Next Article in Journal
Gallic Acid Enhances Olaparib-Induced Cell Death and Attenuates Olaparib Resistance in Human Osteosarcoma U2OS Cell Line
Previous Article in Journal
Vitamin D and LL-37 in Serum and Saliva: Insights into Oral Immunity
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

A Rapid and Reliable Propidium Monoazide Polymerase Chain Reaction for Detecting Viable Pseudomonas syringae pv. actinidiae

Plant Protection Department and Major Crop Disease Laboratory, College of Agronomy, Sichuan Agricultural University, Chengdu 611130, China
*
Author to whom correspondence should be addressed.
Curr. Issues Mol. Biol. 2025, 47(2), 103; https://doi.org/10.3390/cimb47020103
Submission received: 27 November 2024 / Revised: 24 January 2025 / Accepted: 2 February 2025 / Published: 6 February 2025
(This article belongs to the Section Molecular Microbiology)

Abstract

Pseudomonas syringae pv. actinidiae (Psa) is responsible for causing kiwifruit canker disease. The detection of Psa is commonly carried out using normal PCR and culture-based isolation. However, normal PCR does not differentiate between live and dead cells, potentially resulting in the incorrect estimation of the amount of infectious substance in a sample. Such an incorrect estimation could result in unnecessary phytosanitary strategies and control measures. This study attempts to establish a specific assay for detecting only live Psa bacterial cells. To achieve this, a pair of strain-specific primers designed from HopZ3 effector were used, and the traditional PCR method was assessed using a nucleic acid-binding dye (propidium monoazide—PMA), establishing a PMA–PCR system and conditions for detecting live Psa in this study. Sensitivity tests showed a detection limit of 10 cfu/mL and 1 pg/μL. This method was also tested in diseased kiwifruit tissues and can be seen as a rapid and dependable replacement to PCR methods for detecting only those infective kiwifruit materials with viable Psa.

1. Introduction

Kiwifruit (Actinidia chinensis Planch) is one of the most successful artificial domestication and cultivation fruit crops of the 21st century. In 1904, kiwifruit was introduced to New Zealand from China and was subsequently widely cultivated across New Zealand [1]. After more than 100 years, kiwifruit has evolved from a domesticated wild plant to a commercial crop with international economic importance [1]. The cultivation acreage and annual production for kiwifruit have increased gradually in recent years, and kiwifruit bacterial canker disease is one of the most important diseases affecting the kiwifruit planting industry. It mainly causes dried and cracked branches (e.g., trunk, cane, and vine), withered and falling leaves, brown flowers that are typically dried without pollination, and fruit-pitted rot, seriously affecting the quality and yield of the fruit [2]. Consequently, these symptoms lead to a serious economic loss for the kiwifruit industry globally [3,4]. For instance, it was reported that, by 2014, this disease had led to direct economic losses reaching up to NZD 560 million in New Zealand [4]. The causal agent of bacterial canker disease in kiwifruit is Pseudomonas syringae pv. actinidiae, which is a national forest quarantine pest [5]. Psa populations are currently divided into five pathogenic biovars (namely, Psa1, Psa2, Psa3, Psa5, and Psa6) based on genetic diversity, pathogenicity, and toxin production [6,7,8,9]. Biovar 4, which is only distributed in partial areas of New Zealand and Australia, was renamed as Pseudomonas syringae pv. actinidifoliorum (Pfm) in 2015 [10]. Since 2010, Psa3 has been a pandemic group and can cause severe canker disease around the world [3,11,12,13,14].
Because of the huge influence caused by kiwifruit canker disease, there is an urgent need to establish an effective control strategy. In general, chemical control has little effect on kiwifruit canker disease once the symptoms have appeared [15,16]. Likewise, it is impossible to effectively control the disease in the late infection period [15]. The most important task in preventing this disease is to detect its pathogenic bacteria. Therefore, the timely detection of the pathogen is key to control the disease successfully, in order to guarantee the sanitation and health situation to protect orchards as early as possible. Many detection techniques have been applied to detect the pathogen, such as specific-primer PCR, duplex PCR, multiplex PCR, nested PCR, real-time quantitative PCR, droplet digital PCR, serological immunoassays, and recombinase polymerase amplification-lateral flow (RPA-LF) [16,17,18,19,20,21,22,23,24]. However, there are few reports about the detection of viable bacteria. Moreover, the traditional PCR detection methods are prone to false positive results [25], leading to many unnecessary losses due to the wrong prevention and control strategies. However, direct plate culture is time-consuming and laborious. Although the RT-PCR method based on mRNA in prokaryotes can effectively distinguish false positive samples, the results are prone to be affected by multiple factors because of the relatively complicated operating steps and the instability of mRNA, resulting in great differences in the detection of actual samples [26].
A photosensitive DNA dye, propidium monoazide (PMA), is unable to penetrate into the cell membrane of a complete cell [27]. However, it can effectively modify the DNA exposed after cell death, forming stable covalent carbon–nitrogen bonds and preventing the amplification of these DNA molecules via PCR. In addition, the remaining PMA after photolysis reacts with water molecules to produce inactive hydroxylamine, which enables the DNA in dead cells to be distinguished from that in living cells, effectively detecting the live bacteria in the sample [27]. The target of PMA–PCR detection is live bacterial DNA molecules, which avoids the problem of false positives in traditional PCR detection and makes the results more reliable and effective. The PMA–PCR assay has been widely utilized in the detection of various plant pathogens [28,29,30,31,32,33,34,35]. For example, Panth et al. [36] developed an assay using PMA to specifically detect live Xanthomonas arboricola pv. pruni in peaches, providing a good tool for detecting overwintering pathogenic bacteria in peach trees. Wang et al. [37] and Immanuel et al. [38] have also successfully detected the pathogen Xanthomonas fragariae in strawberry using PMA. Based on this, our study combined PMA and PCR technology to develop a PMA–PCR method for accurately and rapidly detecting live Psa cells and analyzed the influence of PMA on the traditional PCR detection of Psa so as to monitor the early infection and real dynamic changes in the Psa population as well as provide technical support for inspection, quarantine, and disease control.

2. Materials and Methods

2.1. Bacterial Strains and Culture

Ten identified Psa strains (MJ2107, CX1101, AB2101, DH2101, DS2102, DF2101, MP2101, MN2101, QL0102, and YA1801) (Table A1) and three Pseudomonas spp. (P. fluorescens, P. viridiflava, and P. lurida) were selected for the specific detection of primers, which were isolated from kiwifruit tissues in the Sichuan province of China. Seven different pathogenic variants of Pseudomonas syringae populations (P. syringae pv. tomato DC3000, P. syringae pv. syringae, P. syringae pv. theae, P. syringae pv. lachrymans, P. syringae pv. tabaci, P. syringae pv. mori, and P. syringae pv. morsprunorum) were also included. All tested bacterial strains were stored with 25% glycerol at −80 °C and were then cultured on Luria–Bertani (LB) agar medium at 25 °C for 48 h before further progress.
Among these strains, Psa strain MJ2107 (deposited in the laboratory of Plant Protection Department, College of Agriculture, Sichuan Agricultural University), isolated from the leaves of infected kiwifruit showing obvious symptoms in Mianzhu city of Sichuan Province, was used in all the assays. It was grown at 25 °C with a 250 rpm/min shaker for 14 h in LB broth and was then plated using streak culture on LB agar medium. A single colony was selected and inoculated into a 50 mL centrifuge tube containing 20 mL LB broth, cultured overnight at 180 rpm/min in a shaker at 25 °C until the OD600 reached 1.5~2.0, and then re-suspended with sterile water and adjusted to a final concentration of 107 colony forming unit (cfu)/mL suspensions using a spectrophotometer for further study. The lethal temperature was set at 100 °C and was heated for 11 to 20 min at 1 min increments. After being cooled on ice, an additional 100 µL of the treated suspensions was subjected to spread plate cultivation on LB agar medium for two weeks to determine whether the bacterial cells were killed and dead.

2.2. DNA Extraction of the Tested Bacterial Strains

A single colony of all the tested bacteria was grown overnight in LB broth at 25 °C in a 200 rpm/min shaker until the OD600 reached 2.0~2.5, and the bacterial precipitate was collected in a Sorvall Legend Micro 17 benchtop centrifuge (Thermo Fisher Scientific, Waltham, MA, USA) at 13,000× g for 1 min. The genomic DNA of each treated bacterium was extracted using the TIANamp Bacteria DNA Kit (TIANGEN Biotech Co., Ltd., Beijing, China), according to its usage instructions. DNA concentration and quality were quantified using a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) before being adjusted to 50 ng/mL with sterile distilled water and stored at −20 °C.

2.3. Comparison of Primer Amplification Sensitivity and Specificity

The genomic DNA concentration of Psa strain MJ2107 was gradient-diluted to 10 ng/μL, 1 ng/μL, 100 pg/μL, 10 pg/μL, 1 pg/μL, 100 fg/μL, 10 fg/μL, and 1 fg/μL successively. The bacterial suspension with a concentration of 107 cfu/mL was gradient-diluted 10-fold until it reached 100 cfu/mL. Two pairs of primers, PsaF/R (designed for HopZ3 effector) [18] and HopZ5F/R (designed for HopZ5 effector) [39], were used for detecting only Psa in this study (Table 1). PCR was carried out in a 25 μL total volume mixture containing 2.5 μL of 10×Taq buffer, 1 μL of 25 mM MgCl2, 1 μL of Taq DNA Polymerase (Vazyme Biotech, Nanjing, China), 1 μL of 2.5 mM dNTP mix, 1 μL of template DNA, 1 μL of 10 μM primers PsaF/R or HopZ5F/R, and sterile distilled water to a final volume. Amplification conditions were performed in an S1000 thermal cycler (Bio-Rad Laboratories, Shanghai, China). The amplification protocol for the HopZ5F/R primer was performed as follows [39]: an initial denaturation step at 95 °C for 10 min; 36 cycles including a denaturation step at 94 °C for 30 s, annealing at 53.2 °C for 35 s, and extension at 72 °C for 90 s; and a final extension at 72 °C for 5 min. The amplification protocol for the PsaF/R primer was performed as follows [18]: 1 cycle at 94 °C for 4 min; 36 cycles at 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s; and a final extension cycle at 72 °C for 10 min. A sterile water control without DNA was included in each PCR batch. In total, 5 μL of PCR products was electrophoresed on 1% TAE agarose gels for 30 min and observed using a gel imaging analysis system with ImageLab software version 6.0 (Bio-Rad Laboratories, Inc., Hercules, CA, USA). PCR products from the final selected primers were sequenced (Sangon biotech, Shanghai, China) and aligned with the known sequences in the National Center of Biotechnology Information (NCBI; https://www.ncbi.nlm.nih.gov, accessed on 6 November 2024). Nucleotide sequences and homology analysis were displayed using the SnapGene Viewer 8.0 software. Furthermore, the amplification reaction conditions of ten Psa strains and ten other Pseudomonas strains for specificity were consistent with those described above, and sterile ddH2O served as a negative control.

2.4. Selection of Propidium Monoazide Treatment Conditions

PMA was dissolved in 1 mL of dimethylsulfoxide (DMSO) to create a PMA mother solution with a concentration of 1 mg/mL (2 mM) before being stored at −20 °C away from direct light. For the assays, 500 µL of live and heat-treated Psa MJ2107 suspensions was supplemented with PMA to obtain a final dye concentration of 5, 10, 15, 20, 25, 30, 35, and 40 μg/mL, respectively. After dye addition, the samples were wrapped in tin foil and gently mixed 2 or 3 times in darkness at room temperature for 0, 2, 4, 6, 8, 10, and 12 min. PMA-treated and PMA-non-treated samples were subsequently exposed to a halogen lamp (650 W) for 0, 5, 10, 15, 20, 25, and 30 min. In addition, the samples were placed on ice at a distance of 20 cm away from the lamp and were mixed gently every 5 min during exposure. After exposure, the bacterial cells were centrifuged (Thermo Fisher Scientific, Waltham, MA, USA) for 2 min at 13,000× g, cleaned twice with sterile ddH2O, and then suspended with 500 μL of sterile ddH2O to extract total DNA as a template for further DNA extraction and amplification. The samples treated or non-treated with PMA were amplified using PCR with the PsaF/R primers as described in Section 2.3.

2.5. False Positive Verification of the Detection Assay Using Propidium Monoazide

The prepared bacterial suspensions with concentrations of 107, 106, 105, 104, 103, 102, and 101 cfu/mL were used as templates to detect the heat-lethal bacteria using traditional PCR, PMA–PCR, and the spread plate method to verify the false positives using PMA–PCR.

2.6. Detection of Different Ratios of Live/Dead Bacteria Mixture Using Propidium Monoazide

Suspensions of dead and live bacteria, each with a concentration of 1 × 107 cfu/mL, were prepared as described in Section 2.1. Various proportions of live and dead bacteria were then mixed to achieve the following ratios of live bacteria in 1 mL of bacterial suspension: 0%, 0.1%, 1%, 10%, 50%, and 100% (live/dead bacteria were mixed as 1:1, 1:9, 1:99, 1:999, and 0:1). The detection was conducted using the established PMA–PCR method.

2.7. Actual Sample Detection

Branch samples showing suspected symptoms of kiwifruit canker disease were collected from 10 different kiwifruit planting sites (Table 2). The samples of asymptomatic leaves or branches under rain-shelter cultivation and open-air cultivation for seasonal detection were collected from four orchards in Dujiangyan City, Sichuan using the random sampling method (in total, there were 1040 samples). The leaves of kiwifruit began to drop due to brown spot disease in September, and no samples were collected from this time. In late November, pruning and binding on the kiwifruit branches were carried out in the field. To minimize damage as much as possible, sampling was avoided to reduce sample collections since this fieldwork could cause wounds to the trees and potentially induce further diseases. Branches were taken at a length of 15 cm from the lower end of the morphology. After these samples were surface washed with running water and 75% alcohol, they were cut into small pieces (5 × 5 mm), treated with 75% alcohol for 30 s and 10% sodium hypochlorite for 2 min, and then washed with sterile water thrice. Three grams of treated small fragments was placed in 50 mL tubes, 30 mL of sterile PBS was added, and then, they were shaken in a 150 rpm/min shaker for 3 h at 25 °C. The extraction was centrifuged for 10 min, and the supernatant was poured away before being precipitated with 1mL sterile water thrice for the traditional PCR, PMA–PCR, or spread plate method. Three replicates were set for each site.

3. Results

3.1. Thermal Lethal Time Identification of Psa Cells

Heat treatments can result in dead bacteria with various degrees of cell membrane permeability. To confirm the complete inactivation of Psa strain MJ2107 using the PMA–PCR assay for specifically detecting live bacteria, the spread plate method was used (Table 3). The results showed that the number of bacterial colonies decreased with the increase in treatment time. MJ2107 exposed to a temperature of 100 °C for 15 min or more showed no cellular growth in LB agar medium, confirming bacterial cell inactivation and ensuring complete non-viability in the samples.

3.2. Comparison of the Amplification and Sensitivity of Specific Primers

Bacterial suspensions and DNA exactions were used as templates; PsaF/R and HopZ5F/R were the specific primers, whose fragment sizes were 312 bp and 520 bp, respectively. The results are shown in Figure 1, from which the different sensitivities of PsaF/R and HopZ5F/R were observed; PsaF/R had a higher sensitivity. The lower detection limit for the bacterial suspension was determined to be 10 cfu/mL, while a detection limit for DNA was established at 1 pg/µL. Consequently, the PsaF/R primer (designed from hopZ3) was selected as the subsequent detection primer. In addition, the hopZ3 gene sequences of twenty known Psa strains were downloaded from the NCBI database along with the sequence of PCR products with a high homology, which reached 99.68–100% (Table 4 and Figure A1). Twenty strains were amplified for specificity detection using the PsaF/R primer. The results showed that all Psa strains could amplify a specific band of 312 bp, while the other 10 non-target strains did not produce any amplified bands (Figure 2). It showed that the PsaF/R primer had a good specificity and high sensitivity.

3.3. Determination of Experimental Conditions for Propidium Monoazide in Viability Assays

The concentration of PMA used in this study was determined by detecting Psa at a concentration of 107 cfu/mL (Figure 3). The findings indicated that, as the concentration of PMA increased, more PMA bound to the DNA of heat-killed bacterial cells, leading to a gradual weakening and eventual disappearance of the brightness of the target fragment. Specifically, when the concentration of PMA exceeded 10 μg/mL, the brightness of the target fragment began to diminish significantly, suggesting that PCR amplification for heat-lethal bacterial cells was completely inhibited. Consequently, it was established that the maximum PMA concentration required for the complete inhibition of PCR amplification for heat-lethal bacterial cells is 10 μg/mL.
However, it should be noted that excessively high PMA concentrations could adversely affect viable bacteria, and its effect would be increasingly pronounced with rising concentrations of PMA. When the concentration remained at or below 20 μg/mL, there was no significant impact on live bacteria, as evidenced by the consistent brightness levels in the target fragments, indicating that PMA did not inhibit DNA amplification from live bacteria. In contrast, once PMA concentrations surpassed 20 μg/mL, its effects on viable bacteria became evident, and their expansion was notably inhibited. Therefore, the optimal concentration for PMA–PCR to detect viable Psa cells was established at 10 μg/mL.
The dark incubation time of the bacterial suspension was evaluated (Figure 4). The findings indicated that the brightness of the target fragments remained constant throughout all dark incubation treatments. In contrast, the brightness of the target fragment of dead bacterial cells exhibited variability in relation to the duration of dark incubation. Specifically, when the dark incubation time was less than 8 min, the brightness of the target fragment diminished. At dark incubation times of 8 and 10 min, the target fragment completely disappeared. However, when the dark incubation time exceeded 10 min, the target fragment reappeared. Therefore, when PMA was used to treat the bacteria in darkness for less than 8 min or for more than 10 min, it failed to completely suppress the DNA of the dead bacteria. However, a dark incubation period of 8 to 10 min could completely inhibit the amplification of the DNA of dead bacteria.
The bacterial suspension with PMA was exposed for different times (Figure 5). The brightness of the target fragment of the live bacteria did not change over time (Figure 5a). In contrast, as the exposure time increased, the brightness of the target fragment of heat-killed bacteria decreased gradually (Figure 5b). At 20 min or longer, the target fragment completely disappeared. The results indicated that the optimal exposure time for the PMA–PCR detection of heat-killed Psa bacterial cells was 20 min, which fully suppressed the PCR amplification of dead bacteria while having no impact on live ones.

3.4. Detection of the Live Bacterial Cells in the Mixed Samples with Dead Cells Using Propidium Monoazide

In mixed samples of heat-lethal and live bacterial cells with different proportions, the detection results of the live bacteria can be seen in Figure 6. We found that live bacterial cells in the mixed samples with different proportions of dead cells were all positive. As the proportion of dead bacteria increased, the target fragments darken. The target disappeared when the percentage of dead bacterial cells accounted for 100%. It showed that the PMA–PCR assay could be used to detect the viable bacteria in a mixed cell suspension with dead bacteria.

3.5. False Positive Verification of the Assay Using Propidium Monoazide

Inactivated Psa cells were detected using the traditional PCR, PMA–PCR, and spread plate methods to verify whether false positives could be generated by PMA–PCR (Table 5). The detection results of PMA–PCR and spread plate counting were negative, while the conventional PCR showed a positive result. This indicated that PMA–PCR could distinguish between dead and viable Psa cells; the reliability of the results was verified using the spread plate method.

3.6. Detection of Actual Samples in the Field Using Propidium Monoazide

Ten branch samples exhibiting pronounced canker symptoms were collected from the field, and viable Psa cells were detected using PMA–PCR (Table 6). The results indicated that the control treatments of PMA–PCR were negative, demonstrating that the DNA amplification of dead Psa cells in the heat-killed samples was completely inhibited and could not be detected. Samples obtained from Chongzhou (B8) and Aba (B9) yielded negative results for both the PMA–PCR and spread plate culture methods. Conversely, the remaining eight samples were positive according to the PMA–PCR and spread plate culture methods. All samples were positive except for those from Chongzhou according to normal PCR. These findings suggested that the samples from Chongzhou were uninfected with Psa, while those from Aba contained dead Psa cells, whose nucleic acids were still detectable. Consequently, PMA–PCR served as a rapid and precise method for detecting live pathogen cells in kiwifruit branch samples, offering an effective alternative to traditional spread plate culture methods.
Additionally, the viable Psa populations on the branches and leaves of kiwifruit were detected using the PMA–PCR method for both rain-shelter and open-air cultivation (Table 7). The results indicated that the detection rates of live bacteria on branches and leaves varied across different periods as well as between the two cultivation modes. From January to April, the detection rate of live bacteria in branches under open-air cultivation was significantly higher than that observed under rain-shelter conditions, with a peak occurring in April (which was also noted in leaves). During May to December, there were minimal differences in the detection rates of viable Psa bacteria between the two cultivation methods. At the same time, it was noteworthy that, from January to April, particularly under rain-shelter conditions, the detection rate remained higher. There was a period during May in which the viable Psa bacterial cells declined, and the prevalence of kiwifruit canker disease started to diminish. These findings suggest that the PMA–PCR method effectively monitors dynamic changes in Psa throughout this disease cycle while filtering out influences from dead bacterial cells.

4. Discussion

Pseudomonas syringae pv. actinidiae is the pathogen causing bacterial canker disease in red-fleshed and yellow-fleshed kiwifruit. This pathogen has inflicted significant economic damage in countries, including Italy and New Zealand, where kiwifruit constitutes a primary agricultural product, as well as causing substantial losses in France, Spain, Portugal, Chile, China, South Korea, and Japan. In a short time, bacterial canker has emerged as a widespread plant disease, causing great losses to kiwifruit production systems [12,18,40,41,42,43]. The effective diagnosis and detection of pathogens are crucial steps in controlling bacterial diseases. As a phytosanitary pathogen, the accurate detection of live Pseudomonas syringae pv. actinidiae to prevent its dissemination is particularly important. Furthermore, the importance of early detection and prevention strategies concerning kiwifruit canker disease is supported [44,45,46]. Fround et al. [47] found that the timely improvement in management measures after the first detection of Psa in kiwifruit orchards could help improve productivity by establishing a multivariate linear regression interpretation model. Cacioppo et al. [48] measured soil and climate parameters using two sensing systems (’OsiriS’ and ’OttaviO’) to predict Psa infection for copper treatment time and found that this early diagnosis resulted in a 60% reduction in canker symptoms and reduced treatment costs [49]. In previous studies, multiple assays, containing the spread plate count method and molecular biology, were widely used to detect the pathogen of kiwifruit canker disease. Among these molecular biology methods, in 1994, Scortichini [50] identified Pseudomonas syringae pv. actinidiae based on the physiological morphological characteristics and pathogenicity. Subsequently, diversified techniques such as PCR restriction fragment length polymorphism analysis, real-time quantitative PCR, and nested PCR were used to identify and detect Psa [17,18,23,42,51,52,53,54]. However, there are few reports on the detection of live bacteria, and the results are often susceptible to false positives. The accurate and sensitive identification of pathogenic bacterial conditions is crucial for developing and implementing effective control measures against plant diseases. In particular, the absence of false positive results is paramount when testing quarantine agents because samples showing false positives are considered to pose no threat to plant disease epidemiology. Although false positive samples themselves are not a threat to the plant, the occurrence of false positive samples may mislead kiwifruit growers when judging the prevalence of the disease, leading to the adoption of inappropriate prevention and control strategies, such as the overuse of agricultural chemicals, as well as unreasonable pruning and quarantine. These unnecessary strategies may cause growers to suffer significant economic losses in terms of control cost, yield loss, and market sales as well as have a significant negative impact on the economic benefits of the kiwifruit industry, which is not conducive to its sustainable development [25,55,56]. Furthermore, epidemiological studies of plant diseases necessitate more reliable data regarding pathogenic bacteria populations to effectively model their occurrence and spread.
Propidium monoazide (PMA) is a fluorescent dye that is capable of inhibiting the DNA amplification of dead bacterial cells during PCR processes. The underlying principle involves enhanced membrane permeability in dead bacterial cells, and PMA can penetrate these membranes and bind to the DNA of dead cells, thereby preventing its amplification during PCR [57]. Combining PMA and polymerase chain reaction (PCR) for pathogen detection effectively avoids the false positives that are commonly associated with normal PCR, accurately allowing for the diagnosis of plant diseases and facilitating the formulation of effective management strategies. Consequently, leveraging the characteristics of PMA, a rapid and efficient detection method for Psa, via PMA–PCR can be established.
PMA–PCR has been extensively utilized in detecting foodborne pathogenic microorganisms as well as medical pathogens [58,59,60,61,62]. It has also been reported that PMA–PCR is applied to detect plant pathogenic bacteria. Gao et al. [63] and Yu et al. [30] established a method for detecting Ralstonia solanacearum, which includes viable but nonculturable (VBNC) bacteria, using PMA combined with PCR (PMA–PCR). Zhao et al. [64] demonstrated that live cells responsible for bacterial fruit spot in watermelon were detectable via PMA–PCR. Additionally, Yu et al. [35] developed a PMA–PCR method specifically designed to assess cell viability in Streptosporium oryzae associated with rice bacterial stripe disease, effectively distinguishing between live and dead cells of Streptosporium oryzae.
Among the molecular biology techniques developed for Psa, Zhou et al. [65] developed a method combining ethidium monoazide (EMA) with quantitative PCR (qPCR) to detect live Psa. Although EMA and PMA exhibited similar functionalities, a small amount of EMA molecules could permeate the cell membrane of viable bacteria and were toxic to the cells, potentially compromising the reliability of the results. In our study, we employed PMA to effectively eliminate the errors associated with EMA. Xiao et al. [66] utilized a PMA–qPCR methodology (with mRNA as template) to detect live Psa-V, which was an important pathogen responsible for kiwifruit canker disease in Shaanxi Province, with a higher PMA concentration at 105 μg/mL compared to the concentration of 10 μg/mL used in our study. This discrepancy may stem from variations in template treatment used during detection processes. Moreover, when the concentration of pathogens and other bacterial compositions in actual samples from the field are unknown, PMA is unreliable for the quantitative determination of cell viability [67]. Nevertheless, PMA is reliable for qualitative determination in dead vs. live cells, and our findings aligned closely with those observed in other Gram-negative bacteria using PMA–PCR. Of all the tested strains in this study, Pss and Pv were reported to cause diseases with symptoms that were similar to canker symptoms in kiwifruit by Psa, although the incidence rates were relatively low [17,28,68,69,70]. For disease treatments, there are some differences between them and Psa. The violent reactions are applied for controlling Psa, while moderate management is applied for Pss and Pv because of their different harmful degrees and infrequent distribution in kiwifruit orchards [28,71]. The rest of the tested strains are not pathogenic bacteria in kiwifruit, although they are closely related to or co-colonized with Psa. Therefore, the correct distinction between Psa and other similar bacteria is particularly important. In our study, the specificity of the PsaF/R primer was very robust, effectively distinguishing Psa from other pathogenic bacteria of Pseudomonas (syringae) populations (Figure 2). These findings are largely in agreement with previous studies [18,28]. Furthermore, with effector HopZ3 as the specific target, a lower limit of detection for bacterial suspensions was observed at 10 cfu/mL with DNA concentrations at 1 pg/μL, which enabled effective identification even at low concentrations of living cells, which is suitable for samples exhibiting low infection levels.
To further assess practical applicability, ten field samples suspected to have kiwifruit canker disease were selected for detection. Eight out of the ten suspected samples in the field showed positive results based on PMA–PCR, which was more specific than normal PCR and could avoid false positives. Simultaneously, the consistency and dependability of the PMA–PCR detections were confirmed using the spread plate method. The PMA–PCR assay also offered a shorter detection time than the spread plate counting method and could reliably indicate whether the suspected sample contains live pathogenic bacteria. Furthermore, the detection of viable Psa on asymptomatic kiwifruit tissues using PMA–PCR was developed in our study. Due to low temperature and high humidity as well as rainy weather and freezing damage, the resistance of the tree is decreased, which is conducive to the invasion and rapid propagation of Psa [72,73].
During January to April, the detection rates of viable Psa were at a high level due to the amount of Psa that had invaded the kiwifuit [74,75,76]; a significant decrease occurred in May because of the rising temperatures under open-air cultivation [77], while there was only a slight difference under rain-shelter cultivation in this study. Although there was a little recovery in autumn [72], it still remained at a low level. All the phenomena were substantially consistent with the occurrence pattern of kiwifruit canker disease [73], and it was proven that the PMA–PCR method could accurately determine the occurrence of field diseases in real time. Therefore, PMA–PCR is a technique that can be used to detect Pseudomonas syringae pv. actinidiae with high specificity, efficiently monitor the early occurrence and development of kiwifruit canker disease, and prevent long-distance transmission through pollens, fruits, seedlings, and other ways.

5. Conclusions

In this study, the specificity and sensitivity of the PsaF/R primer were detected, which could specifically detect Psa. In addition, we successfully established PMA–PCR as a method for detecting live Psa cells, and actual field samples could be detected to prove the feasibility of this method. This approach not only offers a rapid and targeted means of identifying live Psa cells but also serves as a reference for the swift preliminary screening of this pathogen’s activity in laboratory settings. Furthermore, it provides a theoretical foundation for the prevention and control of kiwifruit canker disease and has good application prospects.

Author Contributions

Conceptualization: Y.L. (Yi Luo); methodology: Y.L. (Yi Luo); software: Y.L. (Yi Luo) and W.L.; validation: Y.L. (Yi Luo), W.L. and K.Y.; formal analysis: Y.L. (Yi Luo), S.Z. and G.G.; investigation: Y.L. (Yi Luo), W.L., Y.L. (Yue Li), R.Y. and W.C.; resources: Y.L. (Yi Luo), K.Y., C.W. and G.G.; data curation: G.G. and Y.L. (Yi Luo); writing—original draft preparation: Y.L. (Yi Luo); writing—review and editing: Y.L. (Yi Luo) and S.Z.; visualization: Y.L. (Yi Luo); supervision: M.M. and G.G.; project administration: G.G.; funding acquisition: G.G. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Key R&D Program of China, grant number 2022YFD1400200.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are available upon request from the authors.

Acknowledgments

The authors would like to thank the Dujiangyan Kiwifruit Association for helpful materials used in our experiments; thanks also go to Xichang University for providing the author (Y.L. (Yi Luo)) with study opportunities and tuition support.

Conflicts of Interest

The authors declare no conflicts of interest.

Appendix A

Table A1. Psa strains used in this study.
Table A1. Psa strains used in this study.
NumberStrainHost or CultivarTissueSite
1MJ2107Hort16Aleaves104.13° E, 31.39° N
2CX1101Hongyang branches105.93° E, 31.73° N
3AB2101Xuxiang leaves103.43° E, 30.94° N
4DH2101Hongyangleaves103.70° E, 31.00° N
5DS2102Hongyangleaves103.73° E, 31.02° N
6DF2101Hongyangleaves103.74° E, 31.02° N
7MP2101Hongyangleaves104.13° E, 31.39° N
8MN2101Hongyangcanes104.13° E, 31.39° N
9QL0102Hongyangbranches103.57° E, 30.38° N
10YA1801Hongyangbranches102.94° E, 30.16° N
Figure A1. Nucleotide sequences and alignments of the partial hopZ3 gene according to the PsaF/R primer.
Figure A1. Nucleotide sequences and alignments of the partial hopZ3 gene according to the PsaF/R primer.
Cimb 47 00103 g0a1

References

  1. Richardson, D.P.; Ansell, J.; Drummond, L.N. The nutritional and health attributes of kiwifruit: A review. Eur. J. Nutr. 2018, 57, 2659–2676. [Google Scholar] [CrossRef] [PubMed]
  2. Yao, K.K.; Zhu, Y.H.; Chen, W.; Luo, Y.; Chen, H.B.; Gong, G.S. A Preliminary report on the main control technology and application of kiwifruit canker in Sichuan Province. China Fruits 2024, 85–92+107. [Google Scholar] [CrossRef]
  3. Scortichini, M.; Marcelletti, S.; Ferrante, P.; Petriccione, M.; Firrao, G. Pseudomonas syringae pv. actinidiae: A re-emerging, multi-faceted, pandemic pathogen. Mol. Plant Pathol. 2012, 13, 631–640. [Google Scholar] [CrossRef] [PubMed]
  4. Vanneste, J.L. The scientific, economic, and social impacts of the New Zealand outbreak of bacterial canker of kiwifruit (Pseudomonas syringae pv. actinidiae). Annu. Rev. Phytopathol. 2017, 55, 377–399. [Google Scholar] [CrossRef]
  5. You, Y.X.; Dai, D.J.; Luo, J.Y.; Zhu, J.; Li, B. Research status and prospect of strategies for controlling kiwifruit canker disease. Zhejiang Agric. Sci. 2022, 63, 1322–1328, 1331. [Google Scholar] [CrossRef]
  6. Li, Y.; Cheng, H.Y.; Fang, S.M.; Qian, Z.H. A preliminary study on the prevalence prediction of kiwifruit bacterial canker disease. J. Appl. Ecol. 2001, 12, 359–362. Available online: https://kns.cnki.net/kcms2/article/abstract?v=xyKmmUzEPx3rmmTQLsmXZLBB_w63TegaEeznRdhIslq76TmQAVXHgQzOF9dCZGMsmCz8m9H4trODSgVDD1C9ASNr4wnIEWSF_bsw03gOjKrxIR7MBMyYmNHRE0PmdvixnCdWRlGkozcZG7TffaFH04Uqj38hPkhwGoCpNt7jErKGzJjJODtLXcIpQpJZ2P7q&uniplatform=NZKPT&laguage=CHS (accessed on 1 November 2024).
  7. Chapman, J.R.; Taylor, R.K.; Weir, B.S.; Romberg, M.K.; Vanneste, J.L.; Luck, J.; Alexander, B.J.R. Phylogenetic relationships among global populations of Pseudomonas syringae pv. actinidiae. Phytopathology 2012, 102, 1034–1044. [Google Scholar] [CrossRef] [PubMed]
  8. Sawada, H.; Miyoshi, T.; Ide, Y. Novel MLSA group (Psa5) of Pseudomonas syringae pv. actinidiae causing bacterial canker of kiwifruit (Actinidia chinensis) in Japan. Jpn. J. Phytopathol. 2016, 80, 171–184. [Google Scholar] [CrossRef][Green Version]
  9. Fujikawa, T.; Sawada, H. Genome analysis of the kiwifruit canker pathogen Pseudomonas syringae pv. actinidiae biovar 5. Sci. Rep. 2016, 6, 21399. [Google Scholar] [CrossRef]
  10. Cunty, A.; Poliakoff, F.; Rivoal, C.; Cesbron, S.; Fischer-Le Saux, M.; Lemaire, C.; Jacques, M.A.; Manceau, C.; Vanneste, J.L. Characterization of Pseudomonas syringae pv. actinidiae (Psa) isolated from France and assignment of Psa biovar 4 to a de novo pathovar: Pseudomonas syringae pv. actinidifoliorum pv. nov. Plant Pathol. 2015, 64, 582–596. [Google Scholar] [CrossRef]
  11. Everett, K.R.; Taylor, R.K.; Romberg, M.K.; Rees-George, J.; Manning, M.A. First report of Pseudomonas syringae pv. actinidiae causing kiwifruit bacterial canker in New Zealand. Australas. Plant Dis. Notes 2011, 6, 67–71. [Google Scholar] [CrossRef]
  12. EPPO. First Report of Pseudomonas syringae pv. actinidiae in Chile. EPPO Rep. Serv. 3: 2011/055. Available online: https://gd.eppo.int/reporting/article-137 (accessed on 12 October 2024).
  13. Sawada, H.; Shimizu, S.; Miyoshi, T.; Shinozaki, T.; Kusumoto, S.; Noguchi, M.; Naridomi, T.T.; Kikuhara, K.; Kansako, M.; Fujikawa, T. Characterization of biovar 3 strains of Pseudomonas syringae pv. actinidiae isolated in Japan. Jpn. J. Phytopathol. 2015, 81, 111–126. [Google Scholar] [CrossRef][Green Version]
  14. He, R.; Liu, P.; Jia, B.; Xue, S.; Wang, X.; Hu, J.; Al Shoffe, Y.; Gallipoli, L.; Mazzaglia, A.; Balestra, G.M.; et al. Genetic diversity of Pseudomonas syringae pv. actinidiae strains from different geographic regions in China. Phytopathology 2019, 109, 347–357. [Google Scholar] [CrossRef]
  15. Koh, Y.J.; Jung, J.S.; Hur, J.S. Current status of occurrence of major diseases on kiwifruits and their control in Korea. Acta Hortic. 2003, 610, 437–443. [Google Scholar] [CrossRef]
  16. Koh, H.S.; Kim, G.H.; Lee, Y.S.; Koh, Y.J.; Jae Sung Jung, J.J. Molecular characteristics of Pseudomonas syringae pv. actinidiae strains isolated in Korea and a multiplex PCR assay for haplotype differentiation. Plant Pathol. J. 2014, 30, 96–101. [Google Scholar] [CrossRef] [PubMed]
  17. Rees-George, J.; Vanneste, J.L.; Cornish, D.A.; Pushparajah, I.P.S.; Yu, J.; Templeton, M.D.; Everett, K.R. Detection of Pseudomonas syringae pv. actinidiae using polymerase chain reaction (PCR) primers based on the 16S-23S rDNA intertranscribed spacer region and comparison with PCR primers based on other gene regions. Plant Pathol. 2010, 59, 453–464. [Google Scholar] [CrossRef]
  18. Balestra, G.M.; Taratufolo, M.C.; Vinatzer, B.A.; Mazzaglia, A. A multiplex PCR assay for detection of Pseudomonas syringae pv. actinidiae and differentiation of populations with different geographic origin. Plant Dis. 2013, 97, 472–478. [Google Scholar] [CrossRef] [PubMed]
  19. Gallelli, A.; Talocci, S.; Pilotti, M.; Loreti, S. Real-time and qualitative PCR for detecting Pseudomonas syringae pv. actinidiae isolates causing recent outbreaks of kiwifruit bacterial canker. Plant Pathol. 2014, 63, 264–276. [Google Scholar] [CrossRef]
  20. Ruinelli, M.; Schneeberger, P.H.H.; Ferrante, P.; Bühlmann, A.; Scortichini, M.; Vanneste, J.L.; Pothier, J.F. Comparative genomics-informed design of two LAMP detection assays for detection of the kiwifruit pathogen Pseudomonas syringae pv. actinidiae and discrimination of isolates belonging to the pandemic biovar 3. Plant Pathol. 2017, 66, 140–149. [Google Scholar] [CrossRef]
  21. Cimmino, A.; Iannaccone, M.; Petriccione, M.; Masi, M.; Evidente, M.; Capparelli, R.; Evidente, A. An ELISA method to identify the phytotoxic Pseudomonas syringae pv. actinidiae exopolysaccharides: A tool for rapid immunochemical detection of kiwifruit bacterial canker. Phytochem. Lett. 2017, 19, 136–140. [Google Scholar] [CrossRef]
  22. Chen, H.; Hu, Y.; Qin, K.Y.; Yang, X.Z.; Jia, Z.J.; Li, Q.; Chen, H.B.; Yang, H. A serological approach for the identification of the effector hopz5 of Pseudomonas syringae pv. actinidiae: A tool for the rapid immunodetection of kiwifruit bacterial canker. J. Plant Pathol. 2018, 100, 171–177. [Google Scholar] [CrossRef]
  23. Barrett-Manako, K.; Andersen, M.; Martínez-Sánchez, M.; Jenkins, H.; Hunter, S.; Reese-George, J.; Montefiori, M.; Wohlers, M.; Rikkerink, E.; Templeton, M.; et al. Real-time PCR and droplet digital PCR are accurate and reliable methods to quantify Pseudomonas syringae pv. actinidiae biovar 3 in kiwifruit infected plantlets. Plant Disesae 2020, 105, 1748–1757. [Google Scholar] [CrossRef] [PubMed]
  24. Yang, Y.T.; Peng, Q.D.; Yang, Y.F.; Zhuang, Q.G.; Xi, D.H. Recombinase polymerase amplification-lateral flow (RPA-LF) assay for rapid visual detection of Pseudomonas syringae pv. actinidiae in kiwifruit. Crop Prot. 2023, 17, 106315. [Google Scholar] [CrossRef]
  25. Mou, G.P.; Hu, J.Y.; Xu, R.; Li, K.J.; Luo, J.H.; Wei, S.; Xiao, B.J.; Yi, J.P. Evaluation of PCR detection methods for Clavibacter michiganensis subsp. nebraskensis in imported maize. Plant Quar. 2023, 37, 17–26. [Google Scholar] [CrossRef]
  26. Zhang, C.; Liu, X.; Chen, J.L. Detection of viable Salmonella by real-time fluorescence quantitative RT-PCR. Food Sci. Technol. 2012, 33, 91–94. [Google Scholar] [CrossRef]
  27. Shi, Y.P.; Chen, D.S.; Wang, Y.; Chen, B.; Yang, Y.; Zhang, P.F.; Li, C.; Shao, L. Advances in the researches on PMA-PCR technology. China Anim. Health Insp. 2023, 40, 72–78. [Google Scholar] [CrossRef]
  28. Zhao, J.Y.; Hu, J.X.; Zhang, Y.; Liu, P.; Tang, F.; Liao, F. Establishment of detection method for viable cells of Acidovorax avenae subsp. citrulli with PMA-PC. China Plant Prot. 2015, 35, 12–15. [Google Scholar] [CrossRef]
  29. Kong, W.W.; Li, Y.L.; Wang, J.Q.; Liu, T.T.; Chen, N.; Jin, Y.; He, X.Q. The establishment of PMA-qPCR for detecting bacterial angular leaf ppot on cucumber andits preliminary application. Biotechnol. Bull. 2016, 32, 70–75. [Google Scholar] [CrossRef]
  30. Yu, X.L.; Xu, J.; Zhang, H.; Xu, J.S.; Huang, W.; Hu, X.M.; Feng, J.; Wang, X.L. Rapid detection of viable but non-culturable (VBNC) Ralstonia solanacearum by PMA-PCR method. Plant Prot. 2016, 42, 144–149. [Google Scholar] [CrossRef]
  31. Yuan, Y.Z.; Han, J.; Wang, Y.; Luo, M.; Bao, H.F.; Zhang, C.Z.; Huang, W. Establishment of rapid quantitative detection of viable Erwinia amylovora. J. Fruit Sci. 2020, 37, 1425–1433. [Google Scholar] [CrossRef]
  32. Yu, X.; Wang, W.F.; Li, X.F.; Feng, L.X.; Qian, Y.K.; Zhang, C.; Wei, S. PMA-qPCR assay for the detection of viable Pseudomonas syringae pv. maculicola. Plant Quar. 2021, 35, 49–54. [Google Scholar] [CrossRef]
  33. Zhang, J.L.; Qi, S.; Luan, X.B.; Jin, Y.B.; Huang, C.J.; Li, P.; Wei, J.Y.; Yan, J. Method for rapid detection of Fusarium oxysporum and Phytophthora parasitica var. nicotianae in tabacco planting soil. Guangdong Agric. Sci. 2022, 49, 101–108. [Google Scholar]
  34. Chai, A.; Wang, Q.C.; Kang, H.J.; Yan, L.Y.; Huang, Y.P.; Shi, Y.X.; Xie, X.W.; Li, L.; Fan, T.; Wang, Y.H.; et al. Rapid quantification of infectious cucumber green mottle mosaic virus in watermelon tissues by PMA Coupled with RT-qPCR. Viruses 2022, 14, 2046. [Google Scholar] [CrossRef]
  35. Yu, G.C.; Zhao, Y.Q.; Jiang, P.; Tian, Y.L.; Hu, B.S. Establishment and preliminary application of PMA-PCR method for the detection of cell activity of bacterial streptosporium oryza. Acta Phytophtopathology Sin. 2023, 53, 944–949. [Google Scholar] [CrossRef]
  36. Panth, M.; Noh, E.; Schnabel, G.; Wang, H. Development of a long amplicon PMA-qPCR assay for detection of viable Xanthomonas arboricola pv. pruni cells in peach trees. Plant Dis. 2024, 108, 2190–2196. [Google Scholar] [CrossRef]
  37. Wang, H.; Turechek, W. Detection of viable Xanthomonas fragariae cells in strawberry using propidium monoazide and long-amplicon quantitative PCR. Plant Dis. 2020, 104, 1105–1112. [Google Scholar] [CrossRef] [PubMed]
  38. Immanuel, T.; Taylor, R.; Keeling, S.E.; Brosnahan, C.L.; Alexander, B.J. Discrimination between viable and dead Xanthomonas fragariae in strawberry using viability PCR. J. Phytopathol. 2020, 168, 363–373. [Google Scholar] [CrossRef]
  39. Hu, Y.; Chen, H.; Yang, X.Z.; Li, Q.; Yang, H. Characterization of polyclonal antibody against Pseudomonas syringae pv. actinidiae effector Hopz5 by enzyme linked lmmunoabsorbent assay. Biotechnol. Bull. 2018, 34, 84–89. [Google Scholar] [CrossRef]
  40. Vanneste, J.L.; Yu, J.; Cornish, D.A.; Tanner, D.J.; Windner, R.; Chapman, J.R.; Taylor, R.K.; Mackay, J.F.; Dowlut, S. Identification, virulence, and distribution of two biovars of Pseudomonas syringae pv. actinidiae in New Zealand. Plant Dis. 2013, 97, 708–719. [Google Scholar] [CrossRef] [PubMed]
  41. Bartoli, C.; Lamichhane, J.R.; Berge, O.; Guilbaud, C.; Varvaro, L.; Balestra, G.M.; Vinatzer, B.A.; Morris, C.E. A framework to gauge the epidemic potential of plant pathogens in environmental reservoirs: The example of kiwifruit canker. Mol. Plant Pathol. 2015, 16, 137–149. [Google Scholar] [CrossRef]
  42. Abelleira, A.; Ares, A.; Aguin, O.; Peñalver, J.; Morente, M.C.; López, M.M.; Sainz, M.J.; Mansilla, J.P. Detection and characterization of Pseudomonas syringae pv. actinidifoliorum in kiwifruit in Spain. J. Appl. Microbiol. 2015, 119, 1659–1671. [Google Scholar] [CrossRef] [PubMed]
  43. McCann, H.C.; Li, L.; Liu, Y.; Li, D.; Pan, H.; Zhong, C.; Rikkerink, E.H.A.; Templeton, M.D.; Straub, C.; Colombi, E.; et al. Origin and evolution of the kiwifruit canker pandemic. Genome Biol. Evol. 2017, 9, 932–944. [Google Scholar] [CrossRef]
  44. Reis-Pereira, M.; Tosin, R.; Martins, R.C.; Dos Santos, F.N.; Tavares, F.; Cunha, M. Enhancing kiwi bacterial canker leaf assessment: Integrating hyperspectral-based vegetation indexes in predictive modeling. Eng. Proc. 2023, 48, 22. [Google Scholar] [CrossRef]
  45. Hu, S.Q.; Dai, D.J.; Luo, J.Y.; Zhu, J.; An, Q.L.; Li, B. Analysis of diversity and detection technology of kiwifruit bacterial canker pathogen. J. Zhejiang Agric. Sci. 2022, 63, 2652–2657. [Google Scholar] [CrossRef]
  46. Zhu, H.Y.; An, C.; Li, B.; Liu, C. Research progress of pathogenic bacteria and detection methods of kiwifruit canker disease. Shaanxi Agric. Sci. 2013, 59, 141–145+153. [Google Scholar] [CrossRef]
  47. Froud, K.J.; Beresford, R.M.; Cogger, N.C. Impact of kiwifruit bacterial canker on productivity of cv. hayward kiwifruit using observational data and multivariable analysis. Plant Pathol. 2018, 67, 671–681. [Google Scholar] [CrossRef]
  48. Cacioppo, O.; Marcon, M.; Tacconi, G. Pedoclimatic web monitoring system for Pseudomonas syringae pv. actinidiae (Psa) and orchard management. Acta Horticutrea 2015, 1095, 129–134. [Google Scholar] [CrossRef]
  49. Cameron, A.; De Zoysa, G.H.; Sarojini, V. Antimicrobial peptides against Pseudomonas syringae pv. actinidiae and Erwinia amylovora: Chemical synthesis, secondary structure, efficacy, and mechanistic investigations. Biopolymers 2014, 102, 88–96. [Google Scholar] [CrossRef] [PubMed]
  50. Scortichini, M. Occurrence of Pseudomonas syringae pv. actinidiae on kiwifruit in Italy. Plant Pathol. 1994, 43, 1035–1038. [Google Scholar] [CrossRef]
  51. Biondi, E.; Galeone, A.; Kuzmanovi’c, N.; Ardizzi, S.; Lucchese, C.; Bertaccini, A. Pseudomonas syringae pv. actinidiae detection in kiwifruit plant tissue and bleeding sap. Ann. Appl. Biol. 2013, 162, 60–70. [Google Scholar] [CrossRef]
  52. Zhu, D.; Cao, F.; Gao, G.T.; Wang, D.; Xu, Y.F.; Du, Y.L.; Zhang, X.; Li, C.Z.; Sun, Q.; Zhou, M.N. Research of rapid detection on Pseudomonas syringae pv. actinidiae from the surface of kiwifruit during the storage period. J. Nucl. Agric. Sci. 2017, 31, 493–499. [Google Scholar] [CrossRef]
  53. Garcia, E.; Moura, L.; Abelleira, A.; Aguín, O.; Ares, A.; Mansilla, P. Characterization of Pseudomonas syringae pv. actinidiae biovar 3 on kiwifruit in north-west Portugal. J. Appl. Microbiol. 2018, 125, 1147–1161. [Google Scholar] [CrossRef] [PubMed]
  54. Pei, Y.G.; Ma, L.; Zheng, X.J.; Yao, K.K.; Fu, X.R.; Chen, H.B.; Chang, X.L.; Zhang, M.; Gong, G.S. Identification and Genetic Characterization of Pseudomonas syringae pv. actinidiae from Kiwifruit in Sichuan, China. Plant Dis. 2023, 107, 3248–3258. [Google Scholar] [CrossRef]
  55. Andersen, M.T.; Templeton, M.D.; Rees-George, J.; Vanneste, J.L.; Cornish, D.A.; Yu, J.; Cui, W.; Braggins, T.J.; Babu, K.; Mackay, J.F.; et al. Highly specific assays to detect isolates of Pseudomonas syringae pv. actinidiae biovar 3 and Pseudomonas syringae pv. actinidifoliorum directly from plant material. Plant Pathol. 2018, 67, 1220–1230. [Google Scholar] [CrossRef]
  56. Hao, F.M.; Ding, W.H.; Ma, E.L.; Yan, L.Y.; Huang, Y.P.; Wang, Y.H.; Zang, J.Y. Rapid detection of viable bacteria of bacterial fruit spot by PMA-qPCR. Zhejiang Agric. Sci. 2023, 64, 664–669. [Google Scholar] [CrossRef]
  57. Nocker, A.; Cheung, C.Y.; Camper, A.K. Comparison of propidium monoazide with ethidium monoazide for differentiation of live vs dead bacteria by selective removal of DNA from dead cells. J. Microbiol. Methods 2006, 67, 310–320. [Google Scholar] [CrossRef] [PubMed]
  58. Xu, G.Y.; Fu, L.Z.; Long, X.F.; Chen, C.H.; Li, P.F.; Zhang, S.H. Establishment of PMA-PCR detection method for Corynebacterium pseudotuberculosis in Goat. Mod. J. Anim. Husb. Vet. Med. 2018, 11, 9–13. [Google Scholar]
  59. Chayapa, T.; Doris, H.D. Propidium monoazide for viable salmonella enterica detection by pcr and lamp assays in comparison to RNA-based RT-PCR, RT-LAMP, and culture-based assays. J. Food Sci. 2020, 85, 3509–3516. [Google Scholar] [CrossRef]
  60. Li, Y.; Huang, T.Y.; Mao, Y.; Chen, Y.; Liu, J. Study on the viable but non-culturable (VNBC) state formation of staphylococcus aureus and its control in food system. Front. Microbiol. 2020, 11, 599739. [Google Scholar] [CrossRef]
  61. Liang, T.B.; Long, H.; Wang, D.; Zhang, W.; Zhan, Z.X.; Wu, X. Simultaneous detection of Salmonella spp. and S. aureus in donkey-hide products based on PMA-mqPCR. Mod. Food 2021, 199–204+223. [Google Scholar] [CrossRef]
  62. Wang, P.; Liang, L.; Peng, X.; Qu, T.; Zhao, X.; Ji, Q.; Chen, Y. Sodium deoxycholate-propidium monoazide droplet digital PCR for rapid and quantitative detection of viable Lacticaseibacillus rhamnosus HN001 in compound probiotic products. Microorganisms 2024, 12, 1504. [Google Scholar] [CrossRef] [PubMed]
  63. Gao, D.F.; Liu, X.; Yang, Y.L. Optimization and preliminary application of PMA-PCR system for detection of viable Ralstonia solanacearum in potato. China Plant Prot. 2017, 37, 5–13. [Google Scholar] [CrossRef]
  64. Zhao, Z.B.; Gao, X.N.; Yang, D.H.; Huang, L.L.; Qin, H.Q.; Kang, Z.S.; Wang, N.N. Field detection of canker-causing bacteria on kiwifruit trees: Pseudomonas syringae pv. actinidiae is the major causal agent. Crop Prot. 2015, 75, 55–62. [Google Scholar] [CrossRef]
  65. Zhou, D.X.; Yin, Y.P.; Wang, Z.K.; Xiong, S. Establishment of a method to rapidly detect only viable cells of Pseudomonas syringae pv. actinidiae by EMA-qPCR. Plant Prot. 2017, 43, 143–148. [Google Scholar] [CrossRef]
  66. Xiao, Y.; Liu, H.Y.; Gao, G.T.; Cao, F.; Ma, Y.P.; Zhao, W.Q.; Lei, Y.S. PMA-qPCR for detecting live bacteria of Shaanxi kiwifruit cancer dominant pathogen. Food Mach. 2019, 35, 48–53+59. [Google Scholar] [CrossRef]
  67. Wang, Y.; Yan, Y.; Thompson, K.; Bae, S.; Accorsi, E.; Zhang, Y.; Shen, J.; Vlamakis, H.; Hartmann, E.; Huttenhower, C. Whole microbial community viability is not quantitatively reflected by propidium monoazide sequencing approach. Microbiome 2021, 9, 17. [Google Scholar] [CrossRef]
  68. Opgenorth, D.C. Pseudomonas canker of kiwifruit. Plant Dis. 1983, 67, 1283–1284. [Google Scholar] [CrossRef]
  69. Serizawa, S.; Ichikawa, T.; Takikawa, Y.; Tsuyumu, S.; Goto, M. Occurrence of bacterial canker of kiwifruit in Japan: Description of symptoms, isolation of the pathogen and screening of bactericides. Jpn. J. Phytopathol. 1989, 55, 427–436. [Google Scholar] [CrossRef]
  70. Zhu, X.X.; Fang, Y.Z.; Liao, X.G. Study on the causal agent of kiwifruit canker disease. Hunan Agric. Sci. 1993, 31–33. [Google Scholar] [CrossRef]
  71. Xiao, R.; Shi, H.; Bu, F.W.; Wang, Y.; He, F.Y.; Wang, R.C. Research progress of kiwifruit disease control. Hunan Agric. Sci. 2021, 116–120. [Google Scholar] [CrossRef]
  72. Marcelletti, S.; Ferrante, P.; Petriccione, M.; Firrao, G.; Scortichini, M. Pseudomonas syringae pv. actinidiae draft genomes comparison reveal strain-specific features involved in adaptation and virulence to Actinidia species. PLoS ONE 2011, 6, e27297. [Google Scholar] [CrossRef] [PubMed]
  73. Zhong, C.H.; Li, L.; Pan, H.; Deng, L.; Chen, M.Y. Occurrence rule and comprehensive control of kiwifruit bacterial canker disease. China Fruits 2020, 1, 9–13+18. Available online: http://lib.cqvip.com/Qikan/Article/Detail?id=7101082277 (accessed on 4 October 2024).
  74. Woodcock, S. A review of research and development undertaken on Psa. Kiwifruit Vine Health 2016, 5, 871–874. [Google Scholar]
  75. Do, K.S.; Chung, B.N.; Joa, J.H. D-PSA-K: A model for estimating the accumulated potential damage on kiwifruit canes caused by bacterial canker during the growing and overwintering seasons. Plant Pathol. J. 2016, 32, 537–544. [Google Scholar] [CrossRef] [PubMed][Green Version]
  76. Qin, Z.; Zhang, J.E.; Jiang, Y.P.; Wang, R.L.; Wu, R.S. Predicting the potential distribution of Pseudomonas syringae pv. actinidiae in China using ensemble models. Plant Pathol. 2020, 69, 120–131. [Google Scholar] [CrossRef]
  77. Wang, R.; Li, Q.; He, S.; Liu, Y.; Wang, M.T.; Jiang, G. Modeling and mapping the current and future distribution of Pseudomonas syringae pv. actinidiae under climate change in China. PLoS ONE 2018, 13, e0192153. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Comparison of the amplification and sensitivity of the effector hopZ3 gene (a) and effector hopZ5 gene (b) specific primers of Psa. Lanes 1–8: bacterial suspension concentrations. Lanes 10–17: DNA concentrations. Lanes 9 and 18: a negative control of sterile water (CK). M: DL2000 marker.
Figure 1. Comparison of the amplification and sensitivity of the effector hopZ3 gene (a) and effector hopZ5 gene (b) specific primers of Psa. Lanes 1–8: bacterial suspension concentrations. Lanes 10–17: DNA concentrations. Lanes 9 and 18: a negative control of sterile water (CK). M: DL2000 marker.
Cimb 47 00103 g001
Figure 2. Specificity detection of the PsaF/R primer. Lanes 1–10: Psa strains. Lanes 11–20: Pst for P. s. pv. tomato, Pss for P. s. pv. syringae, Pth for P. s. pv. theae, Psl for P. s. pv. lachrymans, Pta for P. s. pv. tabaci, Psm for P. s. pv. mori, PsmR for P. s. pv. morsprunorum, Pf for P. fluorescens, Pv for P. viridiflava, and Pl for P. lurida. Lane 21: a negative control of sterile water (CK). M: DL2000 marker.
Figure 2. Specificity detection of the PsaF/R primer. Lanes 1–10: Psa strains. Lanes 11–20: Pst for P. s. pv. tomato, Pss for P. s. pv. syringae, Pth for P. s. pv. theae, Psl for P. s. pv. lachrymans, Pta for P. s. pv. tabaci, Psm for P. s. pv. mori, PsmR for P. s. pv. morsprunorum, Pf for P. fluorescens, Pv for P. viridiflava, and Pl for P. lurida. Lane 21: a negative control of sterile water (CK). M: DL2000 marker.
Cimb 47 00103 g002
Figure 3. Screening of PMA concentration for detecting Psa. Lanes 1–9: the PMA concentrations of detecting viable bacterial cells. Lanes 11–19: the PMA concentrations of detecting dead bacterial cells. Lanes 10 and 20: a negative control of sterile water (CK). M: DL2000 marker.
Figure 3. Screening of PMA concentration for detecting Psa. Lanes 1–9: the PMA concentrations of detecting viable bacterial cells. Lanes 11–19: the PMA concentrations of detecting dead bacterial cells. Lanes 10 and 20: a negative control of sterile water (CK). M: DL2000 marker.
Cimb 47 00103 g003
Figure 4. Effect of different PMA incubation times on Psa. Lanes 1–8: the dark incubation time of heat-lethal bacteria. Lanes 10–17: the dark incubation time of live bacteria. Lane 9: a negative control of sterile water (CK). M: DL2000 marker.
Figure 4. Effect of different PMA incubation times on Psa. Lanes 1–8: the dark incubation time of heat-lethal bacteria. Lanes 10–17: the dark incubation time of live bacteria. Lane 9: a negative control of sterile water (CK). M: DL2000 marker.
Cimb 47 00103 g004
Figure 5. The effect of different PMA exposure times on Psa causing kiwifruit canker disease. (a) Viable bacteria; (b) heat-killed bacteria. Lanes 1–7: exposure time. Lane 8: a negative control of sterile water (CK). M: DL5000 marker.
Figure 5. The effect of different PMA exposure times on Psa causing kiwifruit canker disease. (a) Viable bacteria; (b) heat-killed bacteria. Lanes 1–7: exposure time. Lane 8: a negative control of sterile water (CK). M: DL5000 marker.
Cimb 47 00103 g005
Figure 6. PMA–PCR detection of different proportions of dead and live bacteria in a mixed system. Lanes 1–5: the proportions of the live bacteria and the heat-lethal bacteria. Lane 6: a negative control of sterile water (CK). M: DL2000 marker.
Figure 6. PMA–PCR detection of different proportions of dead and live bacteria in a mixed system. Lanes 1–5: the proportions of the live bacteria and the heat-lethal bacteria. Lane 6: a negative control of sterile water (CK). M: DL2000 marker.
Cimb 47 00103 g006
Table 1. The primer sequences for the molecular identification of Pseudomonas syringae pv. actinidiae.
Table 1. The primer sequences for the molecular identification of Pseudomonas syringae pv. actinidiae.
Primer NameGeneSequence (5′→3′)
PsaFhopZ3CAGAGGCGCTAACGAGGAAA
PsaRCGAGCATACATCAACAGGTCA
HopZ5FhopZ5TCACTCCTAGACTGGAATAC
HopZ5RGGCTATCATGAAGGCTGTCA
Table 2. Actual sample source information.
Table 2. Actual sample source information.
SchemeSiteLatitude (°N)Longitude (°E)Host or Cultivar
B1Xichang 28.09102.04Donghong
B2Qionglai 30.52 103.717Hongyang
B3Pujiang 30.26103.62Hongyang
B4Yaan 30.15102.96Hongyang
B5Dujiangyan 30.92103.61Hongyang
B6Dujiangyan 30.92103.61Hongyang
B7Dujiangyan 30.92103.61Hongyang
B8Chongzhou31.55106.17Hongyang
B9Aba prefecture30.55103.64Hongyang
B10Guangyuan 30.93103.42Cuiyu
Table 3. Screening of the inactivation time of viable bacteria.
Table 3. Screening of the inactivation time of viable bacteria.
Heated Time (min)Number of Bacterial Colonies (cfu/mL)
* CK (0)1 × 107
1110
127
133
142
150
160
170
180
190
200
* CK represents that the Psa strain MJ2107 is not heated at 100 °C.
Table 4. The percent homology analysis between Psa strain MJ2107 and the other twenty Psa strains at the PsaF/R primer binding sites.
Table 4. The percent homology analysis between Psa strain MJ2107 and the other twenty Psa strains at the PsaF/R primer binding sites.
StrainGenbank IDPercent Homology (%)
FTRS_L1DQ986456.199.68
JZY2CP136504.1100
CXP-1MK592610.1100
M228CP032631.1100
Yunnan2.4CP135285.1100
MAFF212211AP019808.1100
Yunnan3.2CP135283.1100
MAFF613020AP019411.1100
CRAFRU14.08CP019732.1100
P155CP032871.1100
ICMP18884CP011972.2100
PSA.AH.01CP116478.1100
ICMP 18708CP012179.1100
CRAFRU12.29CP019730.1100
YXH1CP136506.1100
NZ-45CP017007.1100
MAFF212063CP024712.1100
QSY6CP134066.1100
ICMP 9853CP018202.1100
NZ-47CP017009.1100
Table 5. Comparison of normal PCR, PMA–PCR, and spread plate counting methods for the detection of dead Psa bacteria.
Table 5. Comparison of normal PCR, PMA–PCR, and spread plate counting methods for the detection of dead Psa bacteria.
Psa Concentration
/cfu·mL−1
Normal Polymerase Chain ReactionPMA–Polymerase Chain ReactionSpread Plate Counting
/cfu
107+-0
106+0
105+0
104+0
103+0
1020
1010
Note: “+” means Psa can be detected, which is positive; “−” means Psa cannot be detected, which is negative.
Table 6. Detection of kiwifruit branch samples with kiwifruit canker disease in the field.
Table 6. Detection of kiwifruit branch samples with kiwifruit canker disease in the field.
SampleNormal PCRPMA–PCRPlate CulturePMA–PCR (CK)
B1+++
B2+++
B3+++
B4+++
B5+++
B6+++
B7+++
B8
B9+
B10+++
Note: “CK” represents heat-killed Psa cells. “+” means Psa can be detected, which is positive; “−” means Psa cannot be detected, which is negative.
Table 7. Detection of viable Pseudomonas syringae pv. actinidiae in kiwifruit branch samples over one year in the field using PMA–PCR.
Table 7. Detection of viable Pseudomonas syringae pv. actinidiae in kiwifruit branch samples over one year in the field using PMA–PCR.
Month/TimeRain-Shelter CultivationOpen-Air Cultivation
BranchLeafBranchLeaf
January4/32-12/32-
February5/32-14/32-
March4/321/3214/325/32
April6/3213/3217/3222/32
May3/322/322/323/32
June4/321/322/323/32
July1/120/121/120/12
August2/240/122/240/12
September4/40-2/40-
October5/40-4/40-
November3/40-6/40-
December2/20-3/20-
Total43/36817/15277/36833/152
Note: “-” means no samples because of seasonal leaf falling.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Luo, Y.; Liao, W.; Li, Y.; Chen, W.; Zhong, S.; Wu, C.; Yao, K.; Yang, R.; Ma, M.; Gong, G. A Rapid and Reliable Propidium Monoazide Polymerase Chain Reaction for Detecting Viable Pseudomonas syringae pv. actinidiae. Curr. Issues Mol. Biol. 2025, 47, 103. https://doi.org/10.3390/cimb47020103

AMA Style

Luo Y, Liao W, Li Y, Chen W, Zhong S, Wu C, Yao K, Yang R, Ma M, Gong G. A Rapid and Reliable Propidium Monoazide Polymerase Chain Reaction for Detecting Viable Pseudomonas syringae pv. actinidiae. Current Issues in Molecular Biology. 2025; 47(2):103. https://doi.org/10.3390/cimb47020103

Chicago/Turabian Style

Luo, Yi, Wenfei Liao, Yue Li, Wen Chen, Sen Zhong, Cuiping Wu, Kaikai Yao, Rui Yang, Miaomiao Ma, and Guoshu Gong. 2025. "A Rapid and Reliable Propidium Monoazide Polymerase Chain Reaction for Detecting Viable Pseudomonas syringae pv. actinidiae" Current Issues in Molecular Biology 47, no. 2: 103. https://doi.org/10.3390/cimb47020103

APA Style

Luo, Y., Liao, W., Li, Y., Chen, W., Zhong, S., Wu, C., Yao, K., Yang, R., Ma, M., & Gong, G. (2025). A Rapid and Reliable Propidium Monoazide Polymerase Chain Reaction for Detecting Viable Pseudomonas syringae pv. actinidiae. Current Issues in Molecular Biology, 47(2), 103. https://doi.org/10.3390/cimb47020103

Article Metrics

Back to TopTop