Histone Demethylation Profiles in Nonalcoholic Fatty Liver Disease and Prognostic Values in Hepatocellular Carcinoma: A Bioinformatic Analysis
Abstract
1. Introduction
2. Methods
2.1. Dataset Acquisition
2.2. Differentially Expressed Gene Identification
2.3. Retrieving the Genes Encoding HDM
2.4. In Vitro Model Validation
2.5. HDM Gene Expression Levels and Prognostic Value in HCC
2.6. Interactive Gene and PPI Network Construction
2.7. Statistical Analysis
3. Results
3.1. DEGs Identification in NAFLD
3.2. Differentially Expressed HDM Genes
3.3. In Vitro Validation
3.4. HDM Gene Expression and Prognostic Values in HCC
3.5. Interaction Genes and PPI Network
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Powell, E.E.; Wong, V.W.; Rinella, M. Non-alcoholic fatty liver disease. Lancet 2021, 397, 2212–2224. [Google Scholar] [CrossRef] [PubMed]
- Loomba, R.; Friedman, S.L.; Shulman, G.I. Mechanisms and disease consequences of nonalcoholic fatty liver disease. Cell 2021, 184, 2537–2564. [Google Scholar] [CrossRef]
- Abdelmalek, M.F. Nonalcoholic fatty liver disease: Another leap forward. Nat. Rev. Gastroenterol. Hepatol. 2021, 18, 85–86. [Google Scholar] [CrossRef] [PubMed]
- Cotter, T.G.; Rinella, M. Nonalcoholic Fatty Liver Disease 2020: The State of the Disease. Gastroenterology 2020, 158, 1851–1864. [Google Scholar] [CrossRef] [PubMed]
- Huang, D.Q.; El-Serag, H.B.; Loomba, R. Global epidemiology of NAFLD-related HCC: Trends, predictions, risk factors and prevention. Nat. Rev. Gastroenterol. Hepatol. 2021, 18, 223–238. [Google Scholar] [CrossRef]
- Estes, C.; Anstee, Q.M.; Arias-Loste, M.T.; Bantel, H.; Bellentani, S.; Caballeria, J.; Colombo, M.; Craxi, A.; Crespo, J.; Day, C.P.; et al. Modeling NAFLD disease burden in China, France, Germany, Italy, Japan, Spain, United Kingdom, and United States for the period 2016–2030. J. Hepatol. 2018, 69, 896–904. [Google Scholar] [CrossRef]
- Sodum, N.; Kumar, G.; Bojja, S.L.; Kumar, N.; Rao, C.M. Epigenetics in NAFLD/NASH: Targets and therapy. Pharmacol. Res. 2021, 167, 105484. [Google Scholar] [CrossRef]
- Jonas, W.; Schürmann, A. Genetic and epigenetic factors determining NAFLD risk. Mol. Metab. 2021, 50, 101111. [Google Scholar] [CrossRef]
- Hyun, J.; Jung, Y. DNA Methylation in Nonalcoholic Fatty Liver Disease. Int. J. Mol. Sci. 2020, 21, 8138. [Google Scholar] [CrossRef]
- Fang, Z.; Dou, G.; Wang, L. MicroRNAs in the Pathogenesis of Nonalcoholic Fatty Liver Disease. Int. J. Biol. Sci. 2021, 17, 1851–1863. [Google Scholar] [CrossRef]
- Zhang, X.; Asllanaj, E.; Amiri, M.; Portilla-Fernandez, E.; Bramer, W.M.; Nano, J.; Voortman, T.; Pan, Q.; Ghanbari, M. Deciphering the role of epigenetic modifications in fatty liver disease: A systematic review. Eur. J. Clin. Investig. 2021, 51, e13479. [Google Scholar] [CrossRef]
- Zaiou, M.; Amrani, R.; Rihn, B.; Hajri, T. Dietary Patterns Influence Target Gene Expression through Emerging Epigenetic Mechanisms in Nonalcoholic Fatty Liver Disease. Biomedicines 2021, 9, 1256. [Google Scholar] [CrossRef]
- Mosammaparast, N.; Shi, Y. Reversal of histone methylation: Biochemical and molecular mechanisms of histone demethylases. Annu. Rev. Biochem. 2010, 79, 155–179. [Google Scholar] [CrossRef]
- Kim, J.H.; Nagappan, A.; Jung, D.Y.; Suh, N.; Jung, M.H. Histone Demethylase KDM7A Contributes to the Development of Hepatic Steatosis by Targeting Diacylglycerol Acyltransferase 2. Int. J. Mol. Sci. 2021, 22, 1085. [Google Scholar] [CrossRef]
- Bricambert, J.; Alves-Guerra, M.C.; Esteves, P.; Prip-Buus, C.; Bertrand-Michel, J.; Guillou, H.; Chang, C.J.; Vander Wal, M.N.; Canonne-Hergaux, F.; Mathurin, P.; et al. The histone demethylase Phf2 acts as a molecular checkpoint to prevent NAFLD progression during obesity. Nat. Commun. 2018, 9, 2092. [Google Scholar] [CrossRef][Green Version]
- Kim, J.H.; Jung, D.Y.; Kim, H.R.; Jung, M.H. Histone H3K9 Demethylase JMJD2B Plays a Role in LXRα-Dependent Lipogenesis. Int. J. Mol. Sci. 2020, 21, 8313. [Google Scholar] [CrossRef]
- Kim, J.H.; Jung, D.Y.; Nagappan, A.; Jung, M.H. Histone H3K9 demethylase JMJD2B induces hepatic steatosis through upregulation of PPARγ2. Sci. Rep. 2018, 8, 13734. [Google Scholar] [CrossRef][Green Version]
- Arendt, B.M.; Comelli, E.M.; Ma, D.W.; Lou, W.; Teterina, A.; Kim, T.; Fung, S.K.; Wong, D.K.; McGilvray, I.; Fischer, S.E.; et al. Altered hepatic gene expression in nonalcoholic fatty liver disease is associated with lower hepatic n-3 and n-6 polyunsaturated fatty acids. Hepatology 2015, 61, 1565–1578. [Google Scholar] [CrossRef][Green Version]
- Moylan, C.A.; Pang, H.; Dellinger, A.; Suzuki, A.; Garrett, M.E.; Guy, C.D.; Murphy, S.K.; Ashley-Koch, A.E.; Choi, S.S.; Michelotti, G.A.; et al. Hepatic gene expression profiles differentiate presymptomatic patients with mild versus severe nonalcoholic fatty liver disease. Hepatology 2014, 59, 471–482. [Google Scholar] [CrossRef][Green Version]
- Murphy, S.K.; Yang, H.; Moylan, C.A.; Pang, H.; Dellinger, A.; Abdelmalek, M.F.; Garrett, M.E.; Ashley-Koch, A.; Suzuki, A.; Tillmann, H.L.; et al. Relationship between methylome and transcriptome in patients with nonalcoholic fatty liver disease. Gastroenterology 2013, 145, 1076–1087. [Google Scholar] [CrossRef][Green Version]
- Wu, P.; Zhang, M.; Webster, N.J.G. Alternative RNA Splicing in Fatty Liver Disease. Front. Endocrinol. 2021, 12, 613213. [Google Scholar] [CrossRef] [PubMed]
- Ritchie, M.E.; Phipson, B.; Wu, D.; Hu, Y.; Law, C.W.; Shi, W.; Smyth, G.K. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 2015, 43, e47. [Google Scholar] [CrossRef] [PubMed]
- Tang, Z.; Li, C.; Kang, B.; Gao, G.; Li, C.; Zhang, Z. GEPIA: A web server for cancer and normal gene expression profiling and interactive analyses. Nucleic Acids Res. 2017, 45, W98–W102. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Sjöstedt, E.; Zhong, W.; Fagerberg, L.; Karlsson, M.; Mitsios, N.; Adori, C.; Oksvold, P.; Edfors, F.; Limiszewska, A.; Hikmet, F.; et al. An atlas of the protein-coding genes in the human, pig, and mouse brain. Science 2020, 367, eaay5947. [Google Scholar] [CrossRef] [PubMed]
- Uhlen, M.; Zhang, C.; Lee, S.; Sjöstedt, E.; Fagerberg, L.; Bidkhori, G.; Benfeitas, R.; Arif, M.; Liu, Z.; Edfors, F.; et al. A pathology atlas of the human cancer transcriptome. Science 2017, 357, eaan2507. [Google Scholar] [CrossRef][Green Version]
- Pontén, F.; Jirström, K.; Uhlen, M. The Human Protein Atlas—A tool for pathology. J. Pathol. 2008, 216, 387–393. [Google Scholar] [CrossRef]
- Li, T.; Fan, J.; Wang, B.; Traugh, N.; Chen, Q.; Liu, J.S.; Li, B.; Liu, X.S. TIMER: A Web Server for Comprehensive Analysis of Tumor-Infiltrating Immune Cells. Cancer Res. 2017, 77, e108–e110. [Google Scholar] [CrossRef][Green Version]
- Warde-Farley, D.; Donaldson, S.L.; Comes, O.; Zuberi, K.; Badrawi, R.; Chao, P.; Franz, M.; Grouios, C.; Kazi, F.; Lopes, C.T.; et al. The GeneMANIA prediction server: Biological network integration for gene prioritization and predicting gene function. Nucleic Acids Res. 2010, 38, W214–W220. [Google Scholar] [CrossRef][Green Version]
- Szklarczyk, D.; Gable, A.L.; Nastou, K.C.; Lyon, D.; Kirsch, R.; Pyysalo, S.; Doncheva, N.T.; Legeay, M.; Fang, T.; Bork, P.; et al. The STRING database in 2021: Customizable protein-protein networks, and functional characterization of user-uploaded gene/measurement sets. Nucleic Acids Res. 2021, 49, D605–D612. [Google Scholar] [CrossRef]
- Zhou, Y.; Zhou, B.; Pache, L.; Chang, M.; Khodabakhshi, A.H.; Tanaseichuk, O.; Benner, C.; Chanda, S.K. Metascape provides a biologist-oriented resource for the analysis of systems-level datasets. Nat. Commun. 2019, 10, 1523. [Google Scholar] [CrossRef]
- Schonfeld, M.; Averilla, J.; Gunewardena, S.; Weinman, S.A.; Tikhanovich, I. Male-Specific Activation of Lysine Demethylases 5B and 5C Mediates Alcohol-Induced Liver Injury and Hepatocyte Dedifferentiation. Hepatol. Commun. 2022, 6, 1373–1391. [Google Scholar] [CrossRef]
- Zhang, B.; Zhou, B.H.; Xiao, M.; Li, H.; Guo, L.; Wang, M.X.; Yu, S.H.; Ye, Q.H. KDM5C Represses FASN-Mediated Lipid Metabolism to Exert Tumor Suppressor Activity in Intrahepatic Cholangiocarcinoma. Front. Oncol. 2020, 10, 1025. [Google Scholar] [CrossRef]
- Thibonnier, M.; Esau, C.; Ghosh, S.; Wargent, E.; Stocker, C. Metabolic and energetic benefits of microRNA-22 inhibition. BMJ Open Diabetes Res. Care 2020, 8, e001478. [Google Scholar] [CrossRef]
- Thibonnier, M.; Esau, C. Metabolic Benefits of MicroRNA-22 Inhibition. Nucleic Acid Ther. 2020, 30, 104–116. [Google Scholar] [CrossRef]
- Seok, S.; Kim, Y.C.; Byun, S.; Choi, S.; Xiao, Z.; Iwamori, N.; Zhang, Y.; Wang, C.; Ma, J.; Ge, K.; et al. Fasting-induced JMJD3 histone demethylase epigenetically activates mitochondrial fatty acid β-oxidation. J. Clin. Investig. 2018, 128, 3144–3159. [Google Scholar] [CrossRef]
- Zhao, F.; Ke, J.; Pan, W.; Pan, H.; Shen, M. Synergistic effects of ISL1 and KDM6B on non-alcoholic fatty liver disease through the regulation of SNAI1. Mol. Med. 2022, 28, 12. [Google Scholar] [CrossRef]
- Byun, S.; Seok, S.; Kim, Y.C.; Zhang, Y.; Yau, P.; Iwamori, N.; Xu, H.E.; Ma, J.; Kemper, B.; Kemper, J.K. Fasting-induced FGF21 signaling activates hepatic autophagy and lipid degradation via JMJD3 histone demethylase. Nat. Commun. 2020, 11, 807. [Google Scholar] [CrossRef][Green Version]
- Wang, H.J.; Hsieh, Y.J.; Cheng, W.C.; Lin, C.P.; Lin, Y.S.; Yang, S.F.; Chen, C.C.; Izumiya, Y.; Yu, J.S.; Kung, H.J.; et al. JMJD5 regulates PKM2 nuclear translocation and reprograms HIF-1α-mediated glucose metabolism. Proc. Natl. Acad. Sci. USA 2014, 111, 279–284. [Google Scholar] [CrossRef][Green Version]
- Cardamone, M.D.; Tanasa, B.; Chan, M.; Cederquist, C.T.; Andricovich, J.; Rosenfeld, M.G.; Perissi, V. GPS2/KDM4A pioneering activity regulates promoter-specific recruitment of PPARγ. Cell Rep. 2014, 8, 163–176. [Google Scholar] [CrossRef][Green Version]
- Markolovic, S.; Zhuang, Q.; Wilkins, S.E.; Eaton, C.D.; Abboud, M.I.; Katz, M.J.; McNeil, H.E.; Leśniak, R.K.; Hall, C.; Struwe, W.B.; et al. The Jumonji-C oxygenase JMJD7 catalyzes (3S)-lysyl hydroxylation of TRAFAC GTPases. Nat. Chem. Biol. 2018, 14, 688–695. [Google Scholar] [CrossRef][Green Version]
- Chang, S.; Yim, S.; Park, H. The cancer driver genes IDH1/2, JARID1C/KDM5C, and UTX/ KDM6A: Crosstalk between histone demethylation and hypoxic reprogramming in cancer metabolism. Exp. Mol. Med. 2019, 51, 1–17. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Qian, X.; Bao, Z.M.; Yao, D.; Shi, Y. Lysine demethylase 5C epigenetically reduces transcription of ITIH1 that results in augmented progression of liver hepatocellular carcinoma. Kaohsiung J. Med. Sci. 2022, 38, 437–446. [Google Scholar] [CrossRef] [PubMed]
- Ji, X.; Jin, S.; Qu, X.; Li, K.; Wang, H.; He, H.; Guo, F.; Dong, L. Lysine-specific demethylase 5C promotes hepatocellular carcinoma cell invasion through inhibition BMP7 expression. BMC Cancer 2015, 15, 801. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Wu, B.H.; Chen, H.; Cai, C.M.; Fang, J.Z.; Wu, C.C.; Huang, L.Y.; Wang, L.; Han, Z.G. Epigenetic silencing of JMJD5 promotes the proliferation of hepatocellular carcinoma cells by down-regulating the transcription of CDKN1A 686. Oncotarget 2016, 7, 6847–6863. [Google Scholar] [CrossRef][Green Version]
- Chen, D.B.; Xie, X.W.; Zhao, Y.J.; Wang, X.Y.; Liao, W.J.; Chen, P.; Deng, K.J.; Fei, R.; Qin, W.Y.; Wang, J.H.; et al. RFX5 promotes the progression of hepatocellular carcinoma through transcriptional activation of KDM4A. Sci. Rep. 2020, 10, 14538. [Google Scholar] [CrossRef]
- Liu, K.; Liu, Y.; Lau, J.L.; Min, J. Epigenetic targets and drug discovery Part 2: Histone demethylation and DNA methylation. Pharmacol. Ther. 2015, 151, 121–140. [Google Scholar] [CrossRef]
- Kruidenier, L.; Chung, C.W.; Cheng, Z.; Liddle, J.; Che, K.; Joberty, G.; Bantscheff, M.; Bountra, C.; Bridges, A.; Diallo, H.; et al. A selective jumonji H3K27 demethylase inhibitor modulates the proinflammatory macrophage response. Nature 2012, 488, 404–408. [Google Scholar] [CrossRef][Green Version]
- Heinemann, B.; Nielsen, J.M.; Hudlebusch, H.R.; Lees, M.J.; Larsen, D.V.; Boesen, T.; Labelle, M.; Gerlach, L.O.; Birk, P.; Helin, K. Inhibition of demethylases by GSK-J1/J4. Nature 2014, 514, E1–E2. [Google Scholar] [CrossRef]
- Wang, L.; Chang, J.; Varghese, D.; Dellinger, M.; Kumar, S.; Best, A.M.; Ruiz, J.; Bruick, R.; Peña-Llopis, S.; Xu, J.; et al. A small molecule modulates Jumonji histone demethylase activity and selectively inhibits cancer growth. Nat. Commun. 2013, 4, 2035. [Google Scholar] [CrossRef][Green Version]
- Rose, N.R.; Ng, S.S.; Mecinović, J.; Liénard, B.M.; Bello, S.H.; Sun, Z.; McDonough, M.A.; Oppermann, U.; Schofield, C.J. Inhibitor scaffolds for 2-oxoglutarate-dependent histone lysine demethylases. J. Med. Chem. 2008, 51, 7053–7056. [Google Scholar] [CrossRef]
Genes | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
KDM5C | ACTGCTGACCATTGCTGAACGC | CCTCCTTGAGAGCCTGGATGTT |
KDM6B | GACCCTCGAAATCCCATCACAG | GTGCGAACTTCCACGGTGTGTT |
KDM8 | CACAGATGAGGAATGGTCCCAG | GCTGATGTCCTGCTTCAACTCC |
KDM4A | TGCGGCAAGTTGAGGATGGTCT | GCTGCTTGTTCTTCCTCCTCATC |
JMJD7 | GGAGTCCTCTATGTGCAGAAGC | CAGCCAGAAGTTCACAGCATCG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, Y.; Chen, M. Histone Demethylation Profiles in Nonalcoholic Fatty Liver Disease and Prognostic Values in Hepatocellular Carcinoma: A Bioinformatic Analysis. Curr. Issues Mol. Biol. 2023, 45, 3640-3657. https://doi.org/10.3390/cimb45040237
Liu Y, Chen M. Histone Demethylation Profiles in Nonalcoholic Fatty Liver Disease and Prognostic Values in Hepatocellular Carcinoma: A Bioinformatic Analysis. Current Issues in Molecular Biology. 2023; 45(4):3640-3657. https://doi.org/10.3390/cimb45040237
Chicago/Turabian StyleLiu, Yuanbin, and Mingkai Chen. 2023. "Histone Demethylation Profiles in Nonalcoholic Fatty Liver Disease and Prognostic Values in Hepatocellular Carcinoma: A Bioinformatic Analysis" Current Issues in Molecular Biology 45, no. 4: 3640-3657. https://doi.org/10.3390/cimb45040237
APA StyleLiu, Y., & Chen, M. (2023). Histone Demethylation Profiles in Nonalcoholic Fatty Liver Disease and Prognostic Values in Hepatocellular Carcinoma: A Bioinformatic Analysis. Current Issues in Molecular Biology, 45(4), 3640-3657. https://doi.org/10.3390/cimb45040237