A Rapid and Reliable Propidium Monoazide Polymerase Chain Reaction for Detecting Viable Pseudomonas syringae pv. actinidiae
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Strains and Culture
2.2. DNA Extraction of the Tested Bacterial Strains
2.3. Comparison of Primer Amplification Sensitivity and Specificity
2.4. Selection of Propidium Monoazide Treatment Conditions
2.5. False Positive Verification of the Detection Assay Using Propidium Monoazide
2.6. Detection of Different Ratios of Live/Dead Bacteria Mixture Using Propidium Monoazide
2.7. Actual Sample Detection
3. Results
3.1. Thermal Lethal Time Identification of Psa Cells
3.2. Comparison of the Amplification and Sensitivity of Specific Primers
3.3. Determination of Experimental Conditions for Propidium Monoazide in Viability Assays
3.4. Detection of the Live Bacterial Cells in the Mixed Samples with Dead Cells Using Propidium Monoazide
3.5. False Positive Verification of the Assay Using Propidium Monoazide
3.6. Detection of Actual Samples in the Field Using Propidium Monoazide
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
Number | Strain | Host or Cultivar | Tissue | Site |
---|---|---|---|---|
1 | MJ2107 | Hort16A | leaves | 104.13° E, 31.39° N |
2 | CX1101 | Hongyang | branches | 105.93° E, 31.73° N |
3 | AB2101 | Xuxiang | leaves | 103.43° E, 30.94° N |
4 | DH2101 | Hongyang | leaves | 103.70° E, 31.00° N |
5 | DS2102 | Hongyang | leaves | 103.73° E, 31.02° N |
6 | DF2101 | Hongyang | leaves | 103.74° E, 31.02° N |
7 | MP2101 | Hongyang | leaves | 104.13° E, 31.39° N |
8 | MN2101 | Hongyang | canes | 104.13° E, 31.39° N |
9 | QL0102 | Hongyang | branches | 103.57° E, 30.38° N |
10 | YA1801 | Hongyang | branches | 102.94° E, 30.16° N |
References
- Richardson, D.P.; Ansell, J.; Drummond, L.N. The nutritional and health attributes of kiwifruit: A review. Eur. J. Nutr. 2018, 57, 2659–2676. [Google Scholar] [CrossRef] [PubMed]
- Yao, K.K.; Zhu, Y.H.; Chen, W.; Luo, Y.; Chen, H.B.; Gong, G.S. A Preliminary report on the main control technology and application of kiwifruit canker in Sichuan Province. China Fruits 2024, 85–92+107. [Google Scholar] [CrossRef]
- Scortichini, M.; Marcelletti, S.; Ferrante, P.; Petriccione, M.; Firrao, G. Pseudomonas syringae pv. actinidiae: A re-emerging, multi-faceted, pandemic pathogen. Mol. Plant Pathol. 2012, 13, 631–640. [Google Scholar] [CrossRef] [PubMed]
- Vanneste, J.L. The scientific, economic, and social impacts of the New Zealand outbreak of bacterial canker of kiwifruit (Pseudomonas syringae pv. actinidiae). Annu. Rev. Phytopathol. 2017, 55, 377–399. [Google Scholar] [CrossRef]
- You, Y.X.; Dai, D.J.; Luo, J.Y.; Zhu, J.; Li, B. Research status and prospect of strategies for controlling kiwifruit canker disease. Zhejiang Agric. Sci. 2022, 63, 1322–1328, 1331. [Google Scholar] [CrossRef]
- Li, Y.; Cheng, H.Y.; Fang, S.M.; Qian, Z.H. A preliminary study on the prevalence prediction of kiwifruit bacterial canker disease. J. Appl. Ecol. 2001, 12, 359–362. Available online: https://kns.cnki.net/kcms2/article/abstract?v=xyKmmUzEPx3rmmTQLsmXZLBB_w63TegaEeznRdhIslq76TmQAVXHgQzOF9dCZGMsmCz8m9H4trODSgVDD1C9ASNr4wnIEWSF_bsw03gOjKrxIR7MBMyYmNHRE0PmdvixnCdWRlGkozcZG7TffaFH04Uqj38hPkhwGoCpNt7jErKGzJjJODtLXcIpQpJZ2P7q&uniplatform=NZKPT&laguage=CHS (accessed on 1 November 2024).
- Chapman, J.R.; Taylor, R.K.; Weir, B.S.; Romberg, M.K.; Vanneste, J.L.; Luck, J.; Alexander, B.J.R. Phylogenetic relationships among global populations of Pseudomonas syringae pv. actinidiae. Phytopathology 2012, 102, 1034–1044. [Google Scholar] [CrossRef] [PubMed]
- Sawada, H.; Miyoshi, T.; Ide, Y. Novel MLSA group (Psa5) of Pseudomonas syringae pv. actinidiae causing bacterial canker of kiwifruit (Actinidia chinensis) in Japan. Jpn. J. Phytopathol. 2016, 80, 171–184. [Google Scholar] [CrossRef][Green Version]
- Fujikawa, T.; Sawada, H. Genome analysis of the kiwifruit canker pathogen Pseudomonas syringae pv. actinidiae biovar 5. Sci. Rep. 2016, 6, 21399. [Google Scholar] [CrossRef]
- Cunty, A.; Poliakoff, F.; Rivoal, C.; Cesbron, S.; Fischer-Le Saux, M.; Lemaire, C.; Jacques, M.A.; Manceau, C.; Vanneste, J.L. Characterization of Pseudomonas syringae pv. actinidiae (Psa) isolated from France and assignment of Psa biovar 4 to a de novo pathovar: Pseudomonas syringae pv. actinidifoliorum pv. nov. Plant Pathol. 2015, 64, 582–596. [Google Scholar] [CrossRef]
- Everett, K.R.; Taylor, R.K.; Romberg, M.K.; Rees-George, J.; Manning, M.A. First report of Pseudomonas syringae pv. actinidiae causing kiwifruit bacterial canker in New Zealand. Australas. Plant Dis. Notes 2011, 6, 67–71. [Google Scholar] [CrossRef]
- EPPO. First Report of Pseudomonas syringae pv. actinidiae in Chile. EPPO Rep. Serv. 3: 2011/055. Available online: https://gd.eppo.int/reporting/article-137 (accessed on 12 October 2024).
- Sawada, H.; Shimizu, S.; Miyoshi, T.; Shinozaki, T.; Kusumoto, S.; Noguchi, M.; Naridomi, T.T.; Kikuhara, K.; Kansako, M.; Fujikawa, T. Characterization of biovar 3 strains of Pseudomonas syringae pv. actinidiae isolated in Japan. Jpn. J. Phytopathol. 2015, 81, 111–126. [Google Scholar] [CrossRef][Green Version]
- He, R.; Liu, P.; Jia, B.; Xue, S.; Wang, X.; Hu, J.; Al Shoffe, Y.; Gallipoli, L.; Mazzaglia, A.; Balestra, G.M.; et al. Genetic diversity of Pseudomonas syringae pv. actinidiae strains from different geographic regions in China. Phytopathology 2019, 109, 347–357. [Google Scholar] [CrossRef]
- Koh, Y.J.; Jung, J.S.; Hur, J.S. Current status of occurrence of major diseases on kiwifruits and their control in Korea. Acta Hortic. 2003, 610, 437–443. [Google Scholar] [CrossRef]
- Koh, H.S.; Kim, G.H.; Lee, Y.S.; Koh, Y.J.; Jae Sung Jung, J.J. Molecular characteristics of Pseudomonas syringae pv. actinidiae strains isolated in Korea and a multiplex PCR assay for haplotype differentiation. Plant Pathol. J. 2014, 30, 96–101. [Google Scholar] [CrossRef] [PubMed]
- Rees-George, J.; Vanneste, J.L.; Cornish, D.A.; Pushparajah, I.P.S.; Yu, J.; Templeton, M.D.; Everett, K.R. Detection of Pseudomonas syringae pv. actinidiae using polymerase chain reaction (PCR) primers based on the 16S-23S rDNA intertranscribed spacer region and comparison with PCR primers based on other gene regions. Plant Pathol. 2010, 59, 453–464. [Google Scholar] [CrossRef]
- Balestra, G.M.; Taratufolo, M.C.; Vinatzer, B.A.; Mazzaglia, A. A multiplex PCR assay for detection of Pseudomonas syringae pv. actinidiae and differentiation of populations with different geographic origin. Plant Dis. 2013, 97, 472–478. [Google Scholar] [CrossRef] [PubMed]
- Gallelli, A.; Talocci, S.; Pilotti, M.; Loreti, S. Real-time and qualitative PCR for detecting Pseudomonas syringae pv. actinidiae isolates causing recent outbreaks of kiwifruit bacterial canker. Plant Pathol. 2014, 63, 264–276. [Google Scholar] [CrossRef]
- Ruinelli, M.; Schneeberger, P.H.H.; Ferrante, P.; Bühlmann, A.; Scortichini, M.; Vanneste, J.L.; Pothier, J.F. Comparative genomics-informed design of two LAMP detection assays for detection of the kiwifruit pathogen Pseudomonas syringae pv. actinidiae and discrimination of isolates belonging to the pandemic biovar 3. Plant Pathol. 2017, 66, 140–149. [Google Scholar] [CrossRef]
- Cimmino, A.; Iannaccone, M.; Petriccione, M.; Masi, M.; Evidente, M.; Capparelli, R.; Evidente, A. An ELISA method to identify the phytotoxic Pseudomonas syringae pv. actinidiae exopolysaccharides: A tool for rapid immunochemical detection of kiwifruit bacterial canker. Phytochem. Lett. 2017, 19, 136–140. [Google Scholar] [CrossRef]
- Chen, H.; Hu, Y.; Qin, K.Y.; Yang, X.Z.; Jia, Z.J.; Li, Q.; Chen, H.B.; Yang, H. A serological approach for the identification of the effector hopz5 of Pseudomonas syringae pv. actinidiae: A tool for the rapid immunodetection of kiwifruit bacterial canker. J. Plant Pathol. 2018, 100, 171–177. [Google Scholar] [CrossRef]
- Barrett-Manako, K.; Andersen, M.; Martínez-Sánchez, M.; Jenkins, H.; Hunter, S.; Reese-George, J.; Montefiori, M.; Wohlers, M.; Rikkerink, E.; Templeton, M.; et al. Real-time PCR and droplet digital PCR are accurate and reliable methods to quantify Pseudomonas syringae pv. actinidiae biovar 3 in kiwifruit infected plantlets. Plant Disesae 2020, 105, 1748–1757. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.T.; Peng, Q.D.; Yang, Y.F.; Zhuang, Q.G.; Xi, D.H. Recombinase polymerase amplification-lateral flow (RPA-LF) assay for rapid visual detection of Pseudomonas syringae pv. actinidiae in kiwifruit. Crop Prot. 2023, 17, 106315. [Google Scholar] [CrossRef]
- Mou, G.P.; Hu, J.Y.; Xu, R.; Li, K.J.; Luo, J.H.; Wei, S.; Xiao, B.J.; Yi, J.P. Evaluation of PCR detection methods for Clavibacter michiganensis subsp. nebraskensis in imported maize. Plant Quar. 2023, 37, 17–26. [Google Scholar] [CrossRef]
- Zhang, C.; Liu, X.; Chen, J.L. Detection of viable Salmonella by real-time fluorescence quantitative RT-PCR. Food Sci. Technol. 2012, 33, 91–94. [Google Scholar] [CrossRef]
- Shi, Y.P.; Chen, D.S.; Wang, Y.; Chen, B.; Yang, Y.; Zhang, P.F.; Li, C.; Shao, L. Advances in the researches on PMA-PCR technology. China Anim. Health Insp. 2023, 40, 72–78. [Google Scholar] [CrossRef]
- Zhao, J.Y.; Hu, J.X.; Zhang, Y.; Liu, P.; Tang, F.; Liao, F. Establishment of detection method for viable cells of Acidovorax avenae subsp. citrulli with PMA-PC. China Plant Prot. 2015, 35, 12–15. [Google Scholar] [CrossRef]
- Kong, W.W.; Li, Y.L.; Wang, J.Q.; Liu, T.T.; Chen, N.; Jin, Y.; He, X.Q. The establishment of PMA-qPCR for detecting bacterial angular leaf ppot on cucumber andits preliminary application. Biotechnol. Bull. 2016, 32, 70–75. [Google Scholar] [CrossRef]
- Yu, X.L.; Xu, J.; Zhang, H.; Xu, J.S.; Huang, W.; Hu, X.M.; Feng, J.; Wang, X.L. Rapid detection of viable but non-culturable (VBNC) Ralstonia solanacearum by PMA-PCR method. Plant Prot. 2016, 42, 144–149. [Google Scholar] [CrossRef]
- Yuan, Y.Z.; Han, J.; Wang, Y.; Luo, M.; Bao, H.F.; Zhang, C.Z.; Huang, W. Establishment of rapid quantitative detection of viable Erwinia amylovora. J. Fruit Sci. 2020, 37, 1425–1433. [Google Scholar] [CrossRef]
- Yu, X.; Wang, W.F.; Li, X.F.; Feng, L.X.; Qian, Y.K.; Zhang, C.; Wei, S. PMA-qPCR assay for the detection of viable Pseudomonas syringae pv. maculicola. Plant Quar. 2021, 35, 49–54. [Google Scholar] [CrossRef]
- Zhang, J.L.; Qi, S.; Luan, X.B.; Jin, Y.B.; Huang, C.J.; Li, P.; Wei, J.Y.; Yan, J. Method for rapid detection of Fusarium oxysporum and Phytophthora parasitica var. nicotianae in tabacco planting soil. Guangdong Agric. Sci. 2022, 49, 101–108. [Google Scholar]
- Chai, A.; Wang, Q.C.; Kang, H.J.; Yan, L.Y.; Huang, Y.P.; Shi, Y.X.; Xie, X.W.; Li, L.; Fan, T.; Wang, Y.H.; et al. Rapid quantification of infectious cucumber green mottle mosaic virus in watermelon tissues by PMA Coupled with RT-qPCR. Viruses 2022, 14, 2046. [Google Scholar] [CrossRef]
- Yu, G.C.; Zhao, Y.Q.; Jiang, P.; Tian, Y.L.; Hu, B.S. Establishment and preliminary application of PMA-PCR method for the detection of cell activity of bacterial streptosporium oryza. Acta Phytophtopathology Sin. 2023, 53, 944–949. [Google Scholar] [CrossRef]
- Panth, M.; Noh, E.; Schnabel, G.; Wang, H. Development of a long amplicon PMA-qPCR assay for detection of viable Xanthomonas arboricola pv. pruni cells in peach trees. Plant Dis. 2024, 108, 2190–2196. [Google Scholar] [CrossRef]
- Wang, H.; Turechek, W. Detection of viable Xanthomonas fragariae cells in strawberry using propidium monoazide and long-amplicon quantitative PCR. Plant Dis. 2020, 104, 1105–1112. [Google Scholar] [CrossRef] [PubMed]
- Immanuel, T.; Taylor, R.; Keeling, S.E.; Brosnahan, C.L.; Alexander, B.J. Discrimination between viable and dead Xanthomonas fragariae in strawberry using viability PCR. J. Phytopathol. 2020, 168, 363–373. [Google Scholar] [CrossRef]
- Hu, Y.; Chen, H.; Yang, X.Z.; Li, Q.; Yang, H. Characterization of polyclonal antibody against Pseudomonas syringae pv. actinidiae effector Hopz5 by enzyme linked lmmunoabsorbent assay. Biotechnol. Bull. 2018, 34, 84–89. [Google Scholar] [CrossRef]
- Vanneste, J.L.; Yu, J.; Cornish, D.A.; Tanner, D.J.; Windner, R.; Chapman, J.R.; Taylor, R.K.; Mackay, J.F.; Dowlut, S. Identification, virulence, and distribution of two biovars of Pseudomonas syringae pv. actinidiae in New Zealand. Plant Dis. 2013, 97, 708–719. [Google Scholar] [CrossRef] [PubMed]
- Bartoli, C.; Lamichhane, J.R.; Berge, O.; Guilbaud, C.; Varvaro, L.; Balestra, G.M.; Vinatzer, B.A.; Morris, C.E. A framework to gauge the epidemic potential of plant pathogens in environmental reservoirs: The example of kiwifruit canker. Mol. Plant Pathol. 2015, 16, 137–149. [Google Scholar] [CrossRef]
- Abelleira, A.; Ares, A.; Aguin, O.; Peñalver, J.; Morente, M.C.; López, M.M.; Sainz, M.J.; Mansilla, J.P. Detection and characterization of Pseudomonas syringae pv. actinidifoliorum in kiwifruit in Spain. J. Appl. Microbiol. 2015, 119, 1659–1671. [Google Scholar] [CrossRef] [PubMed]
- McCann, H.C.; Li, L.; Liu, Y.; Li, D.; Pan, H.; Zhong, C.; Rikkerink, E.H.A.; Templeton, M.D.; Straub, C.; Colombi, E.; et al. Origin and evolution of the kiwifruit canker pandemic. Genome Biol. Evol. 2017, 9, 932–944. [Google Scholar] [CrossRef]
- Reis-Pereira, M.; Tosin, R.; Martins, R.C.; Dos Santos, F.N.; Tavares, F.; Cunha, M. Enhancing kiwi bacterial canker leaf assessment: Integrating hyperspectral-based vegetation indexes in predictive modeling. Eng. Proc. 2023, 48, 22. [Google Scholar] [CrossRef]
- Hu, S.Q.; Dai, D.J.; Luo, J.Y.; Zhu, J.; An, Q.L.; Li, B. Analysis of diversity and detection technology of kiwifruit bacterial canker pathogen. J. Zhejiang Agric. Sci. 2022, 63, 2652–2657. [Google Scholar] [CrossRef]
- Zhu, H.Y.; An, C.; Li, B.; Liu, C. Research progress of pathogenic bacteria and detection methods of kiwifruit canker disease. Shaanxi Agric. Sci. 2013, 59, 141–145+153. [Google Scholar] [CrossRef]
- Froud, K.J.; Beresford, R.M.; Cogger, N.C. Impact of kiwifruit bacterial canker on productivity of cv. hayward kiwifruit using observational data and multivariable analysis. Plant Pathol. 2018, 67, 671–681. [Google Scholar] [CrossRef]
- Cacioppo, O.; Marcon, M.; Tacconi, G. Pedoclimatic web monitoring system for Pseudomonas syringae pv. actinidiae (Psa) and orchard management. Acta Horticutrea 2015, 1095, 129–134. [Google Scholar] [CrossRef]
- Cameron, A.; De Zoysa, G.H.; Sarojini, V. Antimicrobial peptides against Pseudomonas syringae pv. actinidiae and Erwinia amylovora: Chemical synthesis, secondary structure, efficacy, and mechanistic investigations. Biopolymers 2014, 102, 88–96. [Google Scholar] [CrossRef] [PubMed]
- Scortichini, M. Occurrence of Pseudomonas syringae pv. actinidiae on kiwifruit in Italy. Plant Pathol. 1994, 43, 1035–1038. [Google Scholar] [CrossRef]
- Biondi, E.; Galeone, A.; Kuzmanovi’c, N.; Ardizzi, S.; Lucchese, C.; Bertaccini, A. Pseudomonas syringae pv. actinidiae detection in kiwifruit plant tissue and bleeding sap. Ann. Appl. Biol. 2013, 162, 60–70. [Google Scholar] [CrossRef]
- Zhu, D.; Cao, F.; Gao, G.T.; Wang, D.; Xu, Y.F.; Du, Y.L.; Zhang, X.; Li, C.Z.; Sun, Q.; Zhou, M.N. Research of rapid detection on Pseudomonas syringae pv. actinidiae from the surface of kiwifruit during the storage period. J. Nucl. Agric. Sci. 2017, 31, 493–499. [Google Scholar] [CrossRef]
- Garcia, E.; Moura, L.; Abelleira, A.; Aguín, O.; Ares, A.; Mansilla, P. Characterization of Pseudomonas syringae pv. actinidiae biovar 3 on kiwifruit in north-west Portugal. J. Appl. Microbiol. 2018, 125, 1147–1161. [Google Scholar] [CrossRef] [PubMed]
- Pei, Y.G.; Ma, L.; Zheng, X.J.; Yao, K.K.; Fu, X.R.; Chen, H.B.; Chang, X.L.; Zhang, M.; Gong, G.S. Identification and Genetic Characterization of Pseudomonas syringae pv. actinidiae from Kiwifruit in Sichuan, China. Plant Dis. 2023, 107, 3248–3258. [Google Scholar] [CrossRef]
- Andersen, M.T.; Templeton, M.D.; Rees-George, J.; Vanneste, J.L.; Cornish, D.A.; Yu, J.; Cui, W.; Braggins, T.J.; Babu, K.; Mackay, J.F.; et al. Highly specific assays to detect isolates of Pseudomonas syringae pv. actinidiae biovar 3 and Pseudomonas syringae pv. actinidifoliorum directly from plant material. Plant Pathol. 2018, 67, 1220–1230. [Google Scholar] [CrossRef]
- Hao, F.M.; Ding, W.H.; Ma, E.L.; Yan, L.Y.; Huang, Y.P.; Wang, Y.H.; Zang, J.Y. Rapid detection of viable bacteria of bacterial fruit spot by PMA-qPCR. Zhejiang Agric. Sci. 2023, 64, 664–669. [Google Scholar] [CrossRef]
- Nocker, A.; Cheung, C.Y.; Camper, A.K. Comparison of propidium monoazide with ethidium monoazide for differentiation of live vs dead bacteria by selective removal of DNA from dead cells. J. Microbiol. Methods 2006, 67, 310–320. [Google Scholar] [CrossRef] [PubMed]
- Xu, G.Y.; Fu, L.Z.; Long, X.F.; Chen, C.H.; Li, P.F.; Zhang, S.H. Establishment of PMA-PCR detection method for Corynebacterium pseudotuberculosis in Goat. Mod. J. Anim. Husb. Vet. Med. 2018, 11, 9–13. [Google Scholar]
- Chayapa, T.; Doris, H.D. Propidium monoazide for viable salmonella enterica detection by pcr and lamp assays in comparison to RNA-based RT-PCR, RT-LAMP, and culture-based assays. J. Food Sci. 2020, 85, 3509–3516. [Google Scholar] [CrossRef]
- Li, Y.; Huang, T.Y.; Mao, Y.; Chen, Y.; Liu, J. Study on the viable but non-culturable (VNBC) state formation of staphylococcus aureus and its control in food system. Front. Microbiol. 2020, 11, 599739. [Google Scholar] [CrossRef]
- Liang, T.B.; Long, H.; Wang, D.; Zhang, W.; Zhan, Z.X.; Wu, X. Simultaneous detection of Salmonella spp. and S. aureus in donkey-hide products based on PMA-mqPCR. Mod. Food 2021, 199–204+223. [Google Scholar] [CrossRef]
- Wang, P.; Liang, L.; Peng, X.; Qu, T.; Zhao, X.; Ji, Q.; Chen, Y. Sodium deoxycholate-propidium monoazide droplet digital PCR for rapid and quantitative detection of viable Lacticaseibacillus rhamnosus HN001 in compound probiotic products. Microorganisms 2024, 12, 1504. [Google Scholar] [CrossRef] [PubMed]
- Gao, D.F.; Liu, X.; Yang, Y.L. Optimization and preliminary application of PMA-PCR system for detection of viable Ralstonia solanacearum in potato. China Plant Prot. 2017, 37, 5–13. [Google Scholar] [CrossRef]
- Zhao, Z.B.; Gao, X.N.; Yang, D.H.; Huang, L.L.; Qin, H.Q.; Kang, Z.S.; Wang, N.N. Field detection of canker-causing bacteria on kiwifruit trees: Pseudomonas syringae pv. actinidiae is the major causal agent. Crop Prot. 2015, 75, 55–62. [Google Scholar] [CrossRef]
- Zhou, D.X.; Yin, Y.P.; Wang, Z.K.; Xiong, S. Establishment of a method to rapidly detect only viable cells of Pseudomonas syringae pv. actinidiae by EMA-qPCR. Plant Prot. 2017, 43, 143–148. [Google Scholar] [CrossRef]
- Xiao, Y.; Liu, H.Y.; Gao, G.T.; Cao, F.; Ma, Y.P.; Zhao, W.Q.; Lei, Y.S. PMA-qPCR for detecting live bacteria of Shaanxi kiwifruit cancer dominant pathogen. Food Mach. 2019, 35, 48–53+59. [Google Scholar] [CrossRef]
- Wang, Y.; Yan, Y.; Thompson, K.; Bae, S.; Accorsi, E.; Zhang, Y.; Shen, J.; Vlamakis, H.; Hartmann, E.; Huttenhower, C. Whole microbial community viability is not quantitatively reflected by propidium monoazide sequencing approach. Microbiome 2021, 9, 17. [Google Scholar] [CrossRef]
- Opgenorth, D.C. Pseudomonas canker of kiwifruit. Plant Dis. 1983, 67, 1283–1284. [Google Scholar] [CrossRef]
- Serizawa, S.; Ichikawa, T.; Takikawa, Y.; Tsuyumu, S.; Goto, M. Occurrence of bacterial canker of kiwifruit in Japan: Description of symptoms, isolation of the pathogen and screening of bactericides. Jpn. J. Phytopathol. 1989, 55, 427–436. [Google Scholar] [CrossRef]
- Zhu, X.X.; Fang, Y.Z.; Liao, X.G. Study on the causal agent of kiwifruit canker disease. Hunan Agric. Sci. 1993, 31–33. [Google Scholar] [CrossRef]
- Xiao, R.; Shi, H.; Bu, F.W.; Wang, Y.; He, F.Y.; Wang, R.C. Research progress of kiwifruit disease control. Hunan Agric. Sci. 2021, 116–120. [Google Scholar] [CrossRef]
- Marcelletti, S.; Ferrante, P.; Petriccione, M.; Firrao, G.; Scortichini, M. Pseudomonas syringae pv. actinidiae draft genomes comparison reveal strain-specific features involved in adaptation and virulence to Actinidia species. PLoS ONE 2011, 6, e27297. [Google Scholar] [CrossRef] [PubMed]
- Zhong, C.H.; Li, L.; Pan, H.; Deng, L.; Chen, M.Y. Occurrence rule and comprehensive control of kiwifruit bacterial canker disease. China Fruits 2020, 1, 9–13+18. Available online: http://lib.cqvip.com/Qikan/Article/Detail?id=7101082277 (accessed on 4 October 2024).
- Woodcock, S. A review of research and development undertaken on Psa. Kiwifruit Vine Health 2016, 5, 871–874. [Google Scholar]
- Do, K.S.; Chung, B.N.; Joa, J.H. D-PSA-K: A model for estimating the accumulated potential damage on kiwifruit canes caused by bacterial canker during the growing and overwintering seasons. Plant Pathol. J. 2016, 32, 537–544. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Qin, Z.; Zhang, J.E.; Jiang, Y.P.; Wang, R.L.; Wu, R.S. Predicting the potential distribution of Pseudomonas syringae pv. actinidiae in China using ensemble models. Plant Pathol. 2020, 69, 120–131. [Google Scholar] [CrossRef]
- Wang, R.; Li, Q.; He, S.; Liu, Y.; Wang, M.T.; Jiang, G. Modeling and mapping the current and future distribution of Pseudomonas syringae pv. actinidiae under climate change in China. PLoS ONE 2018, 13, e0192153. [Google Scholar] [CrossRef] [PubMed]
Primer Name | Gene | Sequence (5′→3′) |
---|---|---|
PsaF | hopZ3 | CAGAGGCGCTAACGAGGAAA |
PsaR | CGAGCATACATCAACAGGTCA | |
HopZ5F | hopZ5 | TCACTCCTAGACTGGAATAC |
HopZ5R | GGCTATCATGAAGGCTGTCA |
Scheme | Site | Latitude (°N) | Longitude (°E) | Host or Cultivar |
---|---|---|---|---|
B1 | Xichang | 28.09 | 102.04 | Donghong |
B2 | Qionglai | 30.52 | 103.717 | Hongyang |
B3 | Pujiang | 30.26 | 103.62 | Hongyang |
B4 | Yaan | 30.15 | 102.96 | Hongyang |
B5 | Dujiangyan | 30.92 | 103.61 | Hongyang |
B6 | Dujiangyan | 30.92 | 103.61 | Hongyang |
B7 | Dujiangyan | 30.92 | 103.61 | Hongyang |
B8 | Chongzhou | 31.55 | 106.17 | Hongyang |
B9 | Aba prefecture | 30.55 | 103.64 | Hongyang |
B10 | Guangyuan | 30.93 | 103.42 | Cuiyu |
Heated Time (min) | Number of Bacterial Colonies (cfu/mL) |
---|---|
* CK (0) | 1 × 107 |
11 | 10 |
12 | 7 |
13 | 3 |
14 | 2 |
15 | 0 |
16 | 0 |
17 | 0 |
18 | 0 |
19 | 0 |
20 | 0 |
Strain | Genbank ID | Percent Homology (%) |
---|---|---|
FTRS_L1 | DQ986456.1 | 99.68 |
JZY2 | CP136504.1 | 100 |
CXP-1 | MK592610.1 | 100 |
M228 | CP032631.1 | 100 |
Yunnan2.4 | CP135285.1 | 100 |
MAFF212211 | AP019808.1 | 100 |
Yunnan3.2 | CP135283.1 | 100 |
MAFF613020 | AP019411.1 | 100 |
CRAFRU14.08 | CP019732.1 | 100 |
P155 | CP032871.1 | 100 |
ICMP18884 | CP011972.2 | 100 |
PSA.AH.01 | CP116478.1 | 100 |
ICMP 18708 | CP012179.1 | 100 |
CRAFRU12.29 | CP019730.1 | 100 |
YXH1 | CP136506.1 | 100 |
NZ-45 | CP017007.1 | 100 |
MAFF212063 | CP024712.1 | 100 |
QSY6 | CP134066.1 | 100 |
ICMP 9853 | CP018202.1 | 100 |
NZ-47 | CP017009.1 | 100 |
Psa Concentration /cfu·mL−1 | Normal Polymerase Chain Reaction | PMA–Polymerase Chain Reaction | Spread Plate Counting /cfu |
---|---|---|---|
107 | + | - | 0 |
106 | + | − | 0 |
105 | + | − | 0 |
104 | + | − | 0 |
103 | + | − | 0 |
102 | − | − | 0 |
101 | − | − | 0 |
Sample | Normal PCR | PMA–PCR | Plate Culture | PMA–PCR (CK) |
---|---|---|---|---|
B1 | + | + | + | − |
B2 | + | + | + | − |
B3 | + | + | + | − |
B4 | + | + | + | − |
B5 | + | + | + | − |
B6 | + | + | + | − |
B7 | + | + | + | − |
B8 | − | − | − | − |
B9 | + | − | − | − |
B10 | + | + | + | − |
Month/Time | Rain-Shelter Cultivation | Open-Air Cultivation | ||
---|---|---|---|---|
Branch | Leaf | Branch | Leaf | |
January | 4/32 | - | 12/32 | - |
February | 5/32 | - | 14/32 | - |
March | 4/32 | 1/32 | 14/32 | 5/32 |
April | 6/32 | 13/32 | 17/32 | 22/32 |
May | 3/32 | 2/32 | 2/32 | 3/32 |
June | 4/32 | 1/32 | 2/32 | 3/32 |
July | 1/12 | 0/12 | 1/12 | 0/12 |
August | 2/24 | 0/12 | 2/24 | 0/12 |
September | 4/40 | - | 2/40 | - |
October | 5/40 | - | 4/40 | - |
November | 3/40 | - | 6/40 | - |
December | 2/20 | - | 3/20 | - |
Total | 43/368 | 17/152 | 77/368 | 33/152 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Luo, Y.; Liao, W.; Li, Y.; Chen, W.; Zhong, S.; Wu, C.; Yao, K.; Yang, R.; Ma, M.; Gong, G. A Rapid and Reliable Propidium Monoazide Polymerase Chain Reaction for Detecting Viable Pseudomonas syringae pv. actinidiae. Curr. Issues Mol. Biol. 2025, 47, 103. https://doi.org/10.3390/cimb47020103
Luo Y, Liao W, Li Y, Chen W, Zhong S, Wu C, Yao K, Yang R, Ma M, Gong G. A Rapid and Reliable Propidium Monoazide Polymerase Chain Reaction for Detecting Viable Pseudomonas syringae pv. actinidiae. Current Issues in Molecular Biology. 2025; 47(2):103. https://doi.org/10.3390/cimb47020103
Chicago/Turabian StyleLuo, Yi, Wenfei Liao, Yue Li, Wen Chen, Sen Zhong, Cuiping Wu, Kaikai Yao, Rui Yang, Miaomiao Ma, and Guoshu Gong. 2025. "A Rapid and Reliable Propidium Monoazide Polymerase Chain Reaction for Detecting Viable Pseudomonas syringae pv. actinidiae" Current Issues in Molecular Biology 47, no. 2: 103. https://doi.org/10.3390/cimb47020103
APA StyleLuo, Y., Liao, W., Li, Y., Chen, W., Zhong, S., Wu, C., Yao, K., Yang, R., Ma, M., & Gong, G. (2025). A Rapid and Reliable Propidium Monoazide Polymerase Chain Reaction for Detecting Viable Pseudomonas syringae pv. actinidiae. Current Issues in Molecular Biology, 47(2), 103. https://doi.org/10.3390/cimb47020103