Induced Genetic Deletion of Cell Division Autoantigen 1 in Adulthood Attenuates Diabetes-Associated Renal Fibrosis
Abstract
:1. Introduction
2. Results
2.1. Tamoxifen Treatment Significantly Reduces CDA1 Gene Expression in CDA1Flox/ERCre Mice
2.2. Renal CDA1 Gene Expression Was Persistently Reduced 5 Weeks After Tamoxifen Treatment in Control and Diabetic CDA1Flox/ERCre Mice
2.3. Induced CDA1 Deficiency Does Not Affect Diabetes-Associated Metabolic Parameters
2.4. Diabetes-Associated Kidney Hypertrophy and Tubular Injury Are Attenuated as a Result of CDA1 Deficiency
2.5. Diabetes-Associated Increases in Renal Expression of Profibrotic and Proinflammatory Molecules Are Attenuated in Mice with Induced CDA1 Deficiency
2.6. Diabetes-Associated Increases in Renal Levels of Phosphorylated Smad3 Are Attenuated in Mice with Induced CDA1 Deficiency
3. Discussion
4. Materials and Methods
4.1. Generation of CDA1Flox/ERCre Mice
4.2. Optimization of Tamoxifen Dose
4.3. Induction of Diabetes and Genetic Deletion of CDA1
4.4. Measurements of Metabolic Parameters
4.5. Genotyping CDA1Flox/ERCre Mice
4.6. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
4.7. Histological Analysis
4.8. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
CDA1 | Cell Division Autoantigen 1 |
CDA1BP1 | CDA1 binding protein 1 |
Col I | Collagen I |
Col III | Collagen III |
Cre | Cyclization recombination |
DKD | Diabetic kidney disease |
ECM | Extracellular matrix |
ER | Estrogen receptor |
FN | Fibronectin |
IL6 | Interleukin 6 |
KO | Knockout |
MMP2 | Matrix metalloproteinase 2 |
OPN | Osteopontin |
STZ | Streptozotocin |
TGFβ | Transforming growth factor beta |
WT | Wild type |
Appendix A
Gene | Forward Primer (5′–3′) | Reverse Primer (5′–3′) |
---|---|---|
CDA1: WT-F Primer Set 1 | ACAGGACCTCAGACATATCTCCAT | TGTGCAACACTAGGTTAGTCTCTG |
CDA1: KO-F Primer Set 2 | CTGAGCATCAACACCTATACATGT | TGTGCAACACTAGGTTAGTCTCTG |
Cre: Genotyping Primer set | GTCGATGCAACGAGTGATGA | CAGTGAAACAGCATTGCTGT |
CDA1: RT-PCR Primer Set | CCTGGAGAGCATTCAAATGGACCT | TTCACTGTGGTCAGGATTCTCACT |
β-Actin: RT-PCR Primer Set | GAGGCCCAGAGCAAGAGAG | GGCTGGGGTGTTGGT |
Gene | Forward Primer (5′–3′) | Reverse Primer (5′–3′) | FAM Labelled Probe |
---|---|---|---|
CDA1 | TGTACTTCCAGACAAACCCATACTTT | GCGGTTGCGCTGGAACT | CAAACATGGTGATCGTC |
Col I | GACTGGAAGAGCGGAGAGTACTG | CCTTGATGGCGTCCAGGTT | ATCGACCCTAACCAAG |
Col III | GGGAATGGAGCAAGACAGTCTT | TGCGATATCTATGATGGGTAGTCTCA | AATATCAAACACGCAAGGC |
FN | ACATGGCTTTAGGCGGACAA | ACATTCGGCAGGTATGGTCTTG | CCCCGTCAGGCTTA |
MMP2 | TCACTTTCCTGGGCAACAAGT | GCCACGAGGAATAGGCTATATCC | TGCACCAGCGCCGG |
IL6 | GGGAAATCGTGGAAATGAGAAA | AAGTGCATCATCGTTGTTCATACA | ATTGCCATTGCACAACT |
OPN | TCCAATCGTCCCTACAGTCGAT | AGCCCTTCAACATGTCTGTTCA | ATCACCTCGGCCGT |
References
- Liu, Y. Renal fibrosis: New insights into the pathogenesis and therapeutics. Kidney Int. 2006, 69, 213–217. [Google Scholar] [CrossRef] [PubMed]
- Zeisberg, M.; Neilson, E.G. Mechanisms of tubulointerstitial fibrosis. J. Am. Soc. Nephrol. JASN 2010, 21, 1819–1834. [Google Scholar] [CrossRef]
- Nath, K.A. Tubulointerstitial changes as a major determinant in the progression of renal damage. Am. J. Kidney Dis. Off. J. Natl. Kidney Found. 1992, 20, 1–17. [Google Scholar] [CrossRef] [PubMed]
- Yamamoto, T.; Nakamura, T.; Noble, N.A.; Ruoslahti, E.; Border, W.A. Expression of transforming growth factor beta is elevated in human and experimental diabetic nephropathy. Proc. Natl. Acad. Sci. USA 1993, 90, 1814–1818. [Google Scholar] [CrossRef] [PubMed]
- Tsuchida, K.; Makita, Z.; Yamagishi, S.; Atsumi, T.; Miyoshi, H.; Obara, S.; Ishida, M.; Ishikawa, S.; Yasumura, K.; Koike, T. Suppression of transforming growth factor beta and vascular endothelial growth factor in diabetic nephropathy in rats by a novel advanced glycation end product inhibitor, OPB-9195. Diabetologia 1999, 42, 579–588. [Google Scholar] [CrossRef] [PubMed]
- Ziyadeh, F.N.; Hoffman, B.B.; Han, D.C.; Iglesias-De La Cruz, M.C.; Hong, S.W.; Isono, M.; Chen, S.; McGowan, T.A.; Sharma, K. Long-term prevention of renal insufficiency, excess matrix gene expression, and glomerular mesangial matrix expansion by treatment with monoclonal antitransforming growth factor-beta antibody in db/db diabetic mice. Proc. Natl. Acad. Sci. USA 2000, 97, 8015–8020. [Google Scholar] [CrossRef] [PubMed]
- Petersen, M.; Thorikay, M.; Deckers, M.; van Dinther, M.; Grygielko, E.T.; Gellibert, F.; de Gouville, A.C.; Huet, S.; ten Dijke, P.; Laping, N.J. Oral administration of GW788388, an inhibitor of TGF-beta type I and II receptor kinases, decreases renal fibrosis. Kidney Int. 2008, 73, 705–715. [Google Scholar] [CrossRef]
- Christ, M.; McCartney-Francis, N.L.; Kulkarni, A.B.; Ward, J.M.; Mizel, D.E.; Mackall, C.L.; Gress, R.E.; Hines, K.L.; Tian, H.; Karlsson, S. Immune dysregulation in TGF-beta 1-deficient mice. J. Immunol. 1994, 153, 1936–1946. [Google Scholar] [CrossRef]
- Dickson, M.C.; Martin, J.S.; Cousins, F.M.; Kulkarni, A.B.; Karlsson, S.; Akhurst, R.J. Defective haematopoiesis and vasculogenesis in transforming growth factor-beta 1 knock out mice. Development 1995, 121, 1845–1854. [Google Scholar] [CrossRef]
- Huynh, P.; Chai, Z. Transforming growth factor beta (TGFbeta) and related molecules in chronic kidney disease (CKD). Clin. Sci. 2019, 133, 287–313. [Google Scholar] [CrossRef]
- Chai, Z.; Sarcevic, B.; Mawson, A.; Toh, B.H. SET-related cell division autoantigen-1 (CDA1) arrests cell growth. J. Biol. Chem. 2001, 276, 33665–33674. [Google Scholar] [CrossRef] [PubMed]
- Ozbun, L.L.; You, L.; Kiang, S.; Angdisen, J.; Martinez, A.; Jakowlew, S.B. Identification of differentially expressed nucleolar TGF-beta1 target (DENTT) in human lung cancer cells that is a new member of the TSPY/SET/NAP-1 superfamily. Genomics 2001, 73, 179–193. [Google Scholar] [CrossRef]
- Wang, G.S.; Hong, C.J.; Yen, T.Y.; Huang, H.Y.; Ou, Y.; Huang, T.N.; Jung, W.G.; Kuo, T.Y.; Sheng, M.; Wang, T.F.; et al. Transcriptional modification by a CASK-interacting nucleosome assembly protein. Neuron 2004, 42, 113–128. [Google Scholar] [CrossRef]
- Tao, K.P.; Fong, S.W.; Lu, Z.; Ching, Y.P.; Chan, K.W.; Chan, S.Y. TSPYL2 is important for G1 checkpoint maintenance upon DNA damage. PLoS ONE 2011, 6, e21602. [Google Scholar] [CrossRef]
- Epping, M.T.; Lunardi, A.; Nachmani, D.; Castillo-Martin, M.; Thin, T.H.; Cordon-Cardo, C.; Pandolfi, P.P. TSPYL2 is an essential component of the REST/NRSF transcriptional complex for TGFbeta signaling activation. Cell Death Differ. 2015, 22, 1353–1362. [Google Scholar] [CrossRef] [PubMed]
- Tu, Y.; Wu, W.; Wu, T.; Cao, Z.; Wilkins, R.; Toh, B.H.; Cooper, M.E.; Chai, Z. Antiproliferative autoantigen CDA1 transcriptionally up-regulates p21(Waf1/Cip1) by activating p53 and MEK/ERK1/2 MAPK pathways. J. Biol. Chem. 2007, 282, 11722–11731. [Google Scholar] [CrossRef] [PubMed]
- Magni, M.; Buscemi, G.; Maita, L.; Peng, L.; Chan, S.Y.; Montecucco, A.; Delia, D.; Zannini, L. TSPYL2 is a novel regulator of SIRT1 and p300 activity in response to DNA damage. Cell Death. Differ. 2019, 26, 918–931. [Google Scholar] [CrossRef]
- Cardano, M.; Magni, M.; Alfieri, R.; Chan, S.Y.; Sabbioneda, S.; Buscemi, G.; Zannini, L. Sex specific regulation of TSPY-Like 2 in the DNA damage response of cancer cells. Cell Death Dis. 2023, 14, 197. [Google Scholar] [CrossRef] [PubMed]
- Wei, Y.; Mou, S.; Yang, Q.; Liu, F.; Cooper, M.E.; Chai, Z. To target cellular senescence in diabetic kidney disease: The known and the unknown. Clin. Sci. 2024, 138, 991–1007. [Google Scholar] [CrossRef]
- Kandalaft, L.E.; Zudaire, E.; Portal-Nunez, S.; Cuttitta, F.; Jakowlew, S.B. Differentially Expressed Nucleolar TGF-{beta}1 Target (DENTT) exhibits an inhibitory role on tumorigenesis. Carcinogenesis 2008, 29, 1282–1289. [Google Scholar] [CrossRef]
- Eyler, C.E.; Wu, Q.; Yan, K.; Macswords, J.M.; Chandler-Militello, D.; Misuraca, K.L.; Lathia, J.D.; Forrester, M.T.; Lee, J.; Stamler, J.S.; et al. Glioma stem cell proliferation and tumor growth are promoted by nitric oxide synthase-2. Cell 2011, 146, 53–66. [Google Scholar] [CrossRef]
- Liu, H.; Peng, L.; So, J.; Tsang, K.H.; Chong, C.H.; Mak, P.H.S.; Chan, K.M.; Chan, S.Y. TSPYL2 Regulates the Expression of EZH2 Target Genes in Neurons. Mol. Neurobiol. 2019, 56, 2640–2652. [Google Scholar] [CrossRef] [PubMed]
- Sui, M.; Yan, S.; Zhang, P.; Li, Y.; Chen, K.; Li, Y.; Lu, H.; Li, Y.; Zhao, W.; Zeng, L. The role of Testis-Specific Protein Y-encoded-Like 2 in kidney injury. iScience 2024, 27, 109594. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Wu, X.; Yao, W.; Wang, Y.H. A tumor-suppressing role of TSPYL2 in thyroid cancer: Through interacting with SIRT1 and repressing SIRT1/AKT pathway. Exp. Cell Res. 2023, 432, 113777. [Google Scholar] [CrossRef] [PubMed]
- Chung, W.C.; Huang, T.N.; Hsueh, Y.P. Targeted Deletion of CASK-Interacting Nucleosome Assembly Protein Causes Higher Locomotor and Exploratory Activities. Neurosignals 2011, 19, 128–141. [Google Scholar] [CrossRef]
- Tsang, K.H.; Lai, S.K.; Li, Q.; Yung, W.H.; Liu, H.; Mak, P.H.; Ng, C.C.; McAlonan, G.; Chan, Y.S.; Chan, S.Y. The nucleosome assembly protein TSPYL2 regulates the expression of NMDA receptor subunits GluN2A and GluN2B. Sci. Rep. 2014, 4, 3654. [Google Scholar] [CrossRef]
- Li, Q.; Chan, S.Y.; Wong, K.K.; Wei, R.; Leung, Y.O.; Ding, A.Y.; Hui, T.C.; Cheung, C.; Chua, S.E.; Sham, P.C.; et al. Tspyl2 Loss-of-Function Causes Neurodevelopmental Brain and Behavior Abnormalities in Mice. Behav. Genet 2016, 46, 529–537. [Google Scholar] [CrossRef]
- Moey, C.; Hinze, S.J.; Brueton, L.; Morton, J.; McMullan, D.J.; Kamien, B.; Barnett, C.P.; Brunetti-Pierri, N.; Nicholl, J.; Gecz, J.; et al. Xp11.2 microduplications including IQSEC2, TSPYL2 and KDM5C genes in patients with neurodevelopmental disorders. Eur. J. Hum. Genet 2016, 24, 373–380. [Google Scholar] [CrossRef] [PubMed]
- Pham, Y.; Tu, Y.; Wu, T.; Allen, T.J.; Calkin, A.C.; Watson, A.M.; Li, J.; Jandeleit-Dahm, K.A.; Toh, B.H.; Cao, Z.; et al. Cell division autoantigen 1 plays a profibrotic role by modulating downstream signalling of TGF-beta in a murine diabetic model of atherosclerosis. Diabetologia 2010, 53, 170–179. [Google Scholar] [CrossRef]
- Tu, Y.; Wu, T.; Dai, A.; Pham, Y.; Chew, P.; de Haan, J.B.; Wang, Y.; Toh, B.H.; Zhu, H.; Cao, Z.; et al. Cell division autoantigen 1 enhances signaling and the profibrotic effects of transforming growth factor-beta in diabetic nephropathy. Kidney Int. 2011, 79, 199–209. [Google Scholar] [CrossRef] [PubMed]
- Chai, Z.; Dai, A.; Tu, Y.; Li, J.; Wu, T.; Wang, Y.; Hale, L.J.; Koentgen, F.; Thomas, M.C.; Cooper, M.E. Genetic Deletion of Cell Division Autoantigen 1 Retards Diabetes-Associated Renal Injury. J. Am. Soc. Nephrol. 2013, 24, 1782–1792. [Google Scholar] [CrossRef]
- Li, J.; Huynh, P.; Dai, A.; Wu, T.; Tu, Y.; Chow, B.; Kiriazis, H.; Du, X.J.; Bach, L.A.; Wilkinson-Berka, J.L.; et al. Diabetes Reduces Severity of Aortic Aneurysms Depending on the Presence of Cell Division Autoantigen 1 (CDA1). Diabetes 2018, 67, 755–768. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Wu, J.; Hu, B.; Liu, C.; Wang, H. The Role of Cell Division Autoantigen 1 (CDA1) in Renal Fibrosis of Diabetic Nephropathy. Biomed. Res. Int. 2021, 2021, 6651075. [Google Scholar] [CrossRef] [PubMed]
- Meng, X.M.; Huang, X.R.; Chung, A.C.; Qin, W.; Shao, X.; Igarashi, P.; Ju, W.; Bottinger, E.P.; Lan, H.Y. Smad2 protects against TGF-beta/Smad3-mediated renal fibrosis. J. Am. Soc. Nephrol. 2010, 21, 1477–1487. [Google Scholar] [CrossRef] [PubMed]
- Chai, Z.; Wu, T.; Dai, A.; Huynh, P.; Koentgen, F.; Krippner, G.; Ren, S.; Cooper, M.E. Targeting the CDA1/CDA1BP1 Axis Retards Renal Fibrosis in Experimental Diabetic Nephropathy. Diabetes 2019, 68, 395–408. [Google Scholar] [CrossRef] [PubMed]
- Fioretto, P.; Steffes, M.W.; Sutherland, D.E.; Goetz, F.C.; Mauer, M. Reversal of lesions of diabetic nephropathy after pancreas transplantation. N. Engl. J. Med. 1998, 339, 69–75. [Google Scholar] [CrossRef] [PubMed]
- Kuhn, R.; Torres, R.M. Cre/loxP recombination system and gene targeting. Methods Mol. Biol. 2002, 180, 175–204. [Google Scholar] [PubMed]
- Danielian, P.S.; White, R.; Hoare, S.A.; Fawell, S.E.; Parker, M.G. Identification of residues in the estrogen receptor that confer differential sensitivity to estrogen and hydroxytamoxifen. Mol. Endocrinol. 1993, 7, 232–240. [Google Scholar] [PubMed]
- Metzger, D.; Chambon, P. Site- and time-specific gene targeting in the mouse. Methods 2001, 24, 71–80. [Google Scholar] [CrossRef]
- Kanasaki, K.; Taduri, G.; Koya, D. Diabetic nephropathy: The role of inflammation in fibroblast activation and kidney fibrosis. Front. Endocrinol. 2013, 4, 7. [Google Scholar] [CrossRef]
- Kitada, M.; Ogura, Y.; Koya, D. Rodent models of diabetic nephropathy: Their utility and limitations. Int. J. Nephrol. Renov. Dis. 2016, 9, 279–290. [Google Scholar] [CrossRef] [PubMed]
- Betz, B.; Conway, B.R. An Update on the Use of Animal Models in Diabetic Nephropathy Research. Curr. Diab. Rep. 2016, 16, 18. [Google Scholar] [CrossRef]
- Brosius, F.C., 3rd; Alpers, C.E.; Bottinger, E.P.; Breyer, M.D.; Coffman, T.M.; Gurley, S.B.; Harris, R.C.; Kakoki, M.; Kretzler, M.; Leiter, E.H.; et al. Mouse models of diabetic nephropathy. J. Am. Soc. Nephrol. 2009, 20, 2503–2512. [Google Scholar] [CrossRef] [PubMed]
- Verrecchia, F.; Chu, M.L.; Mauviel, A. Identification of novel TGF-beta/Smad gene targets in dermal fibroblasts using a combined cDNA microarray/promoter transactivation approach. J. Biol. Chem. 2001, 276, 17058–17062. [Google Scholar] [CrossRef]
- Ignotz, R.A.; Massagué, J. Transforming growth factor-beta stimulates the expression of fibronectin and collagen and their incorporation into the extracellular matrix. J. Biol. Chem. 1986, 261, 4337–4345. [Google Scholar] [CrossRef] [PubMed]
- Kim, E.S.; Kim, M.S.; Moon, A. TGF-beta-induced upregulation of MMP-2 and MMP-9 depends on p38 MAPK, but not ERK signaling in MCF10A human breast epithelial cells. Int. J. Oncol. 2004, 25, 1375–1382. [Google Scholar]
- Wang, A.; Ziyadeh, F.N.; Lee, E.Y.; Pyagay, P.E.; Sung, S.H.; Sheardown, S.A.; Laping, N.J.; Chen, S. Interference with TGF-beta signaling by Smad3-knockout in mice limits diabetic glomerulosclerosis without affecting albuminuria. Am. J. Physiol. Ren. Physiol. 2007, 293, F1657–F1665. [Google Scholar] [CrossRef] [PubMed]
- Gurley, S.B.; Mach, C.L.; Stegbauer, J.; Yang, J.; Snow, K.P.; Hu, A.; Meyer, T.W.; Coffman, T.M. Influence of genetic background on albuminuria and kidney injury in Ins2(+/C96Y) (Akita) mice. Am. J. Physiol. Ren. Physiol. 2010, 298, F788–F795. [Google Scholar] [CrossRef]
- Hayashi, S.; McMahon, A.P. Efficient recombination in diverse tissues by a tamoxifen-inducible form of Cre: A tool for temporally regulated gene activation/inactivation in the mouse. Dev. Biol. 2002, 244, 305–318. [Google Scholar] [CrossRef]
- Tesch, G.H.; Allen, T.J. Rodent models of streptozotocin-induced diabetic nephropathy (methods in renal research). Nephrology 2007, 12, 261–266. [Google Scholar] [CrossRef]
- Tikellis, C.; Koh, P.; Burns, W.; Kantharidis, P. Quantitative gene expression analysis in kidney tissues. Methods Mol. Biol. 2009, 466, 83–107. [Google Scholar] [PubMed]
- Kantharidis, P.; Hagiwara, S.; Brennan, E.; McClelland, A.D. Study of microRNA in diabetic nephropathy: Isolation, quantification and biological function. Nephrology 2015, 20, 132–139. [Google Scholar] [CrossRef] [PubMed]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [PubMed]
Mouse Strain | CDA1Flox | CDA1Flox/ERCre | ||
---|---|---|---|---|
Group | Control | Diabetic | Control | Diabetic |
Body Weight (g) | 30.0 ± 0.7 | 25.0 ± 0.4 * | 30.0 ± 0.9 | 26.0 ± 2.2 * |
Food Intake (g/day) | 2.3 ± 0.1 | 4.8 ± 0.1 * | 1.9 ± 0.2 | 4.5 ± 0.2 * |
Water Intake (mL/day) | 1.5 ± 0.2 | 18.4 ± 0.8 * | 2.2 ± 0.2 | 16.0 ± 1.3 * |
Urine Output (mL/day) | 0.7 ± 0.1 | 15.5 ± 0.9 * | 0.8 ± 0.1 | 11.4 ± 1.3 * |
Induction (Genotype) | CDA1Flox | CDA1Flox/ERCre | |||
---|---|---|---|---|---|
Control | Diabetic | Control | Diabetic | ||
Body Weight (g) | vehicle (WT) | 32.0 ± 1.0 | 24.0 ± 1.0 *** | 33.0 ± 1.0 | 24.0 ± 1.0 *** |
Tamoxifen (KO) | 33.0 ± 1.0 | 24.0 ± 1.0 *** | 34.0 ± 1.0 | 26.0 ± 1.0 *** | |
BG (mmol/L) | vehicle (WT) | 14.7 ± 0.9 | 23.1 ± 2.2 * | 14.2 ± 1.2 | 29.5 ± 1.6 *** |
Tamoxifen (KO) | 16.2 ± 0.4 | 25.9 ± 2.0 ** | 15.2 ± 1.5 | 24.5 ± 2.8 * | |
HbA1c (%) | vehicle (WT) | 4.7 ± 0.1 | 11.5 ± 0.7 ** | 4.8 ± 0.2 | 12.6 ± 0.5 *** |
Tamoxifen (KO) | 5.2 ± 0.3 | 11.2 ± 0.8 ** | 4.9 ± 0.2 | 10.6 ± 1.1 *** | |
Food (g/day) | vehicle (WT) | 2.1 ± 0.4 | 5.8 ± 0.2 *** | 1.6 ± 0.3 | 5.3 ± 0.2 *** |
Tamoxifen (KO) | 2.9 ± 0.1 | 5.2 ± 0.3 * | 2.1 ± 0.2 | 4.9 ± 0.4 *** | |
Water (mL/day) | vehicle (WT) | 5.2 ± 1.6 | 26.5 ± 1.7 *** | 3.9 ± 1.0 | 23.7 ± 1.2 *** |
Tamoxifen (KO) | 1.8 ± 1.3 | 21.3 ± 2.7 *** | 1.1 ± 0.3 | 18.7 ± 2.0 *** | |
Urine (mL/day) | vehicle (WT) | 1.0 ± 0.2 | 23.3 ± 1.7 *** | 1.1 ± 0.2 | 20.1 ± 1.4 *** |
Tamoxifen (KO) | 1.4 ± 0.7 | 17.0 ± 2.5 ** | 1.3 ± 0.2 | 14.4 ± 2.8 *** |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huynh, P.; Yang, Y.; Tian, H.; Wu, T.; Huang, M.; Tang, J.; Dai, A.; Cooper, M.E.; Chai, Z. Induced Genetic Deletion of Cell Division Autoantigen 1 in Adulthood Attenuates Diabetes-Associated Renal Fibrosis. Int. J. Mol. Sci. 2025, 26, 2022. https://doi.org/10.3390/ijms26052022
Huynh P, Yang Y, Tian H, Wu T, Huang M, Tang J, Dai A, Cooper ME, Chai Z. Induced Genetic Deletion of Cell Division Autoantigen 1 in Adulthood Attenuates Diabetes-Associated Renal Fibrosis. International Journal of Molecular Sciences. 2025; 26(5):2022. https://doi.org/10.3390/ijms26052022
Chicago/Turabian StyleHuynh, Pacific, Yuxin Yang, Hua Tian, Tieqiao Wu, Minling Huang, Jiali Tang, Aozhi Dai, Mark E. Cooper, and Zhonglin Chai. 2025. "Induced Genetic Deletion of Cell Division Autoantigen 1 in Adulthood Attenuates Diabetes-Associated Renal Fibrosis" International Journal of Molecular Sciences 26, no. 5: 2022. https://doi.org/10.3390/ijms26052022
APA StyleHuynh, P., Yang, Y., Tian, H., Wu, T., Huang, M., Tang, J., Dai, A., Cooper, M. E., & Chai, Z. (2025). Induced Genetic Deletion of Cell Division Autoantigen 1 in Adulthood Attenuates Diabetes-Associated Renal Fibrosis. International Journal of Molecular Sciences, 26(5), 2022. https://doi.org/10.3390/ijms26052022