Single-Cell Transcriptomic Profiling Reveals Regional Differences in the Prefrontal and Entorhinal Cortex of Alzheimer’s Disease Brain
Abstract
1. Introduction
2. Results
2.1. Single-Nucleus Transcriptomic Profiling Reveals Region-Specific Cellular Alterations in AD Human Brain Cortex
2.2. Brain Aging Exacerbates Regional Vulnerability in AD
2.3. Cellular and Molecular Differences in AD PFC and EC Regions
2.4. Region-Specific Dysregulation of Astro in AD
2.5. Microglial Heterogeneity Across Two Cortical Regions in AD
2.6. Molecular Characterization of Oligo Dysfunction in AD Cortical Regions
2.7. Regional Heterogeneity of OPC Responses in AD
2.8. ExN Vulnerability and Dysregulation Patterns in AD
2.9. InN Impairment in AD Cortex
2.10. Endo Cell Responses to AD Pathology Across Different Brain Regions
2.11. Characterization of Unknown Cell Populations in AD Cortical Regions
2.12. Comparison Integration of Single-Nucleus and Bulk RNA Sequencing Revealed Conserved Molecular Networks in AD
2.13. Expression Variation of Key Network Genes in the PFC and EC of AD Mice
3. Discussion
4. Materials and Methods
4.1. Datasets Collection
4.2. SnRNA-Seq Data Analysis
4.2.1. Preprocessing, Quality Control, and Data Integration
4.2.2. Data Dimension Reduction and Clustering Analysis
4.2.3. Examination of Cell Type-Specific Transcriptomic Changes
4.3. Gene Ontology (GO) and Kyoto Encyclopedia of Genomes and Genes (KEGG) Signaling Pathway Enrichment Analysis
4.4. Protein-Protein Interactions (PPI) Network Analysis
4.5. Animal Care and Grouping
4.6. Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)
4.7. Data Visualization and Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
Oligo | oligodendrocytes |
ExN | excitatory neurons |
OPC | oligodendrocyte precursor cells |
Astro | astrocytes |
InN | inhibitory neurons |
Endo | endothelial cells |
Micro | microglia |
AD | Alzheimer’s disease |
References
- Kunkle, B.W.; Grenier-Boley, B.; Sims, R.; Bis, J.C.; Damotte, V.; Naj, A.C.; Boland, A.; Vronskaya, M.; van der Lee, S.J.; Amlie-Wolf, A.; et al. Genetic meta-analysis of diagnosed Alzheimer’s disease identifies new risk loci and implicates Aβ, tau, immunity and lipid processing. Nat. Genet. 2019, 51, 414–430. [Google Scholar] [CrossRef]
- Wingo, A.P.; Liu, Y.; Gerasimov, E.S.; Gockley, J.; Logsdon, B.A.; Duong, D.M.; Dammer, E.B.; Robins, C.; Beach, T.G.; Reiman, E.M.; et al. Integrating human brain proteomes with genome-wide association data implicates new proteins in Alzheimer’s disease pathogenesis. Nat. Genet. 2021, 53, 143–146. [Google Scholar] [CrossRef]
- Sierksma, A.; Lu, A.; Mancuso, R.; Fattorelli, N.; Thrupp, N.; Salta, E.; Zoco, J.; Blum, D.; Buée, L.; De Strooper, B.; et al. Novel Alzheimer risk genes determine the microglia response to amyloid-β but not to TAU pathology. EMBO Mol. Med. 2020, 12, e10606. [Google Scholar] [CrossRef]
- Habib, N.; McCabe, C.; Medina, S.; Varshavsky, M.; Kitsberg, D.; Dvir-Szternfeld, R.; Green, G.; Dionne, D.; Nguyen, L.; Marshall, J.L.; et al. Disease-associated astrocytes in Alzheimer’s disease and aging. Nat. Neurosci. 2020, 23, 701–706. [Google Scholar] [CrossRef]
- Keren-Shaul, H.; Spinrad, A.; Weiner, A.; Matcovitch-Natan, O.; Dvir-Szternfeld, R.; Ulland, T.K.; David, E.; Baruch, K.; Lara-Astaiso, D.; Toth, B.; et al. A Unique Microglia Type Associated with Restricting Development of Alzheimer’s Disease. Cell 2017, 169, 1276–1290.e1217. [Google Scholar] [CrossRef]
- Chen, W.T.; Lu, A.; Craessaerts, K.; Pavie, B.; Sala Frigerio, C.; Corthout, N.; Qian, X.; Laláková, J.; Kühnemund, M.; Voytyuk, I.; et al. Spatial Transcriptomics and In Situ Sequencing to Study Alzheimer’s Disease. Cell 2020, 182, 976–991.e919. [Google Scholar] [CrossRef]
- Grubman, A.; Chew, G.; Ouyang, J.F.; Sun, G.; Choo, X.Y.; McLean, C.; Simmons, R.K.; Buckberry, S.; Vargas-Landin, D.B.; Poppe, D.; et al. A single-cell atlas of entorhinal cortex from individuals with Alzheimer’s disease reveals cell-type-specific gene expression regulation. Nat. Neurosci. 2019, 22, 2087–2097. [Google Scholar] [CrossRef]
- Mathys, H.; Davila-Velderrain, J.; Peng, Z.; Gao, F.; Mohammadi, S.; Young, J.Z.; Menon, M.; He, L.; Abdurrob, F.; Jiang, X.; et al. Single-cell transcriptomic analysis of Alzheimer’s disease. Nature 2019, 570, 332–337. [Google Scholar] [CrossRef]
- Lau, S.F.; Cao, H.; Fu, A.K.Y.; Ip, N.Y. Single-nucleus transcriptome analysis reveals dysregulation of angiogenic endothelial cells and neuroprotective glia in Alzheimer’s disease. Proc. Natl. Acad. Sci. USA 2020, 117, 25800–25809. [Google Scholar] [CrossRef]
- Berchtold, N.C.; Coleman, P.D.; Cribbs, D.H.; Rogers, J.; Gillen, D.L.; Cotman, C.W. Synaptic genes are extensively downregulated across multiple brain regions in normal human aging and Alzheimer’s disease. Neurobiol. Aging 2013, 34, 1653–1661. [Google Scholar] [CrossRef]
- Wang, M.; Roussos, P.; McKenzie, A.; Zhou, X.; Kajiwara, Y.; Brennand, K.J.; De Luca, G.C.; Crary, J.F.; Casaccia, P.; Buxbaum, J.D.; et al. Integrative network analysis of nineteen brain regions identifies molecular signatures and networks underlying selective regional vulnerability to Alzheimer’s disease. Genome Med. 2016, 8, 104. [Google Scholar] [CrossRef]
- Brenner, E.; Tiwari, G.R.; Kapoor, M.; Liu, Y.; Brock, A.; Mayfield, R.D. Single cell transcriptome profiling of the human alcohol-dependent brain. Hum. Mol. Genet. 2020, 29, 1144–1153. [Google Scholar] [CrossRef]
- Stuart, T.; Butler, A.; Hoffman, P.; Hafemeister, C.; Papalexi, E.; Mauck, W.M., III; Hao, Y.; Stoeckius, M.; Smibert, P.; Satija, R. Comprehensive Integration of Single-Cell Data. Cell 2019, 177, 1888–1902.e1821. [Google Scholar] [CrossRef] [PubMed]
- Miao, Y.R.; Liu, W.; Zhang, Q.; Guo, A.Y. lncRNASNP2: An updated database of functional SNPs and mutations in human and mouse lncRNAs. Nucleic Acids Res. 2018, 46, D276–D280. [Google Scholar] [CrossRef] [PubMed]
- Vlachos, I.S.; Zagganas, K.; Paraskevopoulou, M.D.; Georgakilas, G.; Karagkouni, D.; Vergoulis, T.; Dalamagas, T.; Hatzigeorgiou, A.G. DIANA-miRPath v3.0: Deciphering microRNA function with experimental support. Nucleic Acids Res. 2015, 43, W460–W466. [Google Scholar] [CrossRef]
- Chen, Y.; Wang, X. miRDB: An online database for prediction of functional microRNA targets. Nucleic Acids Res. 2020, 48, D127–D131. [Google Scholar] [CrossRef]
- Huang, H.Y.; Lin, Y.C.; Li, J.; Huang, K.Y.; Shrestha, S.; Hong, H.C.; Tang, Y.; Chen, Y.G.; Jin, C.N.; Yu, Y.; et al. miRTarBase 2020: Updates to the experimentally validated microRNA-target interaction database. Nucleic Acids Res. 2020, 48, D148–D154. [Google Scholar] [CrossRef]
- Agarwal, V.; Bell, G.W.; Nam, J.W.; Bartel, D.P. Predicting effective microRNA target sites in mammalian mRNAs. eLife 2015, 4, e05005. [Google Scholar] [CrossRef]
- Chen, X.; Sun, G.; Tian, E.; Zhang, M.; Davtyan, H.; Beach, T.G.; Reiman, E.M.; Blurton-Jones, M.; Holtzman, D.M.; Shi, Y. Modeling Sporadic Alzheimer’s Disease in Human Brain Organoids under Serum Exposure. Adv. Sci. 2021, 8, e2101462. [Google Scholar] [CrossRef]
- Iliff, J.J.; Wang, M.; Liao, Y.; Plogg, B.A.; Peng, W.; Gundersen, G.A.; Benveniste, H.; Vates, G.E.; Deane, R.; Goldman, S.A.; et al. A paravascular pathway facilitates CSF flow through the brain parenchyma and the clearance of interstitial solutes, including amyloid β. Sci. Transl. Med. 2012, 4, 147ra111. [Google Scholar] [CrossRef]
- Rasmussen, M.K.; Mestre, H.; Nedergaard, M. The glymphatic pathway in neurological disorders. Lancet Neurol. 2018, 17, 1016–1024. [Google Scholar] [CrossRef] [PubMed]
- Xu, Z.; Xiao, N.; Chen, Y.; Huang, H.; Marshall, C.; Gao, J.; Cai, Z.; Wu, T.; Hu, G.; Xiao, M. Deletion of aquaporin-4 in APP/PS1 mice exacerbates brain Aβ accumulation and memory deficits. Mol. Neurodegener. 2015, 10, 58. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Carlock, C.; Shim, J.; Moreno-Gonzalez, I.; Glass, W.; Ross, A.; Barichello, T.; Quevedo, J.; Lou, Y. Requirement of brain interleukin33 for aquaporin4 expression in astrocytes and glymphatic drainage of abnormal tau. Mol. Psychiatry 2021, 26, 5912–5924. [Google Scholar] [CrossRef]
- Harrison, I.F.; Ismail, O.; Machhada, A.; Colgan, N.; Ohene, Y.; Nahavandi, P.; Ahmed, Z.; Fisher, A.; Meftah, S.; Murray, T.K.; et al. Impaired glymphatic function and clearance of tau in an Alzheimer’s disease model. Brain 2020, 143, 2576–2593. [Google Scholar] [CrossRef]
- Reeves, B.C.; Karimy, J.K.; Kundishora, A.J.; Mestre, H.; Cerci, H.M.; Matouk, C.; Alper, S.L.; Lundgaard, I.; Nedergaard, M.; Kahle, K.T. Glymphatic System Impairment in Alzheimer’s Disease and Idiopathic Normal Pressure Hydrocephalus. Trends. Mol. Med. 2020, 26, 285–295. [Google Scholar] [CrossRef]
- Serrano-Pozo, A.; Das, S.; Hyman, B.T. APOE and Alzheimer’s disease: Advances in genetics, pathophysiology, and therapeutic approaches. Lancet Neurol. 2021, 20, 68–80. [Google Scholar] [CrossRef]
- Nguyen, A.T.; Wang, K.; Hu, G.; Wang, X.; Miao, Z.; Azevedo, J.A.; Suh, E.; Van Deerlin, V.M.; Choi, D.; Roeder, K.; et al. APOE and TREM2 regulate amyloid-responsive microglia in Alzheimer’s disease. Acta. Neuropathol. 2020, 140, 477–493. [Google Scholar] [CrossRef]
- Smith, L.K.; He, Y.; Park, J.S.; Bieri, G.; Snethlage, C.E.; Lin, K.; Gontier, G.; Wabl, R.; Plambeck, K.E.; Udeochu, J.; et al. β2-microglobulin is a systemic pro-aging factor that impairs cognitive function and neurogenesis. Nat. Med. 2015, 21, 932–937. [Google Scholar] [CrossRef]
- Durand, M.; Kolpak, A.; Farrell, T.; Elliott, N.A.; Shao, W.; Brown, M.; Volkert, M.R. The OXR domain defines a conserved family of eukaryotic oxidation resistance proteins. BMC Cell Biol. 2007, 8, 13. [Google Scholar] [CrossRef]
- Wang, J.; Rousseau, J.; Kim, E.; Ehresmann, S.; Cheng, Y.T.; Duraine, L.; Zuo, Z.; Park, Y.J.; Li-Kroeger, D.; Bi, W.; et al. Loss of Oxidation Resistance 1, OXR1, Is Associated with an Autosomal-Recessive Neurological Disease with Cerebellar Atrophy and Lysosomal Dysfunction. Am. J. Hum. Genet. 2019, 105, 1237–1253. [Google Scholar] [CrossRef]
- Liu, K.X.; Edwards, B.; Lee, S.; Finelli, M.J.; Davies, B.; Davies, K.E.; Oliver, P.L. Neuron-specific antioxidant OXR1 extends survival of a mouse model of amyotrophic lateral sclerosis. Brain 2015, 138, 1167–1181. [Google Scholar] [CrossRef] [PubMed]
- Volkert, M.R.; Crowley, D.J. Preventing Neurodegeneration by Controlling Oxidative Stress: The Role of OXR1. Front. Neurosci. 2020, 14, 611904. [Google Scholar] [CrossRef] [PubMed]
- Smith, A.; Bourdeau, I.; Wang, J.; Bondy, C.A. Expression of Catenin family members CTNNA1, CTNNA2, CTNNB1 and JUP in the primate prefrontal cortex and hippocampus. Brain Res. Mol. Brain Res. 2005, 135, 225–231. [Google Scholar] [CrossRef] [PubMed]
- Prokopenko, D.; Morgan, S.L.; Mullin, K.; Hofmann, O.; Chapman, B.; Kirchner, R.; Amberkar, S.; Wohlers, I.; Lange, C.; Hide, W.; et al. Whole-genome sequencing reveals new Alzheimer’s disease-associated rare variants in loci related to synaptic function and neuronal development. Alzheimer’s Dement. 2021, 17, 1509–1527. [Google Scholar] [CrossRef]
- Rotllan, N.; Fernández-Hernando, C. MicroRNA Regulation of Cholesterol Metabolism. Cholesterol 2012, 2012, 847849. [Google Scholar] [CrossRef]
- Porcelli, S.; Calabrò, M.; Crisafulli, C.; Politis, A.; Liappas, I.; Albani, D.; Raimondi, I.; Forloni, G.; Benedetti, F.; Papadimitriou, G.N.; et al. Alzheimer’s Disease and Neurotransmission Gene Variants: Focus on Their Effects on Psychiatric Comorbidities and Inflammatory Parameters. Neuropsychobiology 2019, 78, 79–85. [Google Scholar] [CrossRef]
- Baker, E.; Sims, R.; Leonenko, G.; Frizzati, A.; Harwood, J.C.; Grozeva, D.; Morgan, K.; Passmore, P.; Holmes, C.; Powell, J.; et al. Gene-based analysis in HRC imputed genome wide association data identifies three novel genes for Alzheimer’s disease. PLoS ONE 2019, 14, e0218111. [Google Scholar] [CrossRef]
- Kochunov, P.; Glahn, D.C.; Nichols, T.E.; Winkler, A.M.; Hong, E.L.; Holcomb, H.H.; Stein, J.L.; Thompson, P.M.; Curran, J.E.; Carless, M.A.; et al. Genetic analysis of cortical thickness and fractional anisotropy of water diffusion in the brain. Front. Neurosci. 2011, 5, 120. [Google Scholar] [CrossRef]
- Hu, H.; Li, H.; Li, J.; Yu, J.; Tan, L. Genome-wide association study identified ATP6V1H locus influencing cerebrospinal fluid BACE activity. BMC Med. Genet. 2018, 19, 75. [Google Scholar] [CrossRef]
- Acquaah-Mensah, G.K.; Agu, N.; Khan, T.; Gardner, A. A regulatory role for the insulin- and BDNF-linked RORA in the hippocampus: Implications for Alzheimer’s disease. J. Alzheimer’s Dis. 2015, 44, 827–838. [Google Scholar] [CrossRef]
- Zhang, B.; Wang, A.; Xia, C.; Lin, Q.; Chen, C. A single nucleotide polymorphism in primary-microRNA-146a reduces the expression of mature microRNA-146a in patients with Alzheimer’s disease and is associated with the pathogenesis of Alzheimer’s disease. Mol. Med. Rep. 2015, 12, 4037–4042. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Xu, J.; Xu, J.; Cheng, J.; Jiao, D.; Zhou, C.; Dai, Y.; Chen, Q. Lower Serum Levels of miR-29c-3p and miR-19b-3p as Biomarkers for Alzheimer’s Disease. Tohoku J. Exp. Med. 2017, 242, 129–136. [Google Scholar] [CrossRef] [PubMed]
- Lei, B.; Liu, J.; Yao, Z.; Xiao, Y.; Zhang, X.; Zhang, Y.; Xu, J. NF-κB-Induced Upregulation of miR-146a-5p Promoted Hippocampal Neuronal Oxidative Stress and Pyroptosis via TIGAR in a Model of Alzheimer’s Disease. Front. Cell. Neurosci. 2021, 15, 653881. [Google Scholar] [CrossRef]
- Aharon, A.; Spector, P.; Ahmad, R.S.; Horrany, N.; Sabbach, A.; Brenner, B.; Aharon-Peretz, J. Extracellular Vesicles of Alzheimer’s Disease Patients as a Biomarker for Disease Progression. Mol. Neurobiol. 2020, 57, 4156–4169. [Google Scholar] [CrossRef]
- Qi, X.M.; Wang, C.; Chu, X.K.; Li, G.; Ma, J.F. Intraventricular infusion of clusterin ameliorated cognition and pathology in Tg6799 model of Alzheimer’s disease. BMC Neurosci. 2018, 19, 2. [Google Scholar] [CrossRef]
- Spuch, C.; Ortolano, S.; Navarro, C. LRP-1 and LRP-2 receptors function in the membrane neuron. Trafficking mechanisms and proteolytic processing in Alzheimer’s disease. Front. Physiol. 2012, 3, 269. [Google Scholar] [CrossRef]
- Wang, L.L.; Pan, X.L.; Wang, Y.; Tang, H.D.; Deng, Y.L.; Ren, R.J.; Xu, W.; Ma, J.F.; Wang, G.; Chen, S.D. A single nucleotide polymorphism in LRP2 is associated with susceptibility to Alzheimer’s disease in the Chinese population. Clin. Chim. Acta 2011, 412, 268–270. [Google Scholar] [CrossRef]
- Parcerisas, A.; Rubio, S.E.; Muhaisen, A.; Gómez-Ramos, A.; Pujadas, L.; Puiggros, M.; Rossi, D.; Ureña, J.; Burgaya, F.; Pascual, M.; et al. Somatic signature of brain-specific single nucleotide variations in sporadic Alzheimer’s disease. J. Alzheimer’s Dis. 2014, 42, 1357–1382. [Google Scholar] [CrossRef]
- Targa, A.; Dakterzada, F.; Benítez, I.D.; de Gonzalo-Calvo, D.; Moncusí-Moix, A.; López, R.; Pujol, M.; Arias, A.; de Batlle, J.; Sánchez-de-la-Torre, M.; et al. Circulating MicroRNA Profile Associated with Obstructive Sleep Apnea in Alzheimer’s Disease. Mol. Neurobiol. 2020, 57, 4363–4372. [Google Scholar] [CrossRef]
- Martinez-Mir, A.; González-Pérez, A.; Gayán, J.; Antúnez, C.; Marín, J.; Boada, M.; Lopez-Arrieta, J.M.; Fernández, E.; Ramírez-Lorca, R.; Sáez, M.E.; et al. Genetic study of neurexin and neuroligin genes in Alzheimer’s disease. J. Alzheimer’s Dis. 2013, 35, 403–412. [Google Scholar] [CrossRef]
- Kohannim, O.; Hibar, D.P.; Stein, J.L.; Jahanshad, N.; Hua, X.; Rajagopalan, P.; Toga, A.W.; Jack, C.R., Jr.; Weiner, M.W.; de Zubicaray, G.I.; et al. Discovery and Replication of Gene Influences on Brain Structure Using LASSO Regression. Front. Neurosci. 2012, 6, 115. [Google Scholar] [CrossRef] [PubMed]
- Manzine, P.R.; Pelucchi, S.; Horst, M.A.; Vale, F.A.C.; Pavarini, S.C.I.; Audano, M.; Mitro, N.; Di Luca, M.; Marcello, E.; Cominetti, M.R. microRNA 221 Targets ADAM10 mRNA and is Downregulated in Alzheimer’s Disease. J. Alzheimer’s Dis. 2018, 61, 113–123. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Xu, Y.; Zhu, H.; Ma, C.; Dai, X.; Qin, C. Downregulated microRNA-222 is correlated with increased p27Kip¹ expression in a double transgenic mouse model of Alzheimer’s disease. Mol. Med. Rep. 2015, 12, 7687–7692. [Google Scholar] [CrossRef]
- Dangla-Valls, A.; Molinuevo, J.L.; Altirriba, J.; Sánchez-Valle, R.; Alcolea, D.; Fortea, J.; Rami, L.; Balasa, M.; Muñoz-García, C.; Ezquerra, M.; et al. CSF microRNA Profiling in Alzheimer’s Disease: A Screening and Validation Study. Mol. Neurobiol. 2017, 54, 6647–6654. [Google Scholar] [CrossRef]
- Barbagallo, C.; Mostile, G.; Baglieri, G.; Giunta, F.; Luca, A.; Raciti, L.; Zappia, M.; Purrello, M.; Ragusa, M.; Nicoletti, A. Specific Signatures of Serum miRNAs as Potential Biomarkers to Discriminate Clinically Similar Neurodegenerative and Vascular-Related Diseases. Cell. Mol. Neurobiol. 2020, 40, 531–546. [Google Scholar] [CrossRef]
- Zeng, Q.; Zou, L.; Qian, L.; Zhou, F.; Nie, H.; Yu, S.; Jiang, J.; Zhuang, A.; Wang, C.; Zhang, H. Expression of microRNA-222 in serum of patients with Alzheimer’s disease. Mol. Med. Rep. 2017, 16, 5575–5579. [Google Scholar] [CrossRef]
- Xu, J.; Zhang, P.; Huang, Y.; Zhou, Y.; Hou, Y.; Bekris, L.M.; Lathia, J.; Chiang, C.W.; Li, L.; Pieper, A.A.; et al. Multimodal single-cell/nucleus RNA sequencing data analysis uncovers molecular networks between disease-associated microglia and astrocytes with implications for drug repurposing in Alzheimer’s disease. Genome Res. 2021, 31, 1900–1912. [Google Scholar] [CrossRef]
- Marcus, D.L.; Strafaci, J.A.; Miller, D.C.; Masia, S.; Thomas, C.G.; Rosman, J.; Hussain, S.; Freedman, M.L. Quantitative neuronal c-fos and c-jun expression in Alzheimer’s disease. Neurobiol. Aging 1998, 19, 393–400. [Google Scholar] [CrossRef]
- Anderson, A.J.; Cummings, B.J.; Cotman, C.W. Increased immunoreactivity for Jun- and Fos-related proteins in Alzheimer’s disease: Association with pathology. Exp. Neurol. 1994, 125, 286–295. [Google Scholar] [CrossRef]
- Li, H.; Zhang, X.; Chen, M.; Chen, J.; Gao, T.; Yao, S. Dexmedetomidine inhibits inflammation in microglia cells under stimulation of LPS and ATP by c-Fos/NLRP3/caspase-1 cascades. Excli. J. 2018, 17, 302–311. [Google Scholar] [CrossRef]
- Kim, B.H.; Nho, K.; Lee, J.M. Genome-wide association study identifies susceptibility loci of brain atrophy to NFIA and ST18 in Alzheimer’s disease. Neurobiol. Aging 2021, 102, 200.e201–200.e211. [Google Scholar] [CrossRef] [PubMed]
- Zhao, M.Y.; Wang, G.Q.; Wang, N.N.; Yu, Q.Y.; Liu, R.L.; Shi, W.Q. The long-non-coding RNA NEAT1 is a novel target for Alzheimer’s disease progression via miR-124/BACE1 axis. Neurol. Res. 2019, 41, 489–497. [Google Scholar] [CrossRef] [PubMed]
- Ke, S.; Yang, Z.; Yang, F.; Wang, X.; Tan, J.; Liao, B. Long Noncoding RNA NEAT1 Aggravates Aβ-Induced Neuronal Damage by Targeting miR-107 in Alzheimer’s Disease. Yonsei Med. J. 2019, 60, 640–650. [Google Scholar] [CrossRef] [PubMed]
- Huang, Z.; Zhao, J.; Wang, W.; Zhou, J.; Zhang, J. Depletion of LncRNA NEAT1 Rescues Mitochondrial Dysfunction Through NEDD4L-Dependent PINK1 Degradation in Animal Models of Alzheimer’s Disease. Front. Cell. Neurosci. 2020, 14, 28. [Google Scholar] [CrossRef]
- Song, N.N.; Ma, P.; Zhang, Q.; Zhang, L.; Wang, H.; Zhang, L.; Zhu, L.; He, C.H.; Mao, B.; Ding, Y.Q. Rnf220/Zc4h2-mediated monoubiquitylation of Phox2 is required for noradrenergic neuron development. Development 2020, 147, dev185199. [Google Scholar] [CrossRef]
- Kim, J.; Choi, T.I.; Park, S.; Kim, M.H.; Kim, C.H.; Lee, S. Rnf220 cooperates with Zc4h2 to specify spinal progenitor domains. Development 2018, 145, dev165340. [Google Scholar] [CrossRef]
- Zhang, L.; Ye, M.; Zhu, L.; Cha, J.; Li, C.; Yao, Y.G.; Mao, B. Loss of ZC4H2 and RNF220 Inhibits Neural Stem Cell Proliferation and Promotes Neuronal Differentiation. Cells 2020, 9, 1600. [Google Scholar] [CrossRef]
- Ma, P.; Song, N.N.; Cheng, X.; Zhu, L.; Zhang, Q.; Zhang, L.L.; Yang, X.; Wang, H.; Kong, Q.; Shi, D.; et al. ZC4H2 stabilizes RNF220 to pattern ventral spinal cord through modulating Shh/Gli signaling. J. Mol. Cell Biol. 2020, 12, 337–344. [Google Scholar] [CrossRef]
- Ma, P.; Song, N.N.; Li, Y.; Zhang, Q.; Zhang, L.; Zhang, L.; Kong, Q.; Ma, L.; Yang, X.; Ren, B.; et al. Fine-Tuning of Shh/Gli Signaling Gradient by Non-proteolytic Ubiquitination during Neural Patterning. Cell Rep. 2019, 28, 541–553.e544. [Google Scholar] [CrossRef]
- Monteiro, R.S.; Gentsch, G.E.; Smith, J.C. Transcriptomics of dorso-ventral axis determination in Xenopus tropicalis. Dev. Biol. 2018, 439, 69–79. [Google Scholar] [CrossRef]
- Paus, T.; Bernard, M.; Chakravarty, M.M.; Davey Smith, G.; Gillis, J.; Lourdusamy, A.; Melka, M.G.; Leonard, G.; Pavlidis, P.; Perron, M.; et al. KCTD8 gene and brain growth in adverse intrauterine environment: A genome-wide association study. Cereb. Cortex 2012, 22, 2634–2642. [Google Scholar] [CrossRef] [PubMed]
- Metz, M.; Gassmann, M.; Fakler, B.; Schaeren-Wiemers, N.; Bettler, B. Distribution of the auxiliary GABAB receptor subunits KCTD8, 12, 12b, and 16 in the mouse brain. J. Comp. Neurol. 2011, 519, 1435–1454. [Google Scholar] [CrossRef] [PubMed]
- Sferra, A.; Fortugno, P.; Motta, M.; Aiello, C.; Petrini, S.; Ciolfi, A.; Cipressa, F.; Moroni, I.; Leuzzi, V.; Pieroni, L.; et al. Biallelic mutations in RNF220 cause laminopathies featuring leukodystrophy, ataxia and deafness. Brain 2021, 144, 3020–3035. [Google Scholar] [CrossRef] [PubMed]
- Bhandari, P.; Vandael, D.; Fernández-Fernández, D.; Fritzius, T.; Kleindienst, D.; Önal, C.; Montanaro, J.; Gassmann, M.; Jonas, P.; Kulik, A.; et al. GABA(B) receptor auxiliary subunits modulate Cav2.3-mediated release from medial habenula terminals. eLife 2021, 10, e68274. [Google Scholar] [CrossRef]
- Karataeva, A.R.; Klaassen, R.V.; Ströder, J.; Ruiperez-Alonso, M.; Hjorth, J.J.; van Nierop, P.; Spijker, S.; Mansvelder, H.D.; Smit, A.B. C-terminal interactors of the AMPA receptor auxiliary subunit Shisa9. PLoS ONE 2014, 9, e87360. [Google Scholar] [CrossRef]
- Kunde, S.A.; Rademacher, N.; Zieger, H.; Shoichet, S.A. Protein kinase C regulates AMPA receptor auxiliary protein Shisa9/CKAMP44 through interactions with neuronal scaffold PICK1. FEBS Open Bio 2017, 7, 1234–1245. [Google Scholar] [CrossRef]
- von Engelhardt, J.; Mack, V.; Sprengel, R.; Kavenstock, N.; Li, K.W.; Stern-Bach, Y.; Smit, A.B.; Seeburg, P.H.; Monyer, H. CKAMP44: A brain-specific protein attenuating short-term synaptic plasticity in the dentate gyrus. Science 2010, 327, 1518–1522. [Google Scholar] [CrossRef]
- Khodosevich, K.; Jacobi, E.; Farrow, P.; Schulmann, A.; Rusu, A.; Zhang, L.; Sprengel, R.; Monyer, H.; von Engelhardt, J. Coexpressed auxiliary subunits exhibit distinct modulatory profiles on AMPA receptor function. Neuron 2014, 83, 601–615. [Google Scholar] [CrossRef]
- Gu, X.; Mao, X.; Lussier, M.P.; Hutchison, M.A.; Zhou, L.; Hamra, F.K.; Roche, K.W.; Lu, W. GSG1L suppresses AMPA receptor-mediated synaptic transmission and uniquely modulates AMPA receptor kinetics in hippocampal neurons. Nat. Commun. 2016, 7, 10873. [Google Scholar] [CrossRef]
- Chen, X.; Aslam, M.; Gollisch, T.; Allen, K.; von Engelhardt, J. CKAMP44 modulates integration of visual inputs in the lateral geniculate nucleus. Nat. Commun. 2018, 9, 261. [Google Scholar] [CrossRef]
- Liu, J.; Li, S.; Li, X.; Li, W.; Yang, Y.; Guo, S.; Lv, L.; Xiao, X.; Yao, Y.G.; Guan, F.; et al. Genome-wide association study followed by trans-ancestry meta-analysis identify 17 new risk loci for schizophrenia. BMC Med. 2021, 19, 177. [Google Scholar] [CrossRef] [PubMed]
- Shafik, A.M.; Zhang, F.; Guo, Z.; Dai, Q.; Pajdzik, K.; Li, Y.; Kang, Y.; Yao, B.; Wu, H.; He, C.; et al. N6-methyladenosine dynamics in neurodevelopment and aging, and its potential role in Alzheimer’s disease. Genome Biol. 2021, 22, 17. [Google Scholar] [CrossRef]
- Rudnitskaya, E.A.; Kozlova, T.A.; Burnyasheva, A.O.; Tarasova, A.E.; Pankova, T.M.; Starostina, M.V.; Stefanova, N.A.; Kolosova, N.G. Features of Postnatal Hippocampal Development in a Rat Model of Sporadic Alzheimer’s Disease. Front. Neurosci. 2020, 14, 533. [Google Scholar] [CrossRef] [PubMed]
- Boccardi, V.; Murasecco, I.; Mecocci, P. Diabetes drugs in the fight against Alzheimer’s disease. Ageing Res. Rev. 2019, 54, 100936. [Google Scholar] [CrossRef]
- Ebrahimpour, S.; Zakeri, M.; Esmaeili, A. Crosstalk between obesity, diabetes, and alzheimer’s disease: Introducing quercetin as an effective triple herbal medicine. Ageing Res. Rev. 2020, 62, 101095. [Google Scholar] [CrossRef]
- Biessels, G.J.; Nobili, F.; Teunissen, C.E.; Simó, R.; Scheltens, P. Understanding multifactorial brain changes in type 2 diabetes: A biomarker perspective. Lancet Neurol. 2020, 19, 699–710. [Google Scholar] [CrossRef]
- Biessels, G.J.; Whitmer, R.A. Cognitive dysfunction in diabetes: How to implement emerging guidelines. Diabetologia 2020, 63, 3–9. [Google Scholar] [CrossRef]
- Lanni, C.; Masi, M.; Racchi, M.; Govoni, S. Cancer and Alzheimer’s disease inverse relationship: An age-associated diverging derailment of shared pathways. Mol. Psychiatry 2021, 26, 280–295. [Google Scholar] [CrossRef]
- Horwitz, T.; Lam, K.; Chen, Y.; Xia, Y.; Liu, C. A decade in psychiatric GWAS research. Mol. Psychiatry 2019, 24, 378–389. [Google Scholar] [CrossRef]
- Lin, C.W.; Chang, L.C.; Ma, T.; Oh, H.; French, B.; Puralewski, R.; Mathews, F.; Fang, Y.; Lewis, D.A.; Kennedy, J.L.; et al. Older molecular brain age in severe mental illness. Mol. Psychiatry 2020, 26, 3646–3656. [Google Scholar] [CrossRef]
- Dominy, S.S.; Lynch, C.; Ermini, F.; Benedyk, M.; Marczyk, A.; Konradi, A.; Nguyen, M.; Haditsch, U.; Raha, D.; Griffin, C.; et al. Porphyromonas gingivalis in Alzheimer’s disease brains: Evidence for disease causation and treatment with small-molecule inhibitors. Sci. Adv. 2019, 5, eaau3333. [Google Scholar] [CrossRef] [PubMed]
- de Oliveira Araújo, R.; Villoria, G.E.M.; Luiz, R.R.; Esteves, J.C.; Leão, A.T.T.; Feres-Filho, E.J. Association between periodontitis and Alzheimer’s disease and its impact on the self-perceived oral health status: A case-control study. Clin. Oral Investig. 2021, 25, 555–562. [Google Scholar] [CrossRef] [PubMed]
- Dioguardi, M.; Crincoli, V.; Laino, L.; Alovisi, M.; Sovereto, D.; Mastrangelo, F.; Russo, L.L.; Muzio, L.L. The Role of Periodontitis and Periodontal Bacteria in the Onset and Progression of Alzheimer’s Disease: A Systematic Review. J. Clin. Med. 2020, 9, 495. [Google Scholar] [CrossRef]
- Liccardo, D.; Marzano, F.; Carraturo, F.; Guida, M.; Femminella, G.D.; Bencivenga, L.; Agrimi, J.; Addonizio, A.; Melino, I.; Valletta, A.; et al. Potential Bidirectional Relationship Between Periodontitis and Alzheimer’s Disease. Front. Physiol. 2020, 11, 683. [Google Scholar] [CrossRef]
- Ide, M.; Harris, M.; Stevens, A.; Sussams, R.; Hopkins, V.; Culliford, D.; Fuller, J.; Ibbett, P.; Raybould, R.; Thomas, R.; et al. Periodontitis and Cognitive Decline in Alzheimer’s Disease. PLoS ONE 2016, 11, e0151081. [Google Scholar] [CrossRef] [PubMed]
- Fang, X.; Tang, W.; Yang, F.; Lu, W.; Cai, J.; Ni, J.; Zhang, J.; Tang, W.; Li, T.; Zhang, D.F.; et al. A Comprehensive Analysis of the CaMK2A Gene and Susceptibility to Alzheimer’s Disease in the Han Chinese Population. Front. Aging Neurosci. 2019, 11, 84. [Google Scholar] [CrossRef]
- Vázquez-Higuera, J.L.; Mateo, I.; Sánchez-Juan, P.; Rodríguez-Rodríguez, E.; Pozueta, A.; Calero, M.; Dobato, J.L.; Frank-García, A.; Valdivieso, F.; Berciano, J.; et al. Genetic variation in the tau kinases pathway may modify the risk and age at onset of Alzheimer’s disease. J. Alzheimer’s Dis. 2011, 27, 291–297. [Google Scholar] [CrossRef]
- Arezoumandan, S.; Cai, X.; Kalkarni, P.; Davis, S.A.; Wilson, K.; Ferris, C.F.; Cairns, N.J.; Gitcho, M.A. Hippocampal neurobiology and function in an aged mouse model of TDP-43 proteinopathy in an APP/PSEN1 background. Neurosci. Lett. 2021, 758, 136010. [Google Scholar] [CrossRef]
- Jian, X.Q.; Wang, K.S.; Wu, T.J.; Hillhouse, J.J.; Mullersman, J.E. Association of ADAM10 and CAMK2A polymorphisms with conduct disorder: Evidence from family-based studies. J. Abnorm. Child Psychol. 2011, 39, 773–782. [Google Scholar] [CrossRef]
- Zhu, Y.; Ding, X.; She, Z.; Bai, X.; Nie, Z.; Wang, F.; Wang, F.; Geng, X. Exploring Shared Pathogenesis of Alzheimer’s Disease and Type 2 Diabetes Mellitus via Co-expression Networks Analysis. Curr. Alzheimer Res. 2020, 17, 566–575. [Google Scholar] [CrossRef]
- Lyons, C.E.; Zhou, X.; Razzoli, M.; Chen, M.; Xia, W.; Ashe, K.; Zhang, B.; Bartolomucci, A. Lifelong chronic psychosocial stress induces a proteomic signature of Alzheimer’s disease in wildtype mice. Eur. J. Neurosci. 2021, 55, 2971–2985. [Google Scholar] [CrossRef] [PubMed]
- Bereczki, E.; Branca, R.M.; Francis, P.T.; Pereira, J.B.; Baek, J.H.; Hortobágyi, T.; Winblad, B.; Ballard, C.; Lehtiö, J.; Aarsland, D. Synaptic markers of cognitive decline in neurodegenerative diseases: A proteomic approach. Brain 2018, 141, 582–595. [Google Scholar] [CrossRef] [PubMed]
- Jacob, C.P.; Koutsilieri, E.; Bartl, J.; Neuen-Jacob, E.; Arzberger, T.; Zander, N.; Ravid, R.; Roggendorf, W.; Riederer, P.; Grünblatt, E. Alterations in expression of glutamatergic transporters and receptors in sporadic Alzheimer’s disease. J. Alzheimers Dis. 2007, 11, 97–116. [Google Scholar] [CrossRef] [PubMed]
- Grizenkova, J.; Akhtar, S.; Collinge, J.; Lloyd, S.E. The retinoic acid receptor beta (Rarb) region of Mmu14 is associated with prion disease incubation time in mouse. PLoS ONE 2010, 5, e15019. [Google Scholar] [CrossRef]
- Suszyńska-Zajczyk, J.; Luczak, M.; Marczak, L.; Jakubowski, H. Hyperhomocysteinemia and bleomycin hydrolase modulate the expression of mouse brain proteins involved in neurodegeneration. J. Alzheimer’s Dis. 2014, 40, 713–726. [Google Scholar] [CrossRef]
- Hawi, Z.; Cummins, T.D.; Tong, J.; Johnson, B.; Lau, R.; Samarrai, W.; Bellgrove, M.A. The molecular genetic architecture of attention deficit hyperactivity disorder. Mol. Psychiatry 2015, 20, 289–297. [Google Scholar] [CrossRef]
- Wang, Y.; Guo, R.; Chen, B.; Rahman, T.; Cai, L.; Li, Y.; Dong, Y.; Tseng, G.C.; Fang, J.; Seney, M.L.; et al. Cocaine-induced neural adaptations in the lateral hypothalamic melanin-concentrating hormone neurons and the role in regulating rapid eye movement sleep after withdrawal. Mol. Psychiatry 2020, 26, 3152–3168. [Google Scholar] [CrossRef]
- Gray, A.L.; Hyde, T.M.; Deep-Soboslay, A.; Kleinman, J.E.; Sodhi, M.S. Sex differences in glutamate receptor gene expression in major depression and suicide. Mol. Psychiatry 2015, 20, 1057–1068. [Google Scholar] [CrossRef]
- Elia, J.; Gai, X.; Xie, H.M.; Perin, J.C.; Geiger, E.; Glessner, J.T.; D’Arcy, M.; deBerardinis, R.; Frackelton, E.; Kim, C.; et al. Rare structural variants found in attention-deficit hyperactivity disorder are preferentially associated with neurodevelopmental genes. Mol. Psychiatry 2010, 15, 637–646. [Google Scholar] [CrossRef]
- Ryan, N.M.; Lihm, J.; Kramer, M.; McCarthy, S.; Morris, S.W.; Arnau-Soler, A.; Davies, G.; Duff, B.; Ghiban, E.; Hayward, C.; et al. DNA sequence-level analyses reveal potential phenotypic modifiers in a large family with psychiatric disorders. Mol. Psychiatry 2018, 23, 2254–2265. [Google Scholar] [CrossRef]
- Smith, L.N.; Jedynak, J.P.; Fontenot, M.R.; Hale, C.F.; Dietz, K.C.; Taniguchi, M.; Thomas, F.S.; Zirlin, B.C.; Birnbaum, S.G.; Huber, K.M.; et al. Fragile X mental retardation protein regulates synaptic and behavioral plasticity to repeated cocaine administration. Neuron 2014, 82, 645–658. [Google Scholar] [CrossRef] [PubMed]
- Devon, R.S.; Anderson, S.; Teague, P.W.; Muir, W.J.; Murray, V.; Pelosi, A.J.; Blackwood, D.H.; Porteous, D.J. The genomic organisation of the metabotropic glutamate receptor subtype 5 gene, and its association with schizophrenia. Mol. Psychiatry 2001, 6, 311–314. [Google Scholar] [CrossRef]
- Shin, S.; Kwon, O.; Kang, J.I.; Kwon, S.; Oh, S.; Choi, J.; Kim, C.H.; Kim, D.G. mGluR5 in the nucleus accumbens is critical for promoting resilience to chronic stress. Nat. Neurosci. 2015, 18, 1017–1024. [Google Scholar] [CrossRef]
- Skafidas, E.; Testa, R.; Zantomio, D.; Chana, G.; Everall, I.P.; Pantelis, C. Predicting the diagnosis of autism spectrum disorder using gene pathway analysis. Mol. Psychiatry 2014, 19, 504–510. [Google Scholar] [CrossRef]
- Sathe, G.; Mangalaparthi, K.K.; Jain, A.; Darrow, J.; Troncoso, J.; Albert, M.; Moghekar, A.; Pandey, A. Multiplexed Phosphoproteomic Study of Brain in Patients with Alzheimer’s Disease and Age-Matched Cognitively Healthy Controls. Omics 2020, 24, 216–227. [Google Scholar] [CrossRef]
- Haas, L.T.; Salazar, S.V.; Kostylev, M.A.; Um, J.W.; Kaufman, A.C.; Strittmatter, S.M. Metabotropic glutamate receptor 5 couples cellular prion protein to intracellular signalling in Alzheimer’s disease. Brain 2016, 139, 526–546. [Google Scholar] [CrossRef]
- Loh, K.H.; Stawski, P.S.; Draycott, A.S.; Udeshi, N.D.; Lehrman, E.K.; Wilton, D.K.; Svinkina, T.; Deerinck, T.J.; Ellisman, M.H.; Stevens, B.; et al. Proteomic Analysis of Unbounded Cellular Compartments: Synaptic Clefts. Cell 2016, 166, 1295–1307.e1221. [Google Scholar] [CrossRef]
- Kim, J.A.; Kim, D.; Won, S.Y.; Han, K.A.; Park, D.; Cho, E.; Yun, N.; An, H.J.; Um, J.W.; Kim, E.; et al. Structural Insights into Modulation of Neurexin-Neuroligin Trans-synaptic Adhesion by MDGA1/Neuroligin-2 Complex. Neuron 2017, 94, 1121–1131.e1126. [Google Scholar] [CrossRef]
- Connor, S.A.; Elegheert, J.; Xie, Y.; Craig, A.M. Pumping the brakes: Suppression of synapse development by MDGA-neuroligin interactions. Curr. Opin. Neurobiol. 2019, 57, 71–80. [Google Scholar] [CrossRef]
- Connor, S.A.; Ammendrup-Johnsen, I.; Chan, A.W.; Kishimoto, Y.; Murayama, C.; Kurihara, N.; Tada, A.; Ge, Y.; Lu, H.; Yan, R.; et al. Altered Cortical Dynamics and Cognitive Function upon Haploinsufficiency of the Autism-Linked Excitatory Synaptic Suppressor MDGA2. Neuron 2016, 91, 1052–1068. [Google Scholar] [CrossRef]
- Lee, K.; Kim, Y.; Lee, S.J.; Qiang, Y.; Lee, D.; Lee, H.W.; Kim, H.; Je, H.S.; Südhof, T.C.; Ko, J. MDGAs interact selectively with neuroligin-2 but not other neuroligins to regulate inhibitory synapse development. Proc. Natl. Acad. Sci. USA 2013, 110, 336–341. [Google Scholar] [CrossRef] [PubMed]
- Ceylan, H. Integrated Bioinformatics Analysis to Identify Alternative Therapeutic Targets for Alzheimer’s Disease: Insights from a Synaptic Machinery Perspective. J. Mol. Neurosci. 2021, 72, 273–286. [Google Scholar] [CrossRef] [PubMed]
- Jiang, H.; Jia, J. Association between NR2B subunit gene (GRIN2B) promoter polymorphisms and sporadic Alzheimer’s disease in the North Chinese population. Neurosci. Lett. 2009, 450, 356–360. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.; Li, X.; Wang, T.; Wang, H.H.; Fu, Y.; Zhang, L.; Xiao, S.F. Association between NMDA receptor subunit 2b gene polymorphism and Alzheimer’s disease in Chinese Han population in Shanghai. Neurosci. Bull. 2010, 26, 395–400. [Google Scholar] [CrossRef]
- Andreoli, V.; De Marco, E.V.; Trecroci, F.; Cittadella, R.; Di Palma, G.; Gambardella, A. Potential involvement of GRIN2B encoding the NMDA receptor subunit NR2B in the spectrum of Alzheimer’s disease. J. Neural. Transm. 2014, 121, 533–542. [Google Scholar] [CrossRef]
- Neff, R.A.; Wang, M.; Vatansever, S.; Guo, L.; Ming, C.; Wang, Q.; Wang, E.; Horgusluoglu-Moloch, E.; Song, W.M.; Li, A.; et al. Molecular subtyping of Alzheimer’s disease using RNA sequencing data reveals novel mechanisms and targets. Sci. Adv. 2021, 7, eabb5398. [Google Scholar] [CrossRef]
- Chu, C.S.; Li, C.T.; Brunoni, A.R.; Yang, F.C.; Tseng, P.T.; Tu, Y.K.; Stubbs, B.; Carvalho, A.F.; Thompson, T.; Rajji, T.K.; et al. Cognitive effects and acceptability of non-invasive brain stimulation on Alzheimer’s disease and mild cognitive impairment: A component network meta-analysis. J. Neurol. Neurosurg. Psychiatry 2021, 92, 195–203. [Google Scholar] [CrossRef]
- Segel, M.; Lash, B.; Song, J.; Ladha, A.; Liu, C.C.; Jin, X.; Mekhedov, S.L.; Macrae, R.K.; Koonin, E.V.; Zhang, F. Mammalian retrovirus-like protein PEG10 packages its own mRNA and can be pseudotyped for mRNA delivery. Science 2021, 373, 882–889. [Google Scholar] [CrossRef]
- Nagy, C.; Maitra, M.; Tanti, A.; Suderman, M.; Théroux, J.F.; Davoli, M.A.; Perlman, K.; Yerko, V.; Wang, Y.C.; Tripathy, S.J.; et al. Single-nucleus transcriptomics of the prefrontal cortex in major depressive disorder implicates oligodendrocyte precursor cells and excitatory neurons. Nat. Neurosci. 2020, 23, 771–781. [Google Scholar] [CrossRef]
Stage | Age (Years) | Sex | Datasets | Ref. |
---|---|---|---|---|
PFC_Ct | 56 | M | GSE141552 | [12] |
56 | M | GSE141552 | [12] | |
69 | M | GSE141552 | [12] | |
74 | F | GSE157827 | [9] | |
78 | M | GSE157827 | [9] | |
79 | F | GSE157827 | [9] | |
85 | M | GSE157827 | [9] | |
90 | M | GSE157827 | [9] | |
93 | M | GSE157827 | [9] | |
94 | F | GSE157827 | [9] | |
PFC_AD | 60 | F | GSE157827 | [9] |
63 | M | GSE157827 | [9] | |
69 | M | GSE157827 | [9] | |
71 | M | GSE157827 | [9] | |
72 | M | GSE157827 | [9] | |
84 | M | GSE157827 | [9] | |
85 | M | GSE157827 | [9] | |
95 | M | GSE157827 | [9] | |
EC_CT | 67.3 | F | GSE138852 | [7] |
72.6 | M | GSE138852 | [7] | |
75.6 | M | GSE138852 | [7] | |
77.5 | M | GSE138852 | [7] | |
82.7 | F | GSE138852 | [7] | |
82.7 | M | GSE138852 | [7] | |
EC_AD | 67.8 | F | GSE138852 | [7] |
73 | M | GSE138852 | [7] | |
74.6 | M | GSE138852 | [7] | |
83 | F | GSE138852 | [7] | |
83.8 | M | GSE138852 | [7] | |
91 | M | GSE138852 | [7] |
Genes | Primers | Sequences |
---|---|---|
VCAN | Forward primer | GGTGTCACAACCCGCATTTG |
Reverse primer | TAACAGGTGGGCTGGTTTCC | |
DCN | Forward primer | GTGCTATGGAGTAGAAGCAGGA |
Reverse primer | ACACTGCACCACTCGAAGAT | |
EGFR | Forward primer | AGCTGGCATCATGGGAGAGA |
Reverse primer | CTGCCATTGAACGTACCCAGA | |
CD44 | Forward primer | CACCTTGGCCACCACTCCTAAT |
Reverse primer | TGACTTGGATGGTTGTTGTGGG | |
CHL1 | Forward primer | GGATCTCTGTGGGCAGATCG |
Reverse primer | GAGGCAACGTGCAAAGACTG | |
SRGN | Forward primer | CCAGGCAGGTCAGAGGAAACTG |
Reverse primer | AAGCCATTCGGTTTGCAGCG | |
MSN | Forward primer | TGAGAACATGCGACTGGGAC |
Reverse primer | GGCTCCAGCACAGTGTTAGT | |
LPAR1 | Forward primer | CCTTTGGCCAGGCTTACAGTT |
Reverse primer | GCCAACATGATGAACACGCA | |
RGS1 | Forward primer | CCATCTCCATGCCAAGGTTGA |
Reverse primer | CATTTTGACCTGTCTGGTTGGC | |
RGS7 | Forward primer | CTCCGGGTCAGACATTGTTCA |
Reverse primer | TGAAACCGGTAGAAGGTGCC | |
GRIA1 | Forward primer | ATGTGGAAGCAAGGACTCCG |
Reverse primer | GGATTGCATGGACTTGGGGA | |
GRIA3 | Forward primer | CGAGAGCAAGTTGAGGGGAG |
Reverse primer | CTGTGCTCCTGTACCGTGTT | |
GRIA4 | Forward primer | AAGGCTATGGTGTAGCGACG |
Reverse primer | TCAAGGCACTCGTCTTGTCC | |
CAMK2A | Forward primer | CTGACCATCAACCCGTCCAA |
Reverse primer | CAGAAGATTCCTTCACACCATCG | |
GRM5 | Forward primer | TTGCCTGCTTCTCAGTTGTCT |
Reverse primer | CTCAGGAAGCACCACTAGGAC | |
DLGAP1 | Forward primer | CATCTGCTCTGGGACTTGCT |
Reverse primer | GCTTGTGGTCTGAGTGGTGT | |
AQP4 | Forward primer | GACAAGTGCCCGTAATCTGAC |
Reverse primer | ACAGTCACAGCGGGATTGAT | |
GFAP | Forward primer | AAGCTCCAAGATGAAACCAAC |
Reverse primer | TTCTCTCCAAATCCACACGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Niu, R.-Z.; Feng, W.-Q.; Chen, L.; Bao, T.-H. Single-Cell Transcriptomic Profiling Reveals Regional Differences in the Prefrontal and Entorhinal Cortex of Alzheimer’s Disease Brain. Int. J. Mol. Sci. 2025, 26, 4841. https://doi.org/10.3390/ijms26104841
Niu R-Z, Feng W-Q, Chen L, Bao T-H. Single-Cell Transcriptomic Profiling Reveals Regional Differences in the Prefrontal and Entorhinal Cortex of Alzheimer’s Disease Brain. International Journal of Molecular Sciences. 2025; 26(10):4841. https://doi.org/10.3390/ijms26104841
Chicago/Turabian StyleNiu, Rui-Ze, Wan-Qing Feng, Li Chen, and Tian-Hao Bao. 2025. "Single-Cell Transcriptomic Profiling Reveals Regional Differences in the Prefrontal and Entorhinal Cortex of Alzheimer’s Disease Brain" International Journal of Molecular Sciences 26, no. 10: 4841. https://doi.org/10.3390/ijms26104841
APA StyleNiu, R.-Z., Feng, W.-Q., Chen, L., & Bao, T.-H. (2025). Single-Cell Transcriptomic Profiling Reveals Regional Differences in the Prefrontal and Entorhinal Cortex of Alzheimer’s Disease Brain. International Journal of Molecular Sciences, 26(10), 4841. https://doi.org/10.3390/ijms26104841