Erratum: Kim, K.-P.; Singh, A.K.; Bai, X.; Leprun, L.; Bhunia, A.K. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food. Sensors 2015, 15, 22672–22691

Kwang-Pyo Kim; Atul K. Singh; Xingjian Bai; Lena Leprun; Arun K. Bhunia

doi:10.3390/s17050945

,

and

¹

Molecular Food Microbiology Laboratory, Department of Food Science, Purdue University, West Lafayette, IN 47907, USA

²

Department of Food Science and Technology, College of Agriculture and Life Sciences, Chonbuk National University, Jeonbuk 561756, Korea

³

Department of Comparative Pathobiology, Purdue University, West Lafayette, IN 47907, USA

^*

Author to whom correspondence should be addressed.

Sensors2017, 17(5), 945;https://doi.org/10.3390/s17050945

This article belongs to the Collection Sensors in Agriculture and Forestry

Version Notes

Order Reprints

Keywords:

n/a

The authors wish to correct the oligonucleotide sequence of primer E-LAP-F1 and LIS-R1 in Table 1 in their paper published in Sensors [], doi:10.3390/s150922672, http://www.mdpi.com/1424-8220/15/9/22672. The following table should be used.

The changes do not affect the scientific results. The manuscript will be updated and the original will remain online on the article webpage, with a reference to this Erratum.

Supplementary Materials

Supplementary File 1

Reference

Kim, K.-P.; Singh, A.K.; Bai, X.; Leprun, L.; Bhunia, A.K.; Kim, K-P. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food. Sensors 2015, 15, 22672–22691. [Google Scholar] [CrossRef] [PubMed]

© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).

Primer	Sequence ^a	Location in Lap Gene	Product Size (bp)	Specificity
ELAP-F1	5′CGGTCCCCGGGTACCATGGCAATTAAAGAAAATGCGGCC3′	1–1301	1301	Listeria spp. (except L. grayi, L. rocourtiae)
LIS-R1	5′TTTGTGATACAGAGTTTTTACC3′	1–1301	1301	Listeria spp. (except L. grayi, L. rocourtiae)
Inn-F1	5′GGAGTTATTAACGAAGATACT3′	286–822	536	L. innocua
Inn-R1	5′TTCTGCTTTTACTTCTTTAGCA3′	286–822	536	L. innocua
IvaSee-F1	5′AAGCTGCAGTTATTCATTCC3′	1137–1743	606	L. ivanovii, L. seeligeri
IvaSee-R1	5′ATCTAAGAATTTTTGTTTTAGT3′	1137–1743	606	L. ivanovii, L. seeligeri
Wel-F1	5′TTCTCGTATTATCGGTTTACCA3′	2344–2581	237	L. welshimeri
Wel-R1	5′GCTTCAAGATAGATTTCTTTCAA3′	2344–2581	237	L. welshimeri
Mar-F1	5′AGAATATATTTGGAACAGCATC3′	246–2059	1813	L. marthii
Mar-R1	5′GTTCGATTGCACGGATGGAAAG3′	246–2059	1813	L. marthii

Erratum: Kim, K.-P.; Singh, A.K.; Bai, X.; Leprun, L.; Bhunia, A.K. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food. Sensors 2015, 15, 22672–22691

Supplementary Materials

Reference

Article Metrics

Citations

Article Access Statistics