Identification of Key Candidate Genes for Muscle Growth in Liaoning Black Pigs and Duroc Pigs via Longissimus Dorsi Muscle Transcriptome Analysis
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Sample Collection
2.2. RNA Extraction and Quality Assessment, Library Construction, and Illumina Sequencing
2.3. Gene Expression Analysis
2.4. Functional Annotation
2.5. Construction of Protein–Protein Interaction Networks for Differentially Expressed Genes
2.6. Validation of Differentially Expressed Genes with Quantitative Real-Time PCR (qPCR)
3. Results
3.1. Sequencing of the Pig Longissimus Dorsi Transcriptome
3.2. Number of Genes in Various FPKM Value Intervals
3.3. Quantification and Quality Assessment of Gene Expression Levels via RNA-Seq Analysis
3.4. Differentially Expressed Gene Analysis
3.5. Differential Gene Clustering Analysis
3.6. GO Enrichment and KEGG Pathway Analyses
3.7. Protein–Protein Interaction Analysis
3.8. Verification of the Accuracy of the RNA-Seq Data via RT-qPCR
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Han, D.; Zhang, C.-H.; Fauconnier, M.-L.; Mi, S. Characterization and differentiation of boiled pork from Tibetan, Sanmenxia and Duroc × (Landrac × Yorkshire) pigs by volatiles profiling and chemometrics analysis. Food Res. Int. 2020, 130, 108910. [Google Scholar] [CrossRef] [PubMed]
- Chang, K.C.; da Costa, N.; Blackley, R.; Southwood, O.; Evans, G.; Plastow, G.; Wood, J.D.; Richardson, R.I. Relationships of myosin heavy chain fibre types to meat quality traits in traditional and modern pigs. Meat Sci. 2003, 64, 93–103. [Google Scholar] [CrossRef]
- Matsakas, A.; Patel, K. Skeletal muscle fibre plasticity in response to selected environmental and physiological stimuli. Histol. Histopathol. 2009, 24, 611–629. [Google Scholar]
- Wang, T.; Xu, Y.-Q.; Yuan, Y.-X.; Xu, P.-W.; Zhang, C.; Li, F. Succinate induces skeletal muscle fiber remodeling via SUNCR1 signaling pathway. EMBO Rep. 2019, 20, e47892, Erratum in EMBO Rep. 2021, 22, e53027. [Google Scholar] [CrossRef]
- Huang, C.; Zhong, L.; Zou, X.; Huang, Y.; Cai, L.; Ma, J. Evidence Against the Causal Relationship Between a Putative Cis-Regulatory Variant of MYH3 and Intramuscular Fat Content in Pigs. Front. Vet. Sci. 2021, 8, 672852. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.-H.; Kim, S.; Kim, J.-M. Genetic correlation between biopsied and post-mortem muscle fibre characteristics and meat quality traits in swine. Meat Sci. 2022, 186, 108735. [Google Scholar] [CrossRef]
- Miao, Z.; Wang, S.; Zhang, J.; Wei, P.; Guo, L.; Liu, D.; Wang, Y.; Shi, M. Identification and comparison of long non-conding RNA in Jinhua and Landrace pigs. Biochem. Biophys. Res. Commun. 2018, 506, 765–771. [Google Scholar] [CrossRef] [PubMed]
- Larson, L.; Lioy, J.; Johnson, J.; Medler, S. Transitional Hybrid Skeletal Muscle Fibers in Rat Soleus Development. J. Histochem. Cytochem. 2019, 67, 891–900. [Google Scholar] [CrossRef]
- Li, R.; Li, B.; Jiang, A.; Cao, Y.; Hou, L.; Zhang, Z.; Zhang, X.; Liu, H.; Kim, K.-H.; Wu, W. Exploring the lncRNAs Related to Skeletal Muscle Fiber Types and Meat Quality Traits in Pigs. Genes 2020, 11, 883. [Google Scholar] [CrossRef]
- Rehfeldt, C.; Fiedler, I.; Dietl, G.; Ender, K. Myogenesis and postnatal skeletal muscle cell growth as influenced by selection. Livest. Prod. Sci. 2000, 66, 177–188. [Google Scholar] [CrossRef]
- Schiaffino, S.; Reggiani, C. Fiber types in Mammalian skeletal muscles. Physiol. Rev. 2011, 91, 1447–1531. [Google Scholar] [CrossRef]
- Wigmore, P.M.; Stickland, N.C. Muscle development in large and small pig fetuses. J. Anat. 1983, 137 Pt 2, 235–245. [Google Scholar]
- Yang, Y.; Yan, J.; Fan, X.; Chen, J.; Wang, Z.; Liu, X.; Yi, G.; Liu, Y.; Niu, Y.; Zhang, L.; et al. The genome variation and developmental transcriptome maps reveal genetic differentiation of skeletal muscle in pigs. PLoS Genet. 2021, 17, e1009910. [Google Scholar] [CrossRef]
- Yu, Z.; Ai, N.; Xu, X.; Zhang, P.; Jin, Z.; Li, X.; Ma, H. Exploring the Molecular Mechanism of Skeletal Muscle Development in Ningxiang Pig by Weighted Gene Co-Expression Network Analysis. Int. J. Mol. Sci. 2024, 25, 9089. [Google Scholar] [CrossRef]
- Yu, Z.; Xu, X.; Ai, N.; Wang, K.; Zhang, P.; Li, X.; LiuFu, S.; Liu, X.; Jiang, J.; Gu, J.; et al. Integrated analysis of circRNA, lncRNA, miRNA and mRNA to reveal the ceRNA regulatory network of postnatal skeletal muscle development in Ningxiang pig. Front. Cell Dev. Biol. 2023, 11, 1185823. [Google Scholar] [CrossRef]
- Edwards, S.A.; Wood, J.D.; Moncrieff, C.B.; Porter, S.J. Comparison of the Duroc and Large White as terminal sire breeds and their effect on pigmeat quality. Int. Rev. Red Cross 1992, 54, 289–297. [Google Scholar] [CrossRef]
- Yu, J.; Zhao, P.; Zheng, X.; Zhou, L.; Wang, C.; Liu, J.-F. Genome-Wide Detection of Selection Signatures in Duroc Revealed Candidate Genes Relating to Growth and Meat Quality. G3-Genes Genomes Genet. 2020, 10, 3765–3773. [Google Scholar] [CrossRef] [PubMed]
- Gomes, J.D.; da Silva, B.P.M.; Duarte, S.F.P.; Ferreira, S.V.; Almeida, V.V.; Pian, L.W.; Ciconello, F.N.; Gadbem, C.T.M.; Cesar, A.S.M. Productive performance and carcass quality of pigs from different sire lines under commercial production conditions. Vet. Anim. Sci. 2025, 29, 100491. [Google Scholar] [CrossRef] [PubMed]
- Marioni, J.C.; Mason, C.E.; Mane, S.M.; Stephens, M.; Gilad, Y. RNA-seq: An assessment of technical reproducibility and comparison with gene expression arrays. Genome Res. 2008, 18, 1509–1517. [Google Scholar] [CrossRef]
- Mortazavi, A.; Williams, B.A.; McCue, K.; Schaeffer, L.; Wold, B. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat. Methods 2008, 5, 621–628. [Google Scholar] [CrossRef]
- Wang, L.; Wang, S.; Li, W. RSeQC: Quality control of RNA-seq experiments. Bioinformatics 2012, 28, 2184–2185. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
- Young, M.D.; Wakefield, M.J.; Smyth, G.K.; Oshlack, A. Gene ontology analysis for RNA-seq: Accounting for selection bias. Genome Biol. 2010, 11, R14. [Google Scholar] [CrossRef]
- Mao, X.; Cai, T.; Olyarchuk, J.G.; Wei, L. Automated genome annotation and pathway identification using the KEGG Orthology (KO) as a controlled vocabulary. Bioinformatics 2005, 21, 3787–3793. [Google Scholar] [CrossRef]
- Franceschini, A.; Szklarczyk, D.; Frankild, S.; Kuhn, M.; Simonovic, M.; Roth, A.; Lin, J.; Minguez, P.; Bork, P.; von Mering, C.; et al. STRING v9.1: Protein-protein interaction networks, with increased coverage and integration. Nucleic Acids Res. 2013, 41, D808–D815. [Google Scholar] [CrossRef]
- Shannon, P.; Markiel, A.; Ozier, O.; Baliga, N.S.; Wang, J.T.; Ramage, D.; Amin, N.; Schwikowski, B.; Ideker, T. Cytoscape: A software environment for integrated models of biomolecular interaction networks. Genome Res. 2003, 13, 2498–2504. [Google Scholar] [CrossRef]
- McLachlan, G.J.; Bean, R.W.; Ng, S.-K. Clustering. Methods Mol. Biol. 2008, 453, 423–439. [Google Scholar] [CrossRef] [PubMed]
- Van Den Berge, K.; Hembach, K.M.; Soneson, C.; Tiberi, S.; Clement, L.; Love, M.I.; Patro, R.; Robinson, M.D. RNA Sequencing Data: Hitchhiker’s Guide to Expression Analysis. Annu. Rev. Biomed. Data Sci. 2019, 2, 139–173. [Google Scholar] [CrossRef]
- Candek-Potokar, M.; Lebret, B.; Gispert, M.; Font-i-Furnols, M. Challenges and future perspectives for the European grading of pig carcasses—A quality view. Meat Sci. 2024, 208, 109390. [Google Scholar] [CrossRef] [PubMed]
- Ren, L.; Liu, A.; Wang, Q.; Wang, H.; Dong, D.; Liu, L. Transcriptome analysis of embryonic muscle development in Chengkou Mountain Chicken. BMC Genom. 2021, 22, 431. [Google Scholar] [CrossRef]
- Schiaffino, S.; Dyar, K.A.; Ciciliot, S.; Blaauw, B.; Sandri, M. Mechanisms regulating skeletal muscle growth and atrophy. FEBS J. 2013, 280, 4294–4314. [Google Scholar] [CrossRef]
- Tan, K.T.; Ang, S.T.J.; Tsai, S.Y. Sarcopenia: Tilting the Balance of Protein Homeostasis. Proteomics 2020, 20, 1800411. [Google Scholar] [CrossRef]
- Liu, Y.; Li, F.; Kong, X.; Tan, B.; Li, Y.; Duan, Y.; Blachier, F.; Hu, C.-A.A.; Yin, Y. Signaling Pathways Related to Protein Synthesis and Amino Acid Concentration in Pig Skeletal Muscles Depend on the Dietary Protein Level, Genotype and Developmental Stages. PLoS ONE 2015, 10, e0138277. [Google Scholar] [CrossRef]
- Chen, Q.; Zhang, W.; Cai, J.; Ni, Y.; Xiao, L.; Zhang, J. Transcriptome analysis in comparing carcass and meat quality traits of Jiaxing Black Pig and Duroc × Duroc × Berkshire × Jiaxing Black Pig crosses. Gene 2022, 808, 145978. [Google Scholar] [CrossRef]
- Jin, L.; Tang, Q.; Hu, S.; Chen, Z.; Zhou, X.; Zeng, B.; Wang, Y.; He, M.; Li, Y.; Gui, L.; et al. A pig BodyMap transcriptome reveals diverse tissue physiologies and evolutionary dynamics of transcription. Nat. Commun. 2021, 12, 3715. [Google Scholar] [CrossRef] [PubMed]
- Dubois, V.; Laurent, M.; Boonen, S.; Vanderschueren, D.; Claessens, F. Androgens and skeletal muscle: Cellular and molecular action mechanisms underlying the anabolic actions. Cell. Mol. Life Sci. 2012, 69, 1651–1667. [Google Scholar] [CrossRef] [PubMed]
- Basualto-Alarcón, C.; Jorquera, G.; Altamirano, F.; Jaimovich, E.; Estrada, M. Testosterone signals through mTOR and androgen receptor to induce muscle hypertrophy. Med. Sci. Sports Exerc. 2013, 45, 1712–1720. [Google Scholar] [CrossRef]
- Brown, D.; Hikim, A.P.S.; Kovacheva, E.L.; Sinha-Hikim, I. Mouse model of testosterone-induced muscle fiber hypertrophy: Involvement of p38 mitogen-activated protein kinase-mediated Notch signaling. J. Endocrinol. 2009, 201, 129–139. [Google Scholar] [CrossRef] [PubMed]
- White, J.P.; Gao, S.; Puppa, M.J.; Sato, S.; Welle, S.L.; Carson, J.A. Testosterone regulation of Akt/mTORC1/FoxO3a signaling in skeletal muscle. Mol. Cell. Endocrinol. 2013, 365, 174–186. [Google Scholar] [CrossRef]
- Martina, V.; Patrick, D. How Sex Hormones Promote Skeletal Muscle Regeneration. Sports Med. 2013, 43, 1089–1100. [Google Scholar] [CrossRef]
- Ribas, V.; Drew, B.G.; Zhou, Z.; Phun, J.; Kalajian, N.Y.; Soleymani, T.; Daraei, P.; Widjaja, K.; Wanagat, J.; Vallim, T.Q.d.A.; et al. Skeletal muscle action of estrogen receptor α is critical for the maintenance of mitochondrial function and metabolic homeostasis in females. Sci. Transl. Med. 2016, 8, 334ra354. [Google Scholar] [CrossRef]
- Vina, J.; Gambini, J.; Lopez-Grueso, R.; Abdelaziz, K.M.; Jove, M.; Borras, C. Females Live Longer than Males: Role of Oxidative Stress. Curr. Med. Chem. 2011, 17, 3959–3965. [Google Scholar] [CrossRef] [PubMed]
- Clark, K.A.; McElhinny, A.S.; Beckerle, M.C.; Gregorio, C.C. Striated muscle cytoarchitecture: An intricate web of form and function. Annu. Rev. Cell Dev. Biol. 2002, 18, 637–706. [Google Scholar] [CrossRef]
- Kostan, J.; Pavsic, M.; Puz, V.; Schwarz, T.C.; Drepper, F.; Molt, S.; Graewert, M.A.; Schreiner, C.; Sajko, S.; van der Ven, P.F.M.; et al. Molecular basis of F-actin regulation and sarcomere assembly via myotilin. PLoS Biol. 2021, 19, e3001148. [Google Scholar] [CrossRef] [PubMed]
- Le Grand, F.; Rudnicki, M.A. Skeletal muscle satellite cells and adult myogenesis. Curr. Opin. Cell Biol. 2007, 19, 628–633. [Google Scholar] [CrossRef]
- Chargé, S.B.P.; Rudnicki, M.A. Cellular and Molecular Regulation of Muscle Regeneration. Physiol. Rev. 2004, 84, 209–238. [Google Scholar] [CrossRef] [PubMed]
- Fraley, S.I.; Feng, Y.; Krishnamurthy, R.; Kim, D.-H.; Celedon, A.; Longmore, G.D.; Wirtz, D. A distinctive role for focal adhesion proteins in three-dimensional cell motility. Nat. Cell Biol. 2010, 12, 598–604. [Google Scholar] [CrossRef]
- Discher, D.E.; Janmey, P.; Wang, Y.-L. Tissue cells feel and respond to the stiffness of their substrate. Science 2005, 310, 1139–1143. [Google Scholar] [CrossRef]
- Zhao, X.; Guan, J.-L. Focal adhesion kinase and its signaling pathways in cell migration and angiogenesis. Adv. Drug Deliv. Rev. 2011, 63, 610–615. [Google Scholar] [CrossRef]
- Boppart, M.D.; Burkin, D.J.; Kaufman, S.J. α7β1-integrin regulates mechanotransduction and prevents skeletal muscle injury. Am. J. Physiol.-Cell Physiol. 2006, 290, C1660–C1665. [Google Scholar] [CrossRef]
- Boppart, M.D.; Mahmassani, Z.S. Integrin signaling: Linking mechanical stimulation to skeletal muscle hypertrophy. Am. J. Physiol.-Cell Physiol. 2019, 317, C629–C641. [Google Scholar] [CrossRef]
- Hornberger, T.A.; Stuppard, R.; Conley, K.E.; Fedele, M.J.; Fiorotto, M.L.; Chin, E.R.; Esser, K.A. Mechanical stimuli regulate rapamycin-sensitive signalling by a phosphoinositide 3-kinase-, protein kinase B- and growth factor-independent mechanism. Biochem. J. 2004, 380, 795–804. [Google Scholar] [CrossRef] [PubMed]
- Klossner, S.; Durieux, A.-C.; Freyssenet, D.; Flueck, M. Mechano-transduction to muscle protein synthesis is modulated by FAK. Eur. J. Appl. Physiol. 2009, 106, 389–398. [Google Scholar] [CrossRef]
- Quach, N.L.; Biressi, S.; Reichardt, L.F.; Keller, C.; Rando, T.A. Focal Adhesion Kinase Signaling Regulates the Expression of Caveolin 3 and β1 Integrin, Genes Essential for Normal Myoblast Fusion. Mol. Biol. Cell 2009, 20, 3422–3435. [Google Scholar] [CrossRef]
- Graham, Z.A.; Gallagher, P.M.; Cardozo, C.P. Focal adhesion kinase and its role in skeletal muscle. J. Muscle Res. Cell Motil. 2015, 36, 305–315. [Google Scholar] [CrossRef]
- Crossland, H.; Kazi, A.A.; Lang, C.H.; Timmons, J.A.; Pierre, P.; Wilkinson, D.J.; Smith, K.; Szewczyk, N.J.; Atherton, P.J. Focal adhesion kinase is required for IGF-I-mediated growth of skeletal muscle cells via a TSC2/mTOR/S6K1-associated pathway. Am. J. Physiol.-Endocrinol. Metab. 2013, 305, E183–E193. [Google Scholar] [CrossRef]
- Schiaffino, S.; Mammucari, C. Regulation of skeletal muscle growth by the IGF1-Akt/PKB pathway: Insights from genetic models. Skelet. Muscle 2011, 1, 4. [Google Scholar] [CrossRef]
- Sylow, L.; Tokarz, V.L.; Richter, E.A.; Klip, A. The many actions of insulin in skeletal muscle, the paramount tissue determining glycemia. Cell Metab. 2021, 33, 758–780. [Google Scholar] [CrossRef] [PubMed]
- Mann, G.; Riddell, M.C.; Adegoke, O.A.J. Effects of Acute Muscle Contraction on the Key Molecules in Insulin and Akt Signaling in Skeletal Muscle in Health and in Insulin Resistant States. Diabetology 2022, 3, 423–446. [Google Scholar] [CrossRef]
- Ohanna, M.; Sobering, A.K.; Lapointe, T.; Lorenzo, L.; Praud, C.; Petroulakis, E.; Sonenberg, N.; Kelly, P.A.; Sotiropoulos, A.; Pende, M. Atrophy of S6K1−/− skeletal muscle cells reveals distinct mTOR effectors for cell cycle and size control. Nat. Cell Biol. 2005, 7, 286–294. [Google Scholar] [CrossRef]
- Poklukar, K.; Candek-Potokar, M.; Lukac, N.B.; Tomazin, U.; Skrlep, M. Lipid Deposition and Metabolism in Local and Modern Pig Breeds: A Review. Animals 2020, 10, 424. [Google Scholar] [CrossRef]
- Schwander, M.; Shirasaki, R.; Pfaff, S.L.; Müller, U. β1 integrins in muscle, but not in motor neurons, are required for skeletal muscle innervation. J. Neurosci. 2004, 24, 8181–8191. [Google Scholar] [CrossRef]
- Pang, Y.; Zhang, Z.; Wang, Z.; Wang, Y.; Yan, Y.; Li, S.; Tong, H. Platelet endothelial aggregation receptor-1 regulates bovine muscle satellite cell migration and differentiation via integrin beta-1 and focal adhesion kinase. Cell Adhes. Migr. 2019, 13, 192–202. [Google Scholar] [CrossRef]
- Han, J.-W.; Lee, H.-J.; Bae, G.-U.; Kang, J.-S. Promyogenic function of Integrin/FAK signaling is mediated by Cdo, Cdc42 and MyoD. Cell. Signal. 2011, 23, 1162–1169. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Lee, H.; Zhu, C. Molecular mechanisms of mechanotransduction in integrin-mediated cell-matrix adhesion. Exp. Cell Res. 2016, 349, 85–94. [Google Scholar] [CrossRef] [PubMed]
- Kato, G. Regulatory Roles of the N-Terminal Intrinsically Disordered Region of Modular Src. Int. J. Mol. Sci. 2022, 23, 2241. [Google Scholar] [CrossRef]
- Lim, M.J.; Seo, Y.H.; Choi, K.J.; Cho, C.H.; Kim, B.S.; Kim, Y.H.; Lee, J.; Lee, H.; Jung, C.Y.; Ha, J.; et al. Suppression of c-Src activity stimulates muscle differentiation via p38 MAPK activation. Arch. Biochem. Biophys. 2007, 465, 197–208. [Google Scholar] [CrossRef]
- Sun, Z.; Guo, S.S.; Fassler, R. Integrin-mediated mechanotransduction. J. Cell Biol. 2016, 215, 445–456. [Google Scholar] [CrossRef] [PubMed]
- Boyer, J.G.; Prasad, V.; Song, T.; Lee, D.; Fu, X.; Grimes, K.M.; Sargent, M.A.; Sadayappan, S.; Molkentin, J.D. ERK1/2 signaling induces skeletal muscle slow fiber-type switching and reduces muscular dystrophy disease severity. JCI Insight 2019, 4, e127356. [Google Scholar] [CrossRef]
- Chiou, M.-J.; Wang, Y.-D.; Kuo, C.-M.; Chen, J.-C.; Chen, J.-Y. Functional analysis of mitogen-activated protein kinase-3 (MAPK3) and its regulation of the promoter region in zebrafish. DNA Cell Biol. 2007, 26, 781–790. [Google Scholar] [CrossRef]
- Zhang, L.; Wang, F.; Gao, G.; Yan, X.; Liu, H.; Liu, Z.; Wang, Z.; He, L.; Lv, Q.; Wang, Z.; et al. Genome-Wide Association Study of Body Weight Traits in Inner Mongolia Cashmere Goats. Front. Vet. Sci. 2021, 8, 752746. [Google Scholar] [CrossRef]
- Sorrentino, C.; Gentile, G.; D’Angiolo, R.; Barra, C.; Stefano, F.D.; Licitra, F.; Sabbatino, E.; Tutino, V.; Moretti, A.; Giovannelli, P.; et al. The Role of the Androgen Receptor in Skeletal Muscle and Its Utility as a Target for Restoring Muscle Functions. Biol. Life Sci. Forum 2023, 21, 5. [Google Scholar] [CrossRef]
- Dent, J.R.; Fletcher, D.K.; McGuigan, M.R. Evidence for a non-genomic action of testosterone in skeletal muscle which may improve athletic performance: Implications for the female athlete. J. Sports Sci. Med. 2012, 11, 363. [Google Scholar]
- Sands, W.A.; Palmer, T.M. Regulating gene transcription in response to cyclic AMP elevation. Cell. Signal. 2008, 20, 460–466. [Google Scholar] [CrossRef]
- Turnham, R.E.; Scott, J.D. Protein kinase A catalytic subunit isoform PRKACA; History, function and physiology. Gene 2016, 577, 101–108. [Google Scholar] [CrossRef]
- Skalhegg, B.S.; Huang, Y.; Su, T.; Idzerda, R.L.; McKnight, G.S.; Burton, K.A. Mutation of the Calpha subunit of PKA leads to growth retardation and sperm dysfunction. Mol. Endocrinol. 2002, 16, 630–639. [Google Scholar] [CrossRef]
- Yin, Z.; Pringle, D.R.; Jones, G.N.; Kelly, K.M.; Kirschner, L.S. Differential Role of PKA Catalytic Subunits in Mediating Phenotypes Caused by Knockout of the Carney Complex Gene Prkar1a. Mol. Endocrinol. 2011, 25, 1786–1793. [Google Scholar] [CrossRef] [PubMed]
- Priya Londhe, D.C.G. Inflammation induced loss of skeletal muscle. Bone 2015, 80, 131–142. [Google Scholar] [CrossRef] [PubMed]
- Nabeshima, Y.; Hanaoka, K.; Hayasaka, M.; Esumi, E.; Li, S.; Nonaka, I.; Nabeshima, Y. Myogenin gene disruption results in perinatal lethality because of severe muscle defect. Nature 1993, 364, 532–535. [Google Scholar] [CrossRef] [PubMed]
- Edmondson, D.G.; Lyons, G.E.; Martin, J.F.; Olson, E.N. Mef2 gene expression marks the cardiac and skeletal muscle lineages during mouse embryogenesis. Development 1994, 120, 1251–1263. [Google Scholar] [CrossRef]
- Pan, P.C.; Qin, Z.X.; Xie, W.; Chen, B.J.; Guan, Z.H.; Xie, B.K. Identification of Differentially Expressed Genes in the Longissimus Dorsi Muscle of Luchuan and Duroc Pigs by Transcriptome Sequencing. Genes 2023, 14, 132. [Google Scholar] [CrossRef]









| Gene ID in NCBI | Gene | Primer Sequence (5′→3′) | Product Size (bp) |
|---|---|---|---|
| NM_001001632.1 | TPM3-S | GCTGGTTGAAGAGGAGCTGGAC | 172 |
| TPM3-A | TTCTTTGAGTTGGATTTCCTGGAGT | ||
| NM_001315611.2 | FKBP5-S | GAACCGTTTGTCTTTAGTCTTGGC | 276 |
| FKBP5-A | CGCTCCTTCGTTGGGATTTG | ||
| NM_001278773.1 | MYL3-S | CCAAGGAACCTGAGTTTGATGC | 260 |
| MYL3-A | GAGCATGGGCAGGAACGTGT | ||
| XM_021091233.1 | ITGA7-S | TGGTTGGGAGTCAGTGTTCGG | 278 |
| ITGA7-A | CCAAAGAGGAGGTAGTGGCTGT | ||
| NM_001009580.1 | CXCL12-S | CACGGCTGAAGAGCAACAATA | 101 |
| CXCL12-A | GAGAGTGGGACTGGGTTTGTTT | ||
| NM_213986.1 | MYOC-S | ATGTCTCAGGATGTGCCGTTG | 144 |
| MYOC-A | ACTGCCGGAATGACCAGACAC | ||
| XM_021089672.1 | MEF2D-S | GGAGACCTCAACAGTGCTAACG | 120 |
| MEF2D-A | GATGACCTTGTTTAGGCTGTTGC | ||
| NM_213883.2 | IGF2(2)-S | GGGCAAGTTCTTCCGCTATGAC | 268 |
| IGF2(2)-A | AGAGGAGGTCACGAGGTGGAT | ||
| NM_001206359.1 | gapdh(1)-S | GACATCAAGAAGGTGGTGAAGCA | 177 |
| internal control | gapdh(1)-A | GTCGTACCAGGAAATGAGCTTGA |
| FPKM Interval | 0~1 | 1~3 | 3~15 | 15~60 | >60 |
|---|---|---|---|---|---|
| CH1 | 20,461 (65.37%) | 2963 (9.47%) | 5002 (15.98%) | 2121 (6.78%) | 755 (2.41%) |
| CH2 | 20,500 (65.49%) | 2996 (9.57%) | 4936 (15.77%) | 2118 (6.77%) | 752 (2.40%) |
| CH3 | 20,408 (65.20%) | 3026 (9.67%) | 4984 (15.92%) | 2132 (6.81%) | 752 (2.40%) |
| CH4 | 21,051 (67.25%) | 3023 (9.66%) | 4709 (15.04%) | 1843 (5.89%) | 676 (2.16%) |
| CH5 | 21,055 (67.26%) | 3013 (9.63%) | 4699 (15.01%) | 1853 (5.92%) | 682 (2.18%) |
| CH6 | 21,087 (67.37%) | 2986 (9.54%) | 4708 (15.04%) | 1845 (5.89%) | 676 (2.16%) |
| HD1 | 20,975 (67.01%) | 2958 (9.45%) | 4674 (14.93%) | 1956 (6.25%) | 739 (2.36%) |
| HD2 | 20,994 (67.07%) | 2915 (9.31%) | 4695 (15.00%) | 1962 (6.27%) | 736 (2.35%) |
| HD3 | 21,017 (67.14%) | 2913 (9.31%) | 4718 (15.07%) | 1939 (6.19%) | 715 (2.28%) |
| HD4 | 19,601 (62.62%) | 2711 (8.66%) | 5384 (17.20%) | 2665 (8.51%) | 941 (3.01%) |
| HD5 | 19,568 (62.51%) | 2710 (8.66%) | 5403 (17.26%) | 2683 (8.57%) | 938 (3.00%) |
| HD6 | 19,589 (62.58%) | 2705 (8.64%) | 5377 (17.18%) | 2684 (8.57%) | 947 (3.03%) |
| GO_Accession | Description | Term_Type | Over-Represented_p-Value | Corrected_p-Value | DEG_Item |
|---|---|---|---|---|---|
| GO:0008092 | cytoskeletal protein binding | molecular_function | 9.60 × 10−8 | 2.18 × 10−5 | 154 |
| GO:0030016 | myofibril | cellular_component | 1.11 × 10−7 | 2.40 × 10−5 | 29 |
| GO:0043292 | contractile fibre | cellular_component | 1.11 × 10−7 | 2.40 × 10−5 | 29 |
| GO:0061061 | muscle structure development | biological_process | 2.95 × 10−7 | 5.30 × 10−5 | 56 |
| GO:0042692 | muscle cell differentiation | biological_process | 4.73 × 10−5 | 0.00399 | 34 |
| GO:0060538 | skeletal muscle organ development | biological_process | 5.05 × 10−5 | 0.004185 | 17 |
| GO:0007517 | muscle organ development | biological_process | 8.59 × 10−5 | 0.006294 | 30 |
| GO:0007519 | skeletal muscle tissue development | biological_process | 0.0003 | 0.017253 | 15 |
| GO:0060537 | muscle tissue development | biological_process | 0.000874 | 0.035947 | 29 |
| GO:1904706 | negative regulation of vascular associated smooth muscle cell proliferation | biological_process | 0.001238 | 0.046245 | 5 |
| GO_Accession | Description | Term_Type | Over-Represented_p-Value | Corrected_p-Value | DEG_Item |
|---|---|---|---|---|---|
| GO:0003012 | muscle system process | biological_process | 2.65 × 10−8 | 1.84 × 10−6 | 56 |
| GO:0061061 | muscle structure development | biological_process | 1.20 × 10−7 | 6.93 × 10−6 | 85 |
| GO:0090257 | regulation of muscle system process | biological_process | 6.81 × 10−7 | 3.42 × 10−5 | 39 |
| GO:0006936 | muscle contraction | biological_process | 9.41 × 10−7 | 4.60 × 10−5 | 48 |
| GO:0006937 | regulation of muscle contraction | biological_process | 2.19 × 10−5 | 0.000774 | 32 |
| GO:0006941 | striated muscle contraction | biological_process | 2.37 × 10−5 | 0.000828 | 27 |
| GO:0042692 | muscle cell differentiation | biological_process | 3.27 × 10−5 | 0.001084 | 51 |
| GO:0007517 | muscle organ development | biological_process | 0.000198 | 0.005153 | 44 |
| GO:0060048 | cardiac muscle contraction | biological_process | 0.000454 | 0.010173 | 20 |
| GO:0006942 | regulation of striated muscle contraction | biological_process | 0.000933 | 0.018673 | 21 |
| GO:0055117 | regulation of cardiac muscle contraction | biological_process | 0.002365 | 0.040228 | 17 |
| GO:1990874 | vascular associated smooth muscle cell proliferation | biological_process | 0.002622 | 0.043526 | 9 |
| GO:0005865 | striated muscle thin filament | cellular_component | 0.002957 | 0.048141 | 8 |
| GO:0030016 | myofibril | cellular_component | 2.72 × 10−8 | 1.86 × 10−6 | 41 |
| GO:0008092 | cytoskeletal protein binding | molecular_function | 4.50 × 10−15 | 1.15 × 10−12 | 277 |
| Term | Database | ID | Input Number | p-Value | Up | Down |
|---|---|---|---|---|---|---|
| Focal adhesion | KEGG PATHWAY | ssc04510 | 99 | 0.004337 | 44 | 55 |
| Staphylococcus aureus infection | KEGG PATHWAY | ssc05150 | 35 | 0.005195 | 34 | 1 |
| Leishmaniasis | KEGG PATHWAY | ssc05140 | 41 | 0.00574 | 32 | 9 |
| Viral myocarditis | KEGG PATHWAY | ssc05416 | 38 | 0.010645 | 27 | 11 |
| Epstein–Barr virus infection | KEGG PATHWAY | ssc05169 | 93 | 0.020259 | 49 | 44 |
| B cell receptor signaling pathway | KEGG PATHWAY | ssc04662 | 43 | 0.02028 | 23 | 20 |
| Toxoplasmosis | KEGG PATHWAY | ssc05145 | 54 | 0.020284 | 32 | 22 |
| Citrate cycle (TCA cycle) | KEGG PATHWAY | ssc00020 | 20 | 0.022353 | 2 | 18 |
| Mitophagy-animal | KEGG PATHWAY | ssc04137 | 36 | 0.025916 | 14 | 22 |
| Legionellosis | KEGG PATHWAY | ssc05134 | 31 | 0.030725 | 15 | 16 |
| AGE-RAGE signaling pathway in diabetic complications | KEGG PATHWAY | ssc04933 | 51 | 0.032827 | 28 | 23 |
| Amoebiasis | KEGG PATHWAY | ssc05146 | 47 | 0.034029 | 31 | 16 |
| Fluid shear stress and atherosclerosis | KEGG PATHWAY | ssc05418 | 65 | 0.036342 | 26 | 39 |
| Adrenergic signaling in cardiomyocytes | KEGG PATHWAY | ssc04261 | 68 | 0.043249 | 23 | 45 |
| Asthma | KEGG PATHWAY | ssc05310 | 18 | 0.044906 | 18 | 0 |
| Proteoglycans in cancer | KEGG PATHWAY | ssc05205 | 91 | 0.046646 | 49 | 42 |
| Fatty acid metabolism | KEGG PATHWAY | ssc01212 | 31 | 0.048777 | 11 | 20 |
| Endocytosis | KEGG PATHWAY | ssc04144 | 106 | 0.049658 | 54 | 52 |
| Fc epsilon RI signaling pathway | KEGG PATHWAY | ssc04664 | 34 | 0.049918 | 18 | 16 |
| Term | Database | ID | Input Number | p-Value | Up | Down |
|---|---|---|---|---|---|---|
| Focal adhesion | KEGG PATHWAY | ssc04510 | 154 | 0.014182 | 54 | 100 |
| Herpes simplex virus 1 infection | KEGG PATHWAY | ssc05168 | 253 | 0.014817 | 100 | 153 |
| Human T-cell leukemia virus 1 infection | KEGG PATHWAY | ssc05166 | 167 | 0.030231 | 74 | 93 |
| Insulin signaling pathway | KEGG PATHWAY | ssc04910 | 108 | 0.030592 | 73 | 35 |
| Endocytosis | KEGG PATHWAY | ssc04144 | 179 | 0.031543 | 89 | 90 |
| Viral myocarditis | KEGG PATHWAY | ssc05416 | 56 | 0.032809 | 19 | 37 |
| Adherens junction | KEGG PATHWAY | ssc04520 | 60 | 0.036048 | 25 | 35 |
| AGE-RAGE signaling pathway in diabetic complications | KEGG PATHWAY | ssc04933 | 82 | 0.038482 | 33 | 49 |
| Insulin resistance | KEGG PATHWAY | ssc04931 | 88 | 0.041252 | 55 | 33 |
| Glucagon signaling pathway | KEGG PATHWAY | ssc04922 | 81 | 0.046426 | 55 | 26 |
| Dilated cardiomyopathy (DCM) | KEGG PATHWAY | ssc05414 | 76 | 0.046815 | 38 | 38 |
| Arrhythmogenic right ventricular cardiomyopathy (ARVC) | KEGG PATHWAY | ssc05412 | 63 | 0.048268 | 30 | 33 |
| Hypertrophic cardiomyopathy (HCM) | KEGG PATHWAY | ssc05410 | 73 | 0.048275 | 35 | 38 |
| Term | Database | ID | Input Number | p-Value | Up | Down | |
|---|---|---|---|---|---|---|---|
| CHFvsHDF | Focal adhesion | KEGG PATHWAY | ssc04510 | 99 | 0.004337 | 44 | 55 |
| CHMvsHDM | Focal adhesion | KEGG PATHWAY | ssc04510 | 154 | 0.014182 | 54 | 100 |
| Insulin signalling pathway | KEGG PATHWAY | ssc04910 | 108 | 0.030592 | 73 | 35 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jia, Z.; Li, J.; Qiao, F.; Zhang, J.; Liu, X.; Chen, J. Identification of Key Candidate Genes for Muscle Growth in Liaoning Black Pigs and Duroc Pigs via Longissimus Dorsi Muscle Transcriptome Analysis. Curr. Issues Mol. Biol. 2025, 47, 917. https://doi.org/10.3390/cimb47110917
Jia Z, Li J, Qiao F, Zhang J, Liu X, Chen J. Identification of Key Candidate Genes for Muscle Growth in Liaoning Black Pigs and Duroc Pigs via Longissimus Dorsi Muscle Transcriptome Analysis. Current Issues in Molecular Biology. 2025; 47(11):917. https://doi.org/10.3390/cimb47110917
Chicago/Turabian StyleJia, Zhanpeng, Jiani Li, Fubo Qiao, Jiashuo Zhang, Xianjun Liu, and Jing Chen. 2025. "Identification of Key Candidate Genes for Muscle Growth in Liaoning Black Pigs and Duroc Pigs via Longissimus Dorsi Muscle Transcriptome Analysis" Current Issues in Molecular Biology 47, no. 11: 917. https://doi.org/10.3390/cimb47110917
APA StyleJia, Z., Li, J., Qiao, F., Zhang, J., Liu, X., & Chen, J. (2025). Identification of Key Candidate Genes for Muscle Growth in Liaoning Black Pigs and Duroc Pigs via Longissimus Dorsi Muscle Transcriptome Analysis. Current Issues in Molecular Biology, 47(11), 917. https://doi.org/10.3390/cimb47110917

