Antibiotic Susceptibility, Genetic Diversity, and the Presence of Toxin Producing Genes in Campylobacter Isolates from Poultry
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Campylobacter Isolation, Enumeration, and Identification
2.3. Antibiotic Susceptibility Testing
2.4. Analysis of Genetic Diversity
2.5. Analysis of Cytolethal Distending Toxin Genes
2.6. Statistical Analysis
3. Results and Discussion
3.1. Prevalence and Contamination Levels of Campylobacter
3.2. Antimicrobial Resistance Patterns
3.3. Genetic Diversity between Isolates
3.4. Distribution of cdtA, cdtB, and cdtC
4. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Han, K.; Jang, S.S.; Choo, E.; Heu, S.; Ryu, S. Prevalence, genetic diversity, and antibiotic resistance patterns of Campylobacter jejuni form retail raw chickens in Korea. Int. J. Food Microbiol. 2007, 114, 50–59. [Google Scholar] [CrossRef] [PubMed]
- Miflin, J.K.; Templeton, J.M.; Blackall, P.J. Antibiotic resistance in Campylobacter jejuni and Campylobacter coli isolated from poultry in the South-East Queensland region. J. Antimicrob. Chemother. 2007, 59, 775–778. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Qin, S.-S.; Wu, C.-M.; Wang, Y.; Jeon, B.; Shen, Z.-Q.; Wang, Y.; Zhang, Q.; Shen, J.-Z. Antimicrobial resistance in Campylobacter coli isolated from pigs in two provinces of China. Int. J. Food Microbiol. 2011, 146, 94–98. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, H.; Yamamoto, S. Campylobacter contamination in retail poultry meats and by-products in the world: A literature survey. J. Vet. Med. Sci. 2009, 71, 255–261. [Google Scholar] [CrossRef] [PubMed]
- Findik, A.; Ica, T.; Onuk, E.E.; Percin, D.; Kevenk, T.O.; Ciftci, A. Molecular typing and cdt genes prevalence of Campylobacter jejuni isolates from various sources. Trop. Anim. Health Prod. 2011, 43, 711–719. [Google Scholar] [CrossRef] [PubMed]
- Moore, J.E.; Corcoran, D.; Dooley, J.S.F.; Fanning, S.; Lucey, B.; Matsuda, M.; McDowell, D.A.; Mégraud, F.; Millar, B.C.; O’Mahony, R.; et al. Campylobacter. Vet. Res. 2005, 36, 351–382. [Google Scholar] [CrossRef] [PubMed]
- On, S.L. Taxonomy of Campylobacter, Arcobacter, Helicobacter and related bacteria: Current status, future prospects and immediate concerns. J. Appl. Microbiol. 2001, 90, 1S–15S. [Google Scholar] [CrossRef]
- Refregier-Petton, J.; Rose, N.; Denis, M.; Salvat, G. Risk factors for Campylobacter spp. contamination in French broiler-chicken flocks at the end of the rearing period. Prev. Vet. Med. 2001, 50, 89–100. [Google Scholar] [CrossRef]
- Skarp, C.P.A.; Hänninen, M.L.; Rautelin, H.I.K. Campylobacteriosis: The role of poultry meat. Clin. Microbiol. Inf. 2016, 22, 103–109. [Google Scholar] [CrossRef] [PubMed]
- Facciolà, A.; Riso, R.; Avventuroso, E.; Visalli, G.; Delia, S.A.; Laganà, P. Campylobacter: From microbiology to prevention. J. Prev. Med. Hyg. 2017, 58, E79–E92. [Google Scholar] [PubMed]
- Ministry of Food and Drug Safety. Statistics of Foodborne Illness. Available online: http://www.foodsafetykorea.go.kr/portal/healthyfoodlife/foodPoisoningStat.do?menu_no=519&menu_grp=MENU_GRP02 (accessed on 17 October 2017).
- Schmutz, C.; Mäusezahl, D.; Bless, P.J.; Hatz, C.; Schwenkglenks, M.; Urbinello, D. Estimating healthcare costs of acute gastroenteritis and human campylobacteriosis in Switzerland. Epidemiol. Infect. 2017, 145, 627–641. [Google Scholar] [CrossRef] [PubMed]
- Zilbauer, M.; Dorrell, N.; Wren, B.W.; Bajaj-Elliott, M. Campylobacter jejuni-mediated disease pathogenesis: An update. Trans. R. Soc. Trop. Med. Hyg. 2008, 102, 123–129. [Google Scholar] [CrossRef] [PubMed]
- Asakura, M.; Samosornsuk, W.; Hinenoya, A.; Misawa, N.; Nishimura, K.; Matsuhisa, A.; Yamasaki, S. Development of a cytolethal distending toxin (cdt) gene-based species-specific multiplex PCR assay for the detection and identification of Campylobacter jejuni, Campylobacter coli and Campylobacter fetus. FEMS Immunol. Med. Microbiol. 2008, 52, 260–266. [Google Scholar] [CrossRef] [PubMed]
- Bolton, D.J. Campylobacter virulence and survival factors. Food Microbiol. 2015, 48, 99–108. [Google Scholar] [CrossRef] [PubMed]
- Yamasaki, S.; Asakura, M.; Tsukamoto, T.; Faruque, S.M.; Deb, R.; Ramamurthy, T. Cytolethal distending toxin (CDT): Genetic diversity, structure and role in diarrheal disease. Toxin Rev. 2006, 25, 61–88. [Google Scholar] [CrossRef]
- Weis, A.M.; Miller, W.A.; Byrne, B.A.; Chouicha, N.; Boyce, W.M.; Townsend, A.K. Prevalence and pathogenic potential of Campylobacter isolates from free-living, human-commensal American crows. Appl. Environ. Microbiol. 2014, 80, 1639–1644. [Google Scholar] [CrossRef] [PubMed]
- Ge, B.; White, D.G.; McDermott, P.F.; Girard, W.; Zhao, S.; Hubert, S.; Meng, J. Antimicrobial-resistant Campylobacter species from retail raw meats. Appl. Environ. Microbiol. 2003, 69, 3005–3007. [Google Scholar] [CrossRef] [PubMed]
- Gibreel, A.; Tracz, D.M.; Nonaka, L.; Ngo, T.M.; Connell, S.R.; Taylor, D.E. Incidence of antibiotic resistance in Campylobacter jejuni isolated in Alberta, Canada, from 1999 to 2002, with special reference to tet(O)-mediated tetracycline resistance. Antimicrob. Agents Chemother. 2004, 48, 3442–3450. [Google Scholar] [CrossRef] [PubMed]
- Zhong, X.; Wu, Q.; Zhang, J.; Shen, S. Prevalence, genetic diversity and antimicrobial susceptibility of Campylobacter jejuni isolated from retail food in China. Food Control 2016, 62, 10–15. [Google Scholar] [CrossRef]
- Foley, S.L.; Lynne, A.M.; Nayak, R. Molecular typing methodologies for microbial source tracking and epidemiological investigations of Gram-negative bacterial foodborne pathogens. Infect. Genet. Evol. 2009, 9, 430–440. [Google Scholar] [CrossRef] [PubMed]
- Behringer, M.; Miller, W.G.; Oyarzabal, O.A. Typing of Campylobacter jejuni and Campylobacter coli isolated from live broilers and retail broiler meat by flaA-RFLP, MLST, PFGE and REP-PCR. J. Microbiol. Meth. 2011, 84, 194–201. [Google Scholar] [CrossRef] [PubMed]
- Hulton, C.S.J.; Higgins, C.F.; Sharp, P.M. ERIC sequences, a novel family of repetitive elements in the genome of Escherichia coli, Salmonella typhimurium and other enterobacterial. Mol. Microbiol. 1991, 5, 825–834. [Google Scholar] [CrossRef] [PubMed]
- Appuhamy, S.; Parton, R.; Coote, J.G.; Gibbs, H.A. Genomic fingerprinting of Haemophilus somnus by a combination of PCR methods. J. Clin. Microbiol. 1997, 35, 288–291. [Google Scholar] [PubMed]
- Abay, S.; Kayman, T.; Otlu, B.; Hizlisoy, H.; Aydin, F.; Ertas, N. Genetic diversity and antibiotic resistance profiles of Campylobacter jejuni isolates from poultry and humans in Turkey. Int. J. Food Microbiol. 2014, 178, 29–38. [Google Scholar] [CrossRef] [PubMed]
- Yamazaki-Matsune, W.; Taguchi, M.; Seto, K.; Kawahara, R.; Kawatsu, K.; Kumeda, Y.; Kitazato, M.; Nukina, M.; Misawa, N.; Tsukamoto, T. Development of a multiplex PCR assay for identification of Campylobacter coli, Campylobacter fetus, Campylobacter hyointestinalis subsp. hyointestinalis, Campylobacter jejuni, Campylobacter lari and Campylobacter upsaliensis. J. Med. Microbiol. 2007, 56, 1467–1473. [Google Scholar] [CrossRef] [PubMed]
- Linton, D.; Owen, R.J.; Stanley, J. Rapid identification by PCR of the genus Campylobacter and five Campylobacter species enteropathogenic for man and animals. Res. Microbiol. 1996, 147, 707–718. [Google Scholar] [CrossRef]
- Wang, R.F.; Salvic, M.F.; Cao, W.W. A rapid PCR method for direct detection of low numbers of Campylobacter jejuni. J. Rapid Methods Autom. Microbiol. 1992, 1, 101–108. [Google Scholar] [CrossRef]
- Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing; 20th Informational Supplement; M100-S20; CLSI: Pennsylvania, PA, USA, 2010. [Google Scholar]
- Centers for Disease Control and Prevention. National Antimicrobial Resistance Monitoring System for Enteric Bacteria (NARMS): 2005 Human Isolates Final Report; Department of Health and Human Services, CDC: Atlanta, GA, USA, 2008.
- Hong, J.; Kim, J.M.; Jung, W.K.; Kim, S.H.; Bae, W.; Koo, H.C.; Gil, J.; Kim, M.; Ser, J.; Park, Y.H. Prevalence and antibiotic resistance of Campylobacter spp. isolated from chicken meat, pork, and beef in Korea, from 2001 to 2006. J. Food Prot. 2007, 70, 860–866. [Google Scholar] [CrossRef] [PubMed]
- Kang, Y.S.; Cho, Y.S.; Yoon, S.K.; Yu, M.A.; Kim, C.M.; Lee, J.O.; Pyun, Y.R. Prevalence and antimicrobial resistance of Campylobacter jejuni and Campylobacter coli isolated from raw chicken meat and human stools in Korea. J. Food Prot. 2006, 69, 2915–2923. [Google Scholar] [CrossRef] [PubMed]
- Herbold, N.M.; Clotilde, L.M.; Anderson, K.M.; Kase, J.; Hartman, G.L.; Himathongkham, S.; Lin, A.; Lauzon, C.R. Clustering of clinical and environmental Escherichia coli O104 isolates using the DiversiLab™ repetitive sequence-based PCR system. Curr. Microbiol. 2015, 70, 436–440. [Google Scholar] [CrossRef] [PubMed]
- Ross, T.L.; Merz, W.G.; Farkosh, M.; Carroll, K.C. Comparison of an automated repetitive sequence-based PCR microbial typing system to pulsed-field gel electrophoresis for analysis of outbreaks of Methicillin-resistant Staphylococcus aureus. J. Clin. Microbiol. 2005, 43, 5642–5647. [Google Scholar] [CrossRef] [PubMed]
- Hue, O.; Le Bouquin, S.; Laisney, M.J.; Allain, V.; Lalande, F.; Petetin, I.; Rouxel, S.; Quesne, S.; Gloaguen, P.Y.; Picherot, M.; et al. Prevalence of and risk factors for Campylobacter spp. contamination of broiler chicken carcasses at the slaughterhouse. Food Microbiol. 2010, 27, 992–999. [Google Scholar] [CrossRef] [PubMed]
- Garin, B.; Gouali, M.; Wouafo, M.; Perchec, A.M.; Thu, P.M.; Ravaonindrina, N.; Urbès, F.; Gay, M.; Diawara, A.; Leclercp, A.; et al. Prevalence, quantification and antimicrobial resistance of Campylobacter spp. on chicken neck-skins at points of slaughter in 5 major cities located on 4 continents. Int. J. Food Microbiol. 2012, 157, 102–107. [Google Scholar] [CrossRef] [PubMed]
- Zhu, J.; Yao, B.; Song, X.; Wang, Y.; Cui, S.; Xu, H.; Yang, B.; Huang, J.; Liu, G.; Yang, X.; et al. Prevalence and quantification of Campylobacter contamination on raw chicken carcasses for retail sale in China. Food Control 2017, 75, 196–202. [Google Scholar] [CrossRef]
- Di Giannatale, E.; Di Serafino, G.; Zilli, K.; Alessiani, A.; Sacchini, L.; Garofolo, G.; Aprea, G.; Marotta, F. Characterization of antimicrobial resistance patterns and detection of virulence genes in Campylobacter isolates in Italy. Sensors 2014, 14, 3308–3322. [Google Scholar] [CrossRef] [PubMed]
- Son, I.; Englen, M.D.; Berrang, M.E.; Fedorka-Cray, P.J.; Harrison, M.A. Antimicrobial resistance of Arcobacter and Campylobacter from broiler carcasses. Int. J. Antimicrob. Agents 2007, 29, 451–455. [Google Scholar] [CrossRef] [PubMed]
- Raeisi, M.; Khoshbakht, R.; Ghaemi, E.A.; Bayani, M.; Hashemi, M.; Seyedghasemi, N.S.; Shirzad-Aski, H. Antimicrobial resistance and virulence-associated genes of Campylobacter spp. isolated from raw milk, fish, poultry, and red meat. Microb. Drug Resist. 2017, 23, 925–933. [Google Scholar] [CrossRef] [PubMed]
- Ma, H.; Su, Y.; Ma, L.; Ma, L.; Li, P.; Du, X.; Gölz, G.; Wang, S.; Lu, X. Prevalence and characterization of Campylobacter jejuni isolated from retail chicken in Tianjin, China. J. Food Prot. 2017, 80, 1032–1040. [Google Scholar] [CrossRef] [PubMed]
- Szczepanska, B.; Andrzejewska, M.; Spica, D.; Klawe, J.J. Prevalence and antimicrobial resistance of Campylobacter jejuni and Campylobacter coli isolated from children and environmental sources in urban and suburban areas. BMC Microbiol. 2017, 17, 80. [Google Scholar] [CrossRef] [PubMed]
- Hiett, K.L.; Seal, B.S.; Siragusa, G.R. Campylobacter spp. subtype analysis using gel-based repetitive extragenic palindromic-PCR discriminates in parallel fashion to fla A short variable region DNA sequence analysis. J. Appl. Microbiol. 2006, 101, 1249–1258. [Google Scholar] [CrossRef] [PubMed]
- Mortensen, N.P.; Schiellerup, P.; Boisen, N.; Klein, B.M.; Locht, H.; Abuoun, M.; Newell, D.; Krogfelt, K.A. The role of Campylobacter jejuni cytolethal distending toxin in gastroenteritis: Toxin detection, antibody production, and clinical outcome. APMIS 2011, 119, 626–634. [Google Scholar] [CrossRef] [PubMed]
- Oh, J.Y.; Kwon, Y.K.; Wei, B.; Jang, H.K.; Lim, S.K.; Kim, C.H.; Jung, S.C.; Kang, M.S. Epidemiological relationships of Campylobacter jejuni strains isolated from humans and chickens in South Korea. J. Microbiol. 2017, 55, 13–20. [Google Scholar] [CrossRef] [PubMed]
- Carvalho, A.F.D.; Silva, D.M.D.; Azevedo, S.S.; Piatti, R.M.; Genovez, M.E.; Scarcelli, E. Detection of CDT toxin genes in Campylobacter spp. strains isolated from broiler carcasses and vegetables in São Paulo, Brazil. Braz. J. Microbiol. 2013, 44, 693–699. [Google Scholar] [CrossRef] [PubMed]
Species | Target Gene | Primer | Sequence (5’→3’) | Size (bp) | Reference |
---|---|---|---|---|---|
Genus Campylobacter | 16S rRNA | C412F | GGATGACACTTTTCGGAGC | 816 | [27] |
C1228R | CATTGTAGCACGTGTGTC | ||||
Campylobacter jejuni | cj0414 | C-1 | CAAATAAAGTTAGAGGTAGAATGT | 161 | [28] |
C-3 | CCATAAGCACTAGCTAGCTGAT | ||||
Campylobacter coli | ask | CC18F | GGTATGATTTCTACAAAGCGAG | 502 | [27] |
CC519R | ATAAAAGACTATCGTCGCGTG |
Genus | Gene | Sequence (5’→3’) | Amplification (1) Condition | Size (bp) |
---|---|---|---|---|
Campylobacter jejuni | cdtA | F: AGGACTTGAACCTACTTTTC | 94 °C, 30 s −55 °C, 30 s −72 °C, 30 s | 631 |
R: AGGTGGAGTAGTTAAAAACC | ||||
cdtB | F: ATCTTTTAACCTTGCTTTTGC | 94 °C, 30 s −56 °C, 30 s −72 °C, 30 s | 714 | |
R: GCAAGCATTAAAATCGCAGC | ||||
cdtC | F: TTTAGCCTTTGCAACTCCTA | 94 °C, 30 s −55 °C, 30 s −72 °C, 30 s | 524 | |
R: AAGGGGTAGCAGCTGTTAA | ||||
Campylobacter coli | cdtA | F: ATTGCCAAGGCTAAAATCTC | 94 °C, 30 s −55 °C, 30 s −72 °C, 30 s | 329 |
R: GATAAAGTCTCCAAAACTGC | ||||
cdtB | F: TTTAATGTATTATTTGCCGC | 94 °C, 30 s −56 °C, 30 s −72 °C, 30 s | 413 | |
R: TCATTGCCTATGCGTATG | ||||
cdtC | F: TAGGGATATGCACGCAAAAG | 94 °C, 30 s −55 °C, 30 s −72 °C, 30 s | 313 | |
R: GCTTAATACAGTTACGATAG |
Seasons | Sample | Prevalence (No. of Positive Samples/No. of Samples (%)) | Contamination Level | |
---|---|---|---|---|
No. of Positive Samples/No. of Samples (%) | Mean ± SD (CFU/g) | |||
Summer | Chicken | 7/80 (8.8) | 3/80 (3.8) | 32.1 ± 21.0 |
Duck | 15/80 (18.8) | 7/80 (8.8) | 15.7 ± 14.2 | |
Subtotal | 22/160 (13.8) | 10/160 (6.3) | 20.6 ± 17.2 | |
Winter | Chicken | 8/72 (11.1) | 19/72 (26.4) | 20.4 ± 38.8 |
Duck | 15/74 (20.3) | 38/74 (51.4) | 427.4 ± 780.2 | |
Subtotal | 23/146 (15.8) | 57/146 (39.0) | 301.1 ± 673.1 | |
Total | Chicken | 15/152 (9.9) A | 22/152 (14.5) | 22.0 ± 36.6 b |
Duck | 30/154 (19.5) A | 45/154 (29.2) | 366.1 ± 733.6 a | |
Total | 45/306 (14.7) | 67/306 (21.9) | 259.8 ± 628.9 |
Class | Antibiotics | Susceptibility | Resistance | ||
---|---|---|---|---|---|
No. of Isolates | Ratio (%) | No. of Isolates | Ratio (%) | ||
A (1) | Amikacin | 25 | 55.6 | 20 | 44.4 |
M | Erythromycin | 43 | 95.6 | 2 | 4.4 |
T | Tetracycline | 13 | 28.9 | 32 | 71.1 |
F | Ciprofloxacin | 4 | 8.9 | 41 | 91.1 |
F | Enrofloxacin | 38 | 84.4 | 7 | 15.6 |
Q | Nalidixic acid | 3 | 6.7 | 42 | 93.3 |
Others | Chloramphenicol | 45 | 100.0 | 0 | 0.0 |
Toxin Profile | Number of Isolates | ||||
---|---|---|---|---|---|
Chicken | Duck | Total (%) | |||
Summer | Winter | Summer | Winter | ||
Negative | 1 | - | 2 | 1 | 4 (4.3) |
cdtA+ | - | - | - | - | - |
cdtB+ | - | - | - | - | - |
cdtC+ | - | - | - | - | - |
cdtA+/cdtB+ | - | 1 | - | 1 (2.2) | |
cdtA+/cdtC+ | - | - | 1 | - | 1 (2.2) |
cdtB+/cdtC+ | 1 | 4 | 1 | 1 | 7 (15.6) |
cdtA+/cdtB+/cdtC+ | 5 | 4 | 10 | 13 | 32 (71.1) |
Total | 7 | 8 | 15 | 15 | 45 (100.0) |
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, J.; Jeong, J.; Lee, H.; Ha, J.; Kim, S.; Choi, Y.; Oh, H.; Seo, K.; Yoon, Y.; Lee, S. Antibiotic Susceptibility, Genetic Diversity, and the Presence of Toxin Producing Genes in Campylobacter Isolates from Poultry. Int. J. Environ. Res. Public Health 2017, 14, 1400. https://doi.org/10.3390/ijerph14111400
Lee J, Jeong J, Lee H, Ha J, Kim S, Choi Y, Oh H, Seo K, Yoon Y, Lee S. Antibiotic Susceptibility, Genetic Diversity, and the Presence of Toxin Producing Genes in Campylobacter Isolates from Poultry. International Journal of Environmental Research and Public Health. 2017; 14(11):1400. https://doi.org/10.3390/ijerph14111400
Chicago/Turabian StyleLee, Jeeyeon, Jiyeon Jeong, Heeyoung Lee, Jimyeong Ha, Sejeong Kim, Yukyung Choi, Hyemin Oh, Kunho Seo, Yohan Yoon, and Soomin Lee. 2017. "Antibiotic Susceptibility, Genetic Diversity, and the Presence of Toxin Producing Genes in Campylobacter Isolates from Poultry" International Journal of Environmental Research and Public Health 14, no. 11: 1400. https://doi.org/10.3390/ijerph14111400
APA StyleLee, J., Jeong, J., Lee, H., Ha, J., Kim, S., Choi, Y., Oh, H., Seo, K., Yoon, Y., & Lee, S. (2017). Antibiotic Susceptibility, Genetic Diversity, and the Presence of Toxin Producing Genes in Campylobacter Isolates from Poultry. International Journal of Environmental Research and Public Health, 14(11), 1400. https://doi.org/10.3390/ijerph14111400