Erratum: Kim, K.-P.; Singh, A.K.; Bai, X.; Leprun, L.; Bhunia, A.K. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food. Sensors 2015, 15, 22672–22691

Kwang-Pyo Kim; Atul K. Singh; Xingjian Bai; Lena Leprun; Arun K. Bhunia

doi:10.3390/s17050945

,

and

¹

Molecular Food Microbiology Laboratory, Department of Food Science, Purdue University, West Lafayette, IN 47907, USA

²

Department of Food Science and Technology, College of Agriculture and Life Sciences, Chonbuk National University, Jeonbuk 561756, Korea

³

Department of Comparative Pathobiology, Purdue University, West Lafayette, IN 47907, USA

^*

Author to whom correspondence should be addressed.

Sensors2017, 17(5), 945;https://doi.org/10.3390/s17050945

This article belongs to the Collection Sensors in Agriculture and Forestry

Version Notes

Order Reprints

Keywords:

n/a

The authors wish to correct the oligonucleotide sequence of primer E-LAP-F1 and LIS-R1 in Table 1 in their paper published in Sensors [1], doi:10.3390/s150922672, http://www.mdpi.com/1424-8220/15/9/22672. The following table should be used.

Table 1. Sequences of species-specific primers based on lap sequence used in this study.

The changes do not affect the scientific results. The manuscript will be updated and the original will remain online on the article webpage, with a reference to this Erratum.

Supplementary Materials

Supplementary File 1

Reference

Kim, K.-P.; Singh, A.K.; Bai, X.; Leprun, L.; Bhunia, A.K.; Kim, K-P. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food. Sensors 2015, 15, 22672–22691. [Google Scholar] [CrossRef] [PubMed]

© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).

Primer	Sequence ^a	Location in Lap Gene	Product Size (bp)	Specificity
ELAP-F1	5′CGGTCCCCGGGTACCATGGCAATTAAAGAAAATGCGGCC3′	1–1301	1301	Listeria spp. (except L. grayi, L. rocourtiae)
LIS-R1	5′TTTGTGATACAGAGTTTTTACC3′	1–1301	1301	Listeria spp. (except L. grayi, L. rocourtiae)
Inn-F1	5′GGAGTTATTAACGAAGATACT3′	286–822	536	L. innocua
Inn-R1	5′TTCTGCTTTTACTTCTTTAGCA3′	286–822	536	L. innocua
IvaSee-F1	5′AAGCTGCAGTTATTCATTCC3′	1137–1743	606	L. ivanovii, L. seeligeri
IvaSee-R1	5′ATCTAAGAATTTTTGTTTTAGT3′	1137–1743	606	L. ivanovii, L. seeligeri
Wel-F1	5′TTCTCGTATTATCGGTTTACCA3′	2344–2581	237	L. welshimeri
Wel-R1	5′GCTTCAAGATAGATTTCTTTCAA3′	2344–2581	237	L. welshimeri
Mar-F1	5′AGAATATATTTGGAACAGCATC3′	246–2059	1813	L. marthii
Mar-R1	5′GTTCGATTGCACGGATGGAAAG3′	246–2059	1813	L. marthii

Erratum: Kim, K.-P.; Singh, A.K.; Bai, X.; Leprun, L.; Bhunia, A.K. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food. Sensors 2015, 15, 22672–22691

Supplementary Materials

Reference

Article Metrics

Citations

Article Access Statistics