear Polyethylenimine Inhibits Porcine Reproductive and Respiratory Syndrome Virus Infection by Blocking Its Attachment to Permissive Cells. Viruses 2019, 11, 876. https://doi.org/10.3390/v11090876
Wang J, Li J, Wang N, Ji Q, Li M, Nan Y, Zhou E-M, Zhang Y, Wu C. The 40 kDa Linear Polyethylenimine Inhibits Porcine Reproductive and Respiratory Syndrome Virus Infection by Blocking Its Attachment to Permissive Cells. Viruses. 2019; 11(9):876. https://doi.org/10.3390/v11090876
Chicago/Turabian StyleWang, Jie, Jie Li, Nana Wang, Qi Ji, Mingshuo Li, Yuchen Nan, En-Min Zhou, Yanjin Zhang, and Chunyan Wu. 2019. "The 40 kDa Linear Polyethylenimine Inhibits Porcine Reproductive and Respiratory Syndrome Virus Infection by Blocking Its Attachment to Permissive Cells" Viruses 11, no. 9: 876. https://doi.org/10.3390/v11090876
APA StyleWang, J., Li, J., Wang, N., Ji, Q., Li, M., Nan, Y., Zhou, E.-M., Zhang, Y., & Wu, C. (2019). The 40 kDa Linear Polyethylenimine Inhibits Porcine Reproductive and Respiratory Syndrome Virus Infection by Blocking Its Attachment to Permissive Cells. Viruses, 11(9), 876. https://doi.org/10.3390/v11090876