Localization and Molecular Cloning of the ASMT Gene for Melatonin Synthesis in Pigs
Abstract
1. Introduction
2. Results
2.1. NCBI Database Search Fails to Identify Pig ASMT
2.2. Discrepancies in Pig ASMT Gene Information on Google Scholar
2.3. AKAP17A Gene Is Often Found near ASMT Gene
2.4. Vertical Comparison of ASMT Gene Coordinates and Chromosomal Arrangement Patterns Across Different Species
2.5. ASMT and ASMTL Genes Are Often Adjacent and Arranged in Opposite Directions
2.6. The Pig ASMT Gene Is Located in the PAR Region of the X Chromosome
2.7. Molecular Cloning of the Pig ASMT Gene
3. Discussion
4. Materials and Methods
4.1. Preparation of Common Reagents and Solutions
4.2. Software and Websites for Experimental Analysis
- (1)
- Gene Query and Analysis Websites:NCBI (https://ncbi.nlm.nih.gov/);Ensembl (https://asia.ensembl.org/);UCSC Genome Browser (http://genome.ucsc.edu/).
- (2)
- Primer Design Website: Primer 3.0 (https://primer3.ut.ee).
- (3)
- Vector Design and Sequence Alignment Software: SnapGene.
4.3. Analysis of ASMT Gene Arrangement Across Different Species
4.4. Analysis of ASMTL Gene Arrangement Across Different Species
4.5. Phylogenetic Tree and Protein Domain Analysis
4.6. RNA Extraction from Pig Ovaries
4.7. Reverse Transcription of RNA
- (1)
- Removal of Genomic DNA from RNA
| Components | Volume (µL) |
|---|---|
| 5× gDNA Eraser | 2 |
| gDNA Eraser Buffer | 1 |
| DEPC-Treated Water | 1 |
| RNA Template | 6 |
- (2)
- Reverse Transcription system
| Components | Volume (µL) |
|---|---|
| 5 × PrimeScript® Buffer 2 | 4 |
| PrimeScript® RT Enzyme Mix I | 1 |
| RT Primer Mix | 1 |
| DEPC-Treated Water | 4 |
| The reaction mixture from the previous step | 10 |
4.8. Primer Design
- (1)
- Details of primers
| Gene | Primer Sequence (5′–3′) | Accession. No | Product Length (bp) |
|---|---|---|---|
| ASMT | F1:CCCCAGTTCCCGCACAC | XM_021081386.1 | 1214 |
| R1:CAGAAGCTCAGCATCGCTCT | |||
| F2:CCCCAGTTCCCGCACAC | 1351 | ||
| R2:GACCCCTCACTTCATCACATGCAA |
4.9. PCR Reaction System
- (1)
- Specific response system
| Reagents | Volume |
|---|---|
| High-Fidelity Taq | 25 μL |
| Primer-F | 2 μL |
| Primer-R | 2 μL |
| Template | 2 μL |
| ddH2O | 19 μL |
- (2)
- Specific response system
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Amaral, F.G.D.; Cipolla-Neto, J. A brief review about melatonin, a pineal hormone. Arch. Endocrinol. Metab. 2018, 62, 472–479. [Google Scholar] [CrossRef] [PubMed]
- Gaudet, S.J.; Slominski, A.; Etminan, M.; Pruski, D.; Paus, R.; Namboodiri, M.A. Identification and characterization of two isozymic forms of arylamine N-acetyltransferase in Syrian hamster skin. J. Investig. Dermatol. 1993, 101, 660–665. [Google Scholar] [CrossRef] [PubMed]
- Slominski, A.; Pisarchik, A.; Semak, I.; Sweatman, T.; Wortsman, J. Characterization of the serotoninergic system in the C57BL/6 mouse skin. Eur. J. Biochem. 2003, 270, 3335–3344. [Google Scholar] [CrossRef]
- Gómez-Corvera, A.; Cerrillo, I.; Molinero, P.; Naranjo, M.C.; Lardone, P.J.; Sanchez-Hidalgo, M.; Carrascosa-Salmoral, M.P.; Medrano-Campillo, P.; Guerrero, J.M.; Rubio, A. Evidence of immune system melatonin production by two pineal melatonin deficient mice, C57BL/6 and Swiss strains. J. Pineal Res. 2009, 47, 15–22. [Google Scholar] [CrossRef] [PubMed]
- Ribelayga, C.; Pévet, P.; Simonneaux, V. HIOMT drives the photoperiodic changes in the amplitude of the melatonin peak of the Siberian hamster. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2000, 278, R1339–R1345. [Google Scholar] [CrossRef] [PubMed]
- Ceinos, R.M.; Chansard, M.; Revel, F.; Calgari, C.; Míguez, J.M.; Simonneaux, V. Analysis of adrenergic regulation of melatonin synthesis in Siberian hamster pineal emphasizes the role of HIOMT. Neuro-Signals 2004, 13, 308–317. [Google Scholar] [CrossRef]
- Liu, T.; Borjigin, J. N-acetyltransferase is not the rate-limiting enzyme of melatonin synthesis at night. J. Pineal Res. 2005, 39, 91–96. [Google Scholar] [CrossRef] [PubMed]
- Tan, D.X.; Hardeland, R.; Manchester, L.C.; Paredes, S.D.; Korkmaz, A.; Sainz, R.M.; Mayo, J.C.; Fuentes-Broto, L.; Reiter, R.J. The changing biological roles of melatonin during evolution: From an antioxidant to signals of darkness, sexual selection and fitness. Biol. Rev. Camb. Philos. Soc. 2010, 85, 607–623. [Google Scholar] [CrossRef]
- Du, L.; Liu, B.; Han, Z.; Xia, Y.; Wu, M.; Liu, S. Melatonin shapes bacterial clearance function of porcine macrophages during enterotoxigenic Escherichia coli infection. Anim. Nutr. 2022, 11, 242–251. [Google Scholar] [CrossRef]
- Pezo, F.; Zambrano, F.; Uribe, P.; Moya, C.; de Andrade, A.F.C.; Risopatron, J.; Yeste, M.; Burgos, R.A.; Sánchez, R. Oxidative and nitrosative stress in frozen-thawed pig spermatozoa. I: Protective effect of melatonin and butylhydroxytoluene on sperm function. Res. Vet. Sci. 2021, 136, 143–150. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Zhu, T.; Ma, X.; Wang, Y.; Liu, J.; Li, G.; Liu, Y.; Ji, P.; Zhang, Z.; Zhang, L.; et al. Melatonergic systems of AANAT, melatonin, and its receptor MT2 in the corpus luteum are essential for reproductive success in mammals †. Biol. Reprod. 2021, 104, 430–444. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Zhang, Z.; He, C.; Zhu, K.; Xu, Z.; Ma, T.; Tao, J.; Liu, G. Melatonin protects porcine oocyte in vitro maturation from heat stress. J. Pineal Res. 2015, 59, 365–375. [Google Scholar] [CrossRef] [PubMed]
- Shi, J.M.; Tian, X.Z.; Zhou, G.B.; Wang, L.; Gao, C.; Zhu, S.E.; Zeng, S.M.; Tian, J.H.; Liu, G.S. Melatonin exists in porcine follicular fluid and improves in vitro maturation and parthenogenetic development of porcine oocytes. J. Pineal Res. 2009, 47, 318–323. [Google Scholar] [CrossRef]
- Faillace, M.P.; Cutrera, R.; Sarmiento, M.I.; Rosenstein, R.E. Evidence for local synthesis of melatonin in golden hamster retina. Neuroreport 1995, 6, 2093–2095. [Google Scholar] [CrossRef]
- Slominski, A.; Pisarchik, A.; Semak, I.; Sweatman, T.; Wortsman, J.; Szczesniewski, A.; Slugocki, G.; McNulty, J.; Kauser, S.; Tobin, D.J.; et al. Serotoninergic and melatoninergic systems are fully expressed in human skin. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 2002, 16, 896–898. [Google Scholar] [CrossRef]
- Sakaguchi, K.; Itoh, M.T.; Takahashi, N.; Tarumi, W.; Ishizuka, B. The rat oocyte synthesises melatonin. Reprod. Fertil. Dev. 2013, 25, 674–682. [Google Scholar] [CrossRef]
- Bae, H.; Yang, C.; Lee, J.Y.; Park, S.; Bazer, F.W.; Song, G.; Lim, W. Melatonin improves uterine-conceptus interaction via regulation of SIRT1 during early pregnancy. J. Pineal Res. 2020, 69, e12670. [Google Scholar] [CrossRef] [PubMed]
- Bertho, N.; Meurens, F. The pig as a medical model for acquired respiratory diseases and dysfunctions: An immunological perspective. Mol. Immunol. 2021, 135, 254–267. [Google Scholar] [CrossRef] [PubMed]
- Chuffa, L.G.A.; Carvalho, R.F.; Seiva, F.R.F.; Zuccari, D.A.P.d.C.; Reiter, R.J. Melatonergic index as a prognostic biomarker of reproductive organ cancers: Correlations with metabolic parameters as well as clock genes PER1 and TIMELESS. Melatonin Res. 2021, 4, 299–315. [Google Scholar] [CrossRef]
- Yi, H.; Donohue, S.J.; Klein, D.C.; McBride, O.W. Localization of the hydroxyindole-O-methyltransferase gene to the pseudoautosomal region: Implications for mapping of psychiatric disorders. Hum. Mol. Genet. 1993, 2, 127–131. [Google Scholar] [CrossRef][Green Version]
- Ried, K.; Rao, E.; Schiebel, K.; Rappold, G.A. Gene duplications as a recurrent theme in the evolution of the human pseudoautosomal region 1: Isolation of the gene ASMTL. Hum. Mol. Genet. 1998, 7, 1771–1778. [Google Scholar] [CrossRef] [PubMed]
- Zhang, K.; Ruan, Z.; Li, J.; Bian, C.; You, X.; Coon, S.L.; Shi, Q. A Comparative Genomic and Transcriptomic Survey Provides Novel Insights into N-Acetylserotonin Methyltransferase (ASMT) in Fish. Molecules 2017, 22, 1653. [Google Scholar] [CrossRef] [PubMed]
- Tan, D.X.; Hardeland, R. The Reserve/Maximum Capacity of Melatonin’s Synthetic Function for the Potential Dimorphism of Melatonin Production and Its Biological Significance in Mammals. Molecules 2021, 26, 7302. [Google Scholar] [CrossRef] [PubMed]
- Soriano, P.; Keitges, E.A.; Schorderet, D.F.; Harbers, K.; Gartler, S.M.; Jaenisch, R. High rate of recombination and double crossovers in the mouse pseudoautosomal region during male meiosis. Proc. Natl. Acad. Sci. USA 1987, 84, 7218–7220. [Google Scholar] [CrossRef] [PubMed]
- Gibbs, R.A. The Human Genome Project changed everything. Nat. Rev. Genet. 2020, 21, 575–576. [Google Scholar] [CrossRef] [PubMed]
- Collins, F.S.; Morgan, M.; Patrinos, A. The Human Genome Project: Lessons from large-scale biology. Science 2003, 300, 286–290. [Google Scholar] [CrossRef] [PubMed]
- Miller, W.; Makova, K.D.; Nekrutenko, A.; Hardison, R.C. Comparative genomics. Annu. Rev. Genom. Hum. Genet. 2004, 5, 15–56. [Google Scholar] [CrossRef]
- Koonin, E.V.; Aravind, L.; Kondrashov, A.S. The impact of comparative genomics on our understanding of evolution. Cell 2000, 101, 573–576. [Google Scholar] [CrossRef] [PubMed]
- Ellegren, H. Comparative genomics and the study of evolution by natural selection. Mol. Ecol. 2008, 17, 4586–4596. [Google Scholar] [CrossRef] [PubMed]
- Linhart, C.; Shamir, R. The degenerate primer design problem: Theory and applications. J. Comput. Biol. A J. Comput. Mol. Cell Biol. 2005, 12, 431–456. [Google Scholar] [CrossRef]











Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yan, L.; Li, G.; Deng, S.; Wang, L.; Wang, Y.; Shen, Z.; Yin, D.; Ji, P.; Wang, B.; Liu, G. Localization and Molecular Cloning of the ASMT Gene for Melatonin Synthesis in Pigs. Int. J. Mol. Sci. 2025, 26, 606. https://doi.org/10.3390/ijms26020606
Yan L, Li G, Deng S, Wang L, Wang Y, Shen Z, Yin D, Ji P, Wang B, Liu G. Localization and Molecular Cloning of the ASMT Gene for Melatonin Synthesis in Pigs. International Journal of Molecular Sciences. 2025; 26(2):606. https://doi.org/10.3390/ijms26020606
Chicago/Turabian StyleYan, Laiqing, Guangdong Li, Shoulong Deng, Likai Wang, Yiwei Wang, Zixia Shen, Depeng Yin, Pengyun Ji, Bingyuan Wang, and Guoshi Liu. 2025. "Localization and Molecular Cloning of the ASMT Gene for Melatonin Synthesis in Pigs" International Journal of Molecular Sciences 26, no. 2: 606. https://doi.org/10.3390/ijms26020606
APA StyleYan, L., Li, G., Deng, S., Wang, L., Wang, Y., Shen, Z., Yin, D., Ji, P., Wang, B., & Liu, G. (2025). Localization and Molecular Cloning of the ASMT Gene for Melatonin Synthesis in Pigs. International Journal of Molecular Sciences, 26(2), 606. https://doi.org/10.3390/ijms26020606

