Next Article in Journal
Gold Nanoplates for a Localized Surface Plasmon Resonance-Based Boric Acid Sensor
Next Article in Special Issue
Development of a Stereovision-Based Technique to Measure the Spread Patterns of Granular Fertilizer Spreaders
Previous Article in Journal
A Cost-Effective Relative Humidity Sensor Based on Side Coupling Induction Technology
Previous Article in Special Issue
Effective Calibration of Low-Cost Soil Water Content Sensors
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Erratum

Erratum: Kim, K.-P.; Singh, A.K.; Bai, X.; Leprun, L.; Bhunia, A.K. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food. Sensors 2015, 15, 22672–22691

1
Molecular Food Microbiology Laboratory, Department of Food Science, Purdue University, West Lafayette, IN 47907, USA
2
Department of Food Science and Technology, College of Agriculture and Life Sciences, Chonbuk National University, Jeonbuk 561756, Korea
3
Department of Comparative Pathobiology, Purdue University, West Lafayette, IN 47907, USA
*
Author to whom correspondence should be addressed.
These authors contributed equally to this study.
Present address: CROUS de Dijon, Dijon CEDEX 21012, France.
Sensors 2017, 17(5), 945; https://doi.org/10.3390/s17050945
Submission received: 11 April 2017 / Accepted: 12 April 2017 / Published: 25 April 2017
(This article belongs to the Collection Sensors in Agriculture and Forestry)
The authors wish to correct the oligonucleotide sequence of primer E-LAP-F1 and LIS-R1 in Table 1 in their paper published in Sensors [1], doi:10.3390/s150922672, https://www.mdpi.com/1424-8220/15/9/22672. The following table should be used.
The changes do not affect the scientific results. The manuscript will be updated and the original will remain online on the article webpage, with a reference to this Erratum.

Supplementary Materials

Supplementary File 1

Reference

  1. Kim, K.-P.; Singh, A.K.; Bai, X.; Leprun, L.; Bhunia, A.K.; Kim, K-P. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food. Sensors 2015, 15, 22672–22691. [Google Scholar] [CrossRef] [PubMed]
Table 1. Sequences of species-specific primers based on lap sequence used in this study.
Table 1. Sequences of species-specific primers based on lap sequence used in this study.
PrimerSequence aLocation in Lap GeneProduct Size (bp)Specificity
ELAP-F15′CGGTCCCCGGGTACCATGGCAATTAAAGAAAATGCGGCC3′1–13011301Listeria spp. (except L. grayi, L. rocourtiae)
LIS-R15′TTTGTGATACAGAGTTTTTACC3′
Inn-F15′GGAGTTATTAACGAAGATACT3′286–822536L. innocua
Inn-R15′TTCTGCTTTTACTTCTTTAGCA3′
IvaSee-F15′AAGCTGCAGTTATTCATTCC3′1137–1743606L. ivanovii, L. seeligeri
IvaSee-R15′ATCTAAGAATTTTTGTTTTAGT3′
Wel-F15′TTCTCGTATTATCGGTTTACCA3′2344–2581237L. welshimeri
Wel-R15′GCTTCAAGATAGATTTCTTTCAA3′
Mar-F15′AGAATATATTTGGAACAGCATC3′246–20591813L. marthii
Mar-R15′GTTCGATTGCACGGATGGAAAG3′
a Underlining indicates artificial nucleotide addition sites; translation start codon is indicated in bold.

Share and Cite

MDPI and ACS Style

Kim, K.-P.; Singh, A.K.; Bai, X.; Leprun, L.; Bhunia, A.K. Erratum: Kim, K.-P.; Singh, A.K.; Bai, X.; Leprun, L.; Bhunia, A.K. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food. Sensors 2015, 15, 22672–22691. Sensors 2017, 17, 945. https://doi.org/10.3390/s17050945

AMA Style

Kim K-P, Singh AK, Bai X, Leprun L, Bhunia AK. Erratum: Kim, K.-P.; Singh, A.K.; Bai, X.; Leprun, L.; Bhunia, A.K. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food. Sensors 2015, 15, 22672–22691. Sensors. 2017; 17(5):945. https://doi.org/10.3390/s17050945

Chicago/Turabian Style

Kim, Kwang-Pyo, Atul K. Singh, Xingjian Bai, Lena Leprun, and Arun K. Bhunia. 2017. "Erratum: Kim, K.-P.; Singh, A.K.; Bai, X.; Leprun, L.; Bhunia, A.K. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food. Sensors 2015, 15, 22672–22691" Sensors 17, no. 5: 945. https://doi.org/10.3390/s17050945

APA Style

Kim, K.-P., Singh, A. K., Bai, X., Leprun, L., & Bhunia, A. K. (2017). Erratum: Kim, K.-P.; Singh, A.K.; Bai, X.; Leprun, L.; Bhunia, A.K. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food. Sensors 2015, 15, 22672–22691. Sensors, 17(5), 945. https://doi.org/10.3390/s17050945

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop