Candida albicans Associated with Periodontal Disease Exhibits Different Clusters of Adhesion Gene and Protease Expression
Abstract
1. Introduction
2. Results
2.1. Origin of the Strains
2.2. Frequency of ALS Genes in the Strains
2.3. Distribution of SAP Genes in the Strains
2.4. ALS Gene Expression in the Strains
2.5. SAP Gene Expression in the Strains
2.6. Unsupervised Hierarchical Clustering
3. Discussion
4. Materials and Methods
4.1. Patient Selection
4.2. DNA Extraction
4.3. Identification of C. albicans
4.4. Identification of ALS Genes in Strains
4.5. Identification of SAP Genes in Strains
4.6. Preparation of Gingival Fibroblasts
4.7. Dilution of C. albicans Yeasts
4.8. In Vitro Infection of Fibroblasts
4.9. C. albicans RNA Extraction and Reverse Transcription to cDNA
4.10. Determination of Virulence Gene Expression in Strains by Real-Time PCR
4.11. Statistical Analysis
4.12. Unsupervised Hierarchical Clustering
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Gulati, M.; Nobile, C.J. Candida albicans biofilms: Development, regulation, and molecular mechanisms. Microbes Infect. 2016, 18, 310–321. [Google Scholar] [CrossRef]
- Yang, C.; Mo, F.; Zhang, J.; Zhang, P.; Li, Q.; Zhang, J.A. Catheter-Related Candida albicans Infection Model in Mouse. J. Vis. Exp. 2024, 205, e65307. [Google Scholar] [CrossRef]
- Duzgol, M.; Boncuoglu, E.; Kiymet, E.; Akaslan-Kara, A.; Erdem, M.; Odaman-Al, I.; Demirag, B.; Zihni, C.; Hilkay-Karapinar, T.; Oymak, Y.; et al. Evaluation for Metastatic Candida Focus and Mortality at Candida-associated Catheter-related Bloodstream Infections at the Pediatric Hematology-oncology Patients. J. Pediatr. Hematol. Oncol. 2022, 44, e643–e648. [Google Scholar] [CrossRef]
- Shahabudin, S.; Azmi, N.S.; Lani, M.N.; Mukhtar, M.; Hossain, M.S. Candida albicans skin infection in diabetic patients: An updated review of pathogenesis and management. Mycoses 2024, 67, e13753. [Google Scholar] [CrossRef] [PubMed]
- Jabri, B.; Iken, M.; Achmit, M.; Rida, S.; Ennibi, O.K. Occurrence of Candida albicans in Periodontitis. Int. J. Dent. 2021, 2021, 5589664. [Google Scholar] [CrossRef] [PubMed]
- Oka, I.; Shigeishi, H.; Ohta, K. Co-Infection of Oral Candida albicans and Porphyromonas gingivalis Is Associated with Active Periodontitis in Middle-Aged and Older Japanese People. Medicina 2022, 58, 723. [Google Scholar] [CrossRef]
- Kwon, T.; Lamster, I.B.; Levin, L. Current Concepts in the Management of Periodontitis. Int. Dent. J. 2021, 71, 462–476. [Google Scholar] [CrossRef] [PubMed]
- Eke, P.I.; Thornton-Evans, G.O.; Wei, L.; Borgnakke, W.S.; Dye, B.A.; Genco, R.J. Periodontitis in US Adults: National Health and Nutrition Examination Survey 2009–2014. J. Am. Dent. Assoc. 2018, 149, 576–588.e6. [Google Scholar] [CrossRef]
- Torrungruang, K.; Jitpakdeebordin, S.; Charatkulangkun, O.; Gleebbua, Y. Porphyromonas gingivalis, Aggregatibacter actinomycetemcomitans, and Treponema denticola/Prevotella intermedia Co-Infection Are Associated with Severe Periodontitis in a Thai Population. PLoS ONE 2015, 10, e0136646. [Google Scholar] [CrossRef]
- Carrouel, F.; Kanoute, A.; Lvovschi, V.E.; Bourgeois, D. Periodontal pathogens of the interdental microbiota in a 3 months pregnant population with an intact periodontium. Front. Microbiol. 2023, 14, 1275180. [Google Scholar] [CrossRef]
- Yekani, M.; Dastgir, M.; Fattahi, S.; Shahi, S.; Maleki Dizaj, S.; Memar, M.Y. Microbiological and molecular aspects of periodontitis pathogenesis: An infection-induced inflammatory condition. Front. Cell. Infect. Microbiol. 2025, 15, 1533658. [Google Scholar] [CrossRef] [PubMed]
- Jepsen, K.; Falk, W.; Brune, F.; Cosgarea, R.; Fimmers, R.; Bekeredjian-Ding, I.; Jepsen, S. Prevalence and Antibiotic Susceptibility Trends of Selected Enterobacteriaceae, Enterococci, and Candida albicans in the Subgingival Microbiota of German Periodontitis Patients: A Retrospective Surveillance Study. Antibiotics 2022, 11, 385. [Google Scholar] [CrossRef] [PubMed]
- Monroy-Pérez, E.; Hernández-Jaimes, T.; Morales-Espinosa, R.; Delgado, G.; Martínez-Gregorio, H.; García-Cortés, L.R.; Herrera-Gabriel, J.P.; De Lira-Silva, A.; Vaca-Paniagua, F.; Paniagua-Contreras, G.L. Analysis of in vitro expression of virulence genes related to antibiotic and disinfectant resistance in Escherichia coli as an emerging periodontal pathogen. Front. Cell. Infect. Microbiol. 2024, 14, 1412007. [Google Scholar] [CrossRef]
- Slazhneva, E.; Tikhomirova, E.; Tsarev, V.; Orekhova, L.; Loboda, E.; Atrushkevich, V. Candida species detection in patients with chronic periodontitis: A systematic review and meta-analysis. Clin. Exp. Dent. Res. 2022, 8, 1354–1375. [Google Scholar] [CrossRef]
- Martorano-Fernandes, L.; Goodwine, J.S.; Ricomini-Filho, A.P.; Nobile, C.J.; Del Bel Cury, A.A. Candida albicans Adhesins Als1 and Hwp1 Modulate Interactions with Streptococcus mutans. Microorganisms 2023, 11, 1391. [Google Scholar] [CrossRef]
- Hoyer, L.L.; Cota, E. Candida albicans Agglutinin-Like Sequence (Als) Family Vignettes: A Review of Als Protein Structure and Function. Front. Microbiol. 2016, 7, 280. [Google Scholar] [CrossRef]
- Kadry, A.A.; El-Ganiny, A.M.; El-Baz, A.M. Relationship between Sap prevalence and biofilm formation among resistant clinical isolates of Candida albicans. Afr. Health. Sci. 2018, 18, 1166–1174. [Google Scholar] [CrossRef]
- Kumar, R.; Rojas, I.G.; Edgerton, M. Candida albicans Sap6 Initiates Oral Mucosal Inflammation via the Protease Activated Receptor PAR2. Front. Immunol. 2022, 13, 912748. [Google Scholar] [CrossRef]
- Pawar, M.Y.; Hatolkar, S.M.; Misra, R.N. Phenotypic and molecular detection of virulence factor genes SAP4 and PLB in Candida albicans isolates from the Western part of India. Med. J. Armed Forces India 2022, 78, 271–276. [Google Scholar] [CrossRef]
- Hube, B.; Stehr, F.; Bossenz, M.; Mazur, A.; Kretschmar, M.; Schäfer, W. Secreted lipases of Candida albicans: Cloning, characterisation and expression analysis of a new gene family with at least ten members. Arch. Microbiol. 2000, 174, 362–374. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Z.; Zhou, Y.; Wang, R.; Xie, F.; Zhai, Z. Expression, purification, and characterization of phospholipase B1 from Candida albicans in Escherichia coli. 3 Biotech 2020, 10, 538. [Google Scholar] [CrossRef]
- Monroy-Pérez, E.; Sáinz-Espuñes, T.; Paniagua-Contreras, G.; Negrete-Abascal, E.; Rodríguez-Moctezuma, J.R.; Vaca, S. Frequency and expression of ALS and HWP1 genotypes in Candida albicans strains isolated from Mexican patients suffering from vaginal candidosis. Mycoses 2012, 55, e151–e157. [Google Scholar] [CrossRef]
- Monroy-Pérez, E.; Paniagua-Contreras, G.L.; Rodríguez-Purata, P.; Vaca-Paniagua, F.; Vázquez-Villaseñor, M.; Díaz-Velásquez, C.; Uribe-García, A.; Vaca, S. High Virulence and Antifungal Resistance in Clinical Strains of Candida albicans. Can. J. Infect. Dis. Med. Microbiol. 2016, 2016, 5930489. [Google Scholar] [CrossRef] [PubMed]
- Green, C.B.; Cheng, G.; Chandra, J.; Mukherjee, P.; Ghannoum, M.A.; Hoyer, L.L. RT-PCR detection of Candida albicans ALS gene expression in the reconstituted human epithelium (RHE) model of oral candidiasis and in model biofilms. Microbiology 2004, 150, 267–275. [Google Scholar] [CrossRef][Green Version]
- Bonfim-Mendonça, P.S.; Tobaldini-Valério, F.K.; Capoci, I.R.; Faria, D.R.; Sakita, K.M.; Arita, G.S.; Negri, M.; Kioshima, É.S.; Svidzinski, T.I. Different expression levels of ALS and SAP genes contribute to recurrent vulvovaginal candidiasis by Candida albicans. Future Microbiol. 2021, 16, 211–219. [Google Scholar] [CrossRef] [PubMed]
- Trindade, D.; Carvalho, R.; Machado, V.; Chambrone, L.; Mendes, J.J.; Botelho, J. Prevalence of periodontitis in dentate people between 2011 and 2020: A systematic review and meta-analysis of epidemiological studies. J. Clin. Periodontol. 2023, 50, 604–626. [Google Scholar] [CrossRef] [PubMed]
- Jabri, B.; Iken, M.; Ait-Ou-Amar, S.; Rida, S.; Bouziane, A.; Ennibi, O.K. Candida albicans and Candida dubliniensis in Periodontitis in Adolescents and Young Adults. Int. J. Microbiol. 2022, 2022, 4625368. [Google Scholar] [CrossRef]
- Veras, E.L.; Castro Dos Santos, N.; Souza, J.G.S.; Figueiredo, L.C.; Retamal-Valdes, B.; Barão, V.A.R.; Shibli, J.; Bertolini, M.; Faveri, M.; Teles, F.; et al. Newly identified pathogens in periodontitis: Evidence from an association and an elimination study. J. Oral Microbiol. 2023, 15, 2213111. [Google Scholar] [CrossRef]
- Fritschi, B.Z.; Albert-Kiszely, A.; Persson, G.R. Staphylococcus aureus and other bacteria in untreated periodontitis. J. Dent. Res. 2008, 87, 589–593. [Google Scholar] [CrossRef]
- Monroy-Pérez, E.; Rodríguez-Bedolla, R.M.; Garzón, J.; Vaca-Paniagua, F.; Arturo-Rojas Jiménez, E.; Paniagua-Contreras, G.L. Marked virulence and azole resistance in Candida albicans isolated from patients with periodontal disease. Microb. Pathog. 2020, 148, 104436. [Google Scholar] [CrossRef]
- Zhao, X.; Oh, S.H.; Cheng, G.; Green, C.B.; Nuessen, J.A.; Yeater, K.; Leng, R.P.; Brown, A.J.P.; Hoyer, L.L. ALS3 and ALS8 represent a single locus that encodes a Candida albicans adhesin; functional comparisons between Als3p and Als1p. Microbiology 2004, 150, 2415–2428. [Google Scholar] [CrossRef]
- Roudbarmohammadi, S.; Roudbary, M.; Bakhshi, B.; Katiraee, F.; Mohammadi, R.; Falahati, M. ALS1 and ALS3 gene expression and biofilm formation in Candida albicans isolated from vulvovaginal candidiasis. Adv. Biomed. Res. 2016, 5, 105. [Google Scholar] [CrossRef]
- Satala, D.; González-González, M.; Smolarz, M.; Surowiec, M.; Kulig, K.; Wronowska, E.; Zawrotniak, M.; Kozik, A.; Rapala-Kozik, M.; Karkowska-Kuleta, J. The Role of Candida albicans Virulence Factors in the Formation of Multispecies Biofilms With Bacterial Periodontal Pathogens. Front. Cell Infect. Microbiol. 2022, 11, 765942. [Google Scholar] [CrossRef]
- Ponde, N.O.; Lortal, L.; Ramage, G.; Naglik, J.R.; Richardson, J.-P. Candida albicans biofilms and polymicrobial interactions. Crit. Rev. Microbiol. 2021, 47, 91–111. [Google Scholar] [CrossRef]
- Ríos-López, A.L.; Garza-Velásquez, M.F.; González, G.M.; Becerril-García, M.A.; Flores-Maldonado, O. Prevalence, virulence factors and antifungal susceptibility of oral isolates of Candida albicans from patients with cystic fibrosis in Mexico. Rev. Iberoam. Micol. 2024, 41, 31–36. [Google Scholar] [CrossRef]
- Cheng, G.; Wozniak, K.; Wallig, M.A.; Fidel Jr, P.L.; Trupin, S.R.; Hoyer, L.L. Comparison between Candida albicans agglutinin-like sequence gene expression patterns in human clinical specimens and models of vaginal candidiasis. Infect. Immun. 2005, 73, 1656–1663. [Google Scholar] [CrossRef] [PubMed]
- Borg-von Zepelin, M.; Meyer, I.; Thomssen, R.; Würzner, R.; Sanglard, D.; Telenti, A.; Monod, M. HIV-Protease inhibitors reduce cell adherence of Candida albicans strains by inhibition of yeast secreted aspartic proteases. J. Investig. Dermatol. 1999, 113, 747–751. [Google Scholar] [CrossRef] [PubMed]
- Borg-von Zepelin, M.; Beggah, S.; Boggian, K.; Sanglard, D.; Monod, M. The expression of the secreted aspartyl proteinases Sap4 to Sap6 from Candida albicans in murine macrophages. Mol. Microbiol. 1998, 28, 543–554. [Google Scholar] [CrossRef]
- Ibrahim, A.S.; Filler, S.G.; Sanglard, D.; Edwards, J.E.J.; Hube, B. Secreted aspartyl proteinases and interactions of Candida albicans with human endothelial cells. Infect. Immun. 1998, 66, 3003–3005. [Google Scholar] [CrossRef] [PubMed]
- Naglik, J.R.; Moyes, D.; Makwana, J.; Kanzaria, P.; Tsichlaki, E.; Weindl, G.; Hube, B. Quantitative expression of the Candida albicans secreted aspartyl proteinase gene family in human oral and vaginal candidiasis. Microbiology 2008, 154, 3266–3280. [Google Scholar] [CrossRef]
- Lian, C.H.; Liu, W.D. Differential expression of Candida albicans secreted aspartyl proteinase in human vulvovaginal candidiasis. Mycoses 2007, 50, 383–390. [Google Scholar] [CrossRef] [PubMed]
- Modrzewska, B.; Kurnatowski, P.; Khalid, K. Comparison of proteolytic activity of Candida sp. strains depending on their origin. J. Mycol. Med. 2016, 26, 138–147. [Google Scholar] [CrossRef]
- Pichová, I.; Pavlíčková, L.; Dostál, J.; Dolejší, E.; Hrušková-Heidingsfeldová, O.; Weber, J.; Ruml, T.; Souček, M. Secreted aspartic proteases of Candida albicans, Candida tropicalis, Candida parapsilosis and Candida lusitaniae: Inhibition with peptidomimetic inhibitors. Eur. J. Biochem. 2001, 268, 2669–2677. [Google Scholar] [CrossRef]
- Naglik, J.R.; Challacombe, S.J.; Hube, B. Candida albicans secreted aspartyl proteinases in virulence and pathogenesis. Microbiol. Mol. Biol. Rev. 2003, 67, 400–428. [Google Scholar] [CrossRef]
- Felk, A.; Kretschmar, M.; Albrecht, A.; Schaller, M.; Beinhauer, S.; Nichterlein, T.; Sanglard, D.; Korting, H.C.; Schäfer, W.; Hube, B. Candida albicans hyphal formation and the expression of the Efg1-regulated proteinases Sap4 to Sap6 are required for the invasion of parenchymal organs. Infect. Immun. 2002, 70, 3689–3700. [Google Scholar] [CrossRef]
- Sanglard, D.; Hube, B.; Monod, M.; Odds, F.C.; Gow, N.A. A triple deletion of the secreted aspartyl proteinase genes SAP4, SAP5, and SAP6 of Candida albicans causes attenuated virulence. Infect. Immun. 1997, 65, 3539–3546. [Google Scholar] [CrossRef]
- Monroy-Pérez, E.; Paniagua-Contreras, G.L.; Vaca-Paniagua, F.; Negrete-Abascal, E.; Vaca-Pacheco, S. SAP Expression in Candida albicans Strains Isolated from Mexican Patients with Vaginal Candidosis. Int. J. Clin. Med. 2013, 4, 25–31. [Google Scholar] [CrossRef]
- Tavanti, A.; Pardini, G.; Campa, D.; Davini, P.; Lupetti, A.; Senesi, S. Differential expression of secretory aspartyl proteinase genes (SAP1-10) in oral Candida albicans isolates with distinct karyotypes. J. Clin. Microbiol. 2004, 42, 4726–4734. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Koukos, G.; Sakellari, D.; Arsenakis, M.; Tsalikis, L.; Slini, T.; Konstantinidis, A. Prevalence of Staphylococcus aureus and methicillin resistant Staphylococcus aureus (MRSA) in the oral cavity. Arch. Oral Biol. 2015, 60, 1410–1415. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Liu, C.; Zheng, W.; Zhang, X.; Yu, J.; Gao, Q.; Hou, Y.; Huang, X. PCR detection of Klebsiella pneumoniae in infant formula based on 16S-23S internal transcribed spacer. Int. J. Food. Microbiol. 2008, 125, 230–235. [Google Scholar] [CrossRef]
- Paniagua-Contreras, G.; Monroy-Pérez, E.; Gutiérrez-Lucas, R.; Sainz-Espuñes, T.; Bustos-Martínez, J.; Vaca, S. Genotypic characterization of methicillin-resistant Staphylococcus aureus strains isolated from the anterior nares and catheter of ambulatory hemodialysis patients in Mexico. Folia Microbiol. 2014, 59, 295–302. [Google Scholar] [CrossRef]
- Ooka, T.; Terajima, J.; Kusumoto, M.; Iguchi, A.; Kurokawa, K.; Ogura, Y.; Asadulghani, M.; Nakayama, K.; Murase, K.; Ohnishi, M.; et al. Development of a multiplex PCR-based rapid typing method for enterohemorrhagic Escherichia coli O157 strains. J. Clin. Microbiol. 2009, 47, 2888–2894. [Google Scholar] [CrossRef]
- Luo, G.; Mitchell, T.G. Rapid identification of pathogenic fungi directly from cultures by using Multiplex PCR. J. Clin. Microbiol. 2002, 40, 2860–2865. [Google Scholar] [CrossRef] [PubMed]
- Schaller, M.; Korting, H.C.; Schäfer, W.; Bastert, J.; Chen, W.; Hube, B. Secreted aspartic proteinase (Sap) activity contributes to tissue damage in a model of human oral candidosis. Mol. Microbiol. 1999, 34, 169–180. [Google Scholar] [CrossRef] [PubMed]
- Gower, J.C. A General Coefficient of Similarity and Some of Its Properties. Biometrics 1971, 27, 857–871. [Google Scholar] [CrossRef]
- Ward, J.H., Jr. Hierarchical Grouping to Optimize an Objective Function. J. Am. Stat. Assoc. 1963, 58, 236–244. [Google Scholar] [CrossRef]

| Function | Gene | Strain Origin (n = 80) | p-Value | Total (n = 80) | ||
|---|---|---|---|---|---|---|
| Gingivitis (n = 6) No. (%) | Moderate Periodontitis (n = 66) No. (%) | Chronic Periodontitis (n = 8) No. (%) | ||||
| ALS1 | 6 (100) | 65 (98.5) | 8 (100) | 1 | 79 | |
| Adhesion | ALS2 | 5 (83.3) | 45 (68.1) | 5 (62.5) | 0.7189 | 55 |
| ALS3 | 5 (83.3) | 58 (87.8) | 7 (87.5) | 0.8202 | 70 | |
| ALS4 | 6 (100) | 65 (98.4) | 8 (100) | 1 | 79 | |
| ALS5 | 4 (66.6) | 48 (72.7) | 4 (50) | 0.3571 | 56 | |
| ALS6 | 6 (100) | 64 (96.9) | 7 (87.5) | 0.443 | 77 | |
| ALS7 | 6 (100) | 64 (96.9) | 8 (100) | 1 | 78 | |
| ALS9 | 6 (100) | 63 (95.4) | 7 (87.5) | 0.5443 | 76 | |
| Function | Gene | Strain Origin (n = 80) | p-Value | Total (n = 80) | ||
|---|---|---|---|---|---|---|
| Gingivitis (n = 6) No. (%) | Moderate Periodontitis (n = 66) No. (%) | Chronic Periodontitis (n = 8) No. (%) | ||||
| Secreted aspartyl protease | SAP1 | 6 (100) | 66 (100) | 8 (100) | 1 | 80 |
| SAP2 | 6 (100) | 65 (98.4) | 7 (87.5) | 0.3212 | 78 | |
| SAP3 | 6 (100) | 62 (93.9) | 7 (87.5) | 0.6282 | 75 | |
| SAP4 | 6 (100) | 64 (96.9) | 8 (100) | 1 | 78 | |
| SAP5 | 6 (100) | 55 (83.3) | 5 (62.5) | 0.1509 | 66 | |
| SAP6 | 6 (100) | 66 (100) | 8 (100) | 1 | 80 | |
| SAP7 | 6 (100) | 65 (98.4) | 8 (100) | 1 | 79 | |
| SAP8 | 6 (100) | 63 (95.4) | 8 (100) | 1 | 77 | |
| SAP9 | 6 (100) | 66 (100) | 8 (100) | 1 | 80 | |
| SAP10 | 6 (100) | 66 (100) | 8 (100) | 1 | 80 | |
| Function | Gene | Strain Origin (n = 80) | p-Value | Total (n = 80) | ||
|---|---|---|---|---|---|---|
| Gingivitis (n = 6) No. (%) | Moderate Periodontitis (n = 66) No. (%) | Chronic Periodontitis (n = 8) No. (%) | ||||
| ALS1 | 5 (83.3) | 64 (98.5) | 8 (100) | 0.2342 | 77 | |
| Adhesion | ALS2 | 0 (0) | 0 (0) | 0 (0) | - | 0 |
| ALS3 | 5 (83.3) | 58 (87.8) | 4 (50) | 0.02123 | 67 | |
| ALS4 | 5 (83.3) | 58 (87.8) | 4 (50) | 0.02123 | 67 | |
| ALS5 | 2 (33.3) | 44 (66.6) | 4 (50) | 0.1845 | 50 | |
| ALS6 | 6 (100) | 64 (96.9) | 7 (87.5) | 0.443 | 77 | |
| ALS7 | 4 (66.6) | 52 (78.7) | 6 (75) | 0.7575 | 62 | |
| ALS9 | 6 (100) | 63 (95.4) | 4 (50) | 0.00264 | 73 | |
| Function | Gene | Strain origin (n = 80) | p-Value | Total (n = 80) | ||
|---|---|---|---|---|---|---|
| Gingivitis (n = 6) No. (%) | Moderate Periodontitis (n = 66) No. (%) | Chronic Periodontitis (n = 8) No. (%) | ||||
| Secreted aspartyl protease | SAP1 | 6 (100) | 62 (93.9) | 8 (100) | 1 | 76 |
| SAP2 | 2 (33.3) | 49 (74.2) | 3 (37.5) | 0.01577 | 54 | |
| SAP3 | 1 (16.6) | 38 (57.5) | 2 (25) | 0.04985 | 41 | |
| SAP4 | 2 (33.3) | 32 (48.4) | 3 (37.5) | 0.6255 | 37 | |
| SAP5 | 3 (50) | 41 (62.1) | 3 (37.5) | 0.3722 | 47 | |
| SAP6 | 3 (50) | 51 (77.2) | 3 (37.5) | 0.02604 | 57 | |
| SAP7 | 1 (16.6) | 46 (69.7) | 3 (37.5) | 0.008886 | 50 | |
| SAP8 | 3 (50) | 44 (66.6) | 5 (62.5) | 0.7372 | 52 | |
| SAP9 | 5 (83.3) | 65 (98.4) | 8 (100) | 0.1541 | 78 | |
| SAP10 | 6 (100) | 63 (95.4) | 8 (100) | 1 | 77 | |
| Gene | Sequence (5′-3′) | Amplicon Size (bp) |
|---|---|---|
| ITS1 ITS2 | TTTATCAACTTGTCACACCAGA | 273 |
| ATCCCGCCTTACCACTACCG | ||
| ALS1 | GACTAGTGAACCAACAAATACCAGA | 318 |
| CCAGAAGAAACAGCAGGTGA | ||
| ALS2 | CCAAGTATTAACAAAGTTTCAATCACTTAT | 366 |
| TCTCAATCTTAAATTGAACGGCTTAC | ||
| ALS3 | CCACTTCACAATCCCCATC | 342 |
| CAGCAGTAGTAGTAACAGTAGTAGTTTCATC | ||
| ALS4 | CCCAGTCTTTCACAAGCAGTAAAT | 356 |
| GTAAATGAGTCATCAACAGAAGCC | ||
| ALS5 | TGACTACTTCCAGATTTATGCCGAG | 318 |
| ATTGATACTGGTTATTATCTGAGGGAGAAA | ||
| ALS6 | GACTCCACAATCATCTAGTAGCTTGGTTT | 152 |
| CAATTGTCACATCATCTTTTGTTGC | ||
| ALS7 | GAAGAGAACTAGCGTTTGGTCTAGTTGT | 206 |
| TGG CATACTCCAATCATTTATTTCA | ||
| ALS9 | CCATATTCAGAAACAAAGGGTTC | 198 |
| AACTGAAACTGCTGGATTTGG | ||
| SAP1 | TCAATCAATTTACTCTTCCATTTCTAACA | 161 |
| CCAGTAGCATTAACAGGAGTTTTAATGACA | ||
| SAP2 | AACAACAACCCACTAGACATCACC | 178 |
| TGACCATTAGTAACTGGGAATGCTTTAGGA | ||
| SAP3 | CCTTCTCTAAAATTATGGATTGGAAC | 231 |
| TTGATTTCACCTTGGGGACCAGTAACATTT | ||
| SAP4 | TTATTTTTAGATATTGAGCCCACAGAAA | 171 |
| GCCAGTGTCAACAATAACGCTAAGTT | ||
| SAP5 | AGAATTTCCCGTCGATGAGACTGG | 277 |
| CAAATTTTGGGAAGTGCGGGAAGA | ||
| SAP6 | CCCGTTTTGAAATTAAATATGCTGATGG | 187 |
| GTCGTAAGGAGTTCTGGTAGCTTCG | ||
| SAP7 | GAAATGCAAAGAGTATTAGAGTTATTAC | 196 |
| GAATGATTTGGTTTACATCATCTTCAACTG | ||
| SAP8 | TCTCAAGAAATTATCCCCCAAAATA | 256 |
| TCGGTTCCATTATCAGAATTTGTTC | ||
| SAP9 | ATTTACTCCACAGTTTATATCACTGAAGGT | 80 |
| CCACCAGAACCACCCTCAGTT | ||
| SAP10 | CCCGGTATCCAATAGAATCGAA | 80 |
| TCAGTGAATGTGACGAATTTGAAGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Paniagua-Contreras, G.L.; Cano-Kobayashi, A.; Fernández-Presas, A.M.; Ruíz-De la Cruz, M.; Martínez-Gregorio, H.; Vaca-Paniagua, F.; Monroy-Pérez, E. Candida albicans Associated with Periodontal Disease Exhibits Different Clusters of Adhesion Gene and Protease Expression. Int. J. Mol. Sci. 2025, 26, 8721. https://doi.org/10.3390/ijms26178721
Paniagua-Contreras GL, Cano-Kobayashi A, Fernández-Presas AM, Ruíz-De la Cruz M, Martínez-Gregorio H, Vaca-Paniagua F, Monroy-Pérez E. Candida albicans Associated with Periodontal Disease Exhibits Different Clusters of Adhesion Gene and Protease Expression. International Journal of Molecular Sciences. 2025; 26(17):8721. https://doi.org/10.3390/ijms26178721
Chicago/Turabian StylePaniagua-Contreras, Gloria Luz, Alan Cano-Kobayashi, Ana María Fernández-Presas, Miguel Ruíz-De la Cruz, Héctor Martínez-Gregorio, Felipe Vaca-Paniagua, and Eric Monroy-Pérez. 2025. "Candida albicans Associated with Periodontal Disease Exhibits Different Clusters of Adhesion Gene and Protease Expression" International Journal of Molecular Sciences 26, no. 17: 8721. https://doi.org/10.3390/ijms26178721
APA StylePaniagua-Contreras, G. L., Cano-Kobayashi, A., Fernández-Presas, A. M., Ruíz-De la Cruz, M., Martínez-Gregorio, H., Vaca-Paniagua, F., & Monroy-Pérez, E. (2025). Candida albicans Associated with Periodontal Disease Exhibits Different Clusters of Adhesion Gene and Protease Expression. International Journal of Molecular Sciences, 26(17), 8721. https://doi.org/10.3390/ijms26178721

