Rapid Nucleic Acid Detection of Listeria monocytogenes Based on RAA-CRISPR Cas12a System
Abstract
1. Introduction
2. Results
2.1. Optimization of RAA-CRISPR/Cas12a Detection System
2.2. Evaluation of the Sensitivity of the L. monocytogenes RAA-CRISPR/Cas12a Detection System
2.3. Evaluation of the Specificity of Intergeneric and Interspecific RAA-CRISPR/Cas12a Detection System for L. monocytogenes
2.4. Detection of L. monocytogenes in Beef Substrate and Comparison with National Standard Method
2.5. Detection of L. monocytogenes in Actual Samples with RAA-CRISPR/Cas12a
3. Discussion
4. Materials and Methods
4.1. Bacterial Culture and Extraction of Genomic DNA
4.2. Primer Design and crRNA Synthesis
4.3. RAA Amplification and CRISPR/Cas12a Detection
4.4. Evaluation of Specificity and Sensitivity of RAA-CRISPR/Cas12 System
4.5. Validation of RAA-CRISPR/Cas12a in Beef Substrates and Detection in Real Products
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Havelaar, A.H.; Kirk, M.D.; Torgerson, P.R.; Gibb, H.J.; Hald, T.; Lake, R.J.; Praet, N.; Bellinger, D.C.; De Silva, N.R.; Gargouri, N.; et al. World Health Organization Global Estimates and Regional Comparisons of the Burden of Foodborne Disease in 2010. PLoS Med. 2015, 12, e1001923. [Google Scholar] [CrossRef]
- Zhu, S.; Song, Y.; Pei, J.; Xue, F.; Cui, X.; Xiong, X.; Li, C. The application of photodynamic inactivation to microorganisms in food. Food Chem. X 2021, 12, 100150. [Google Scholar] [CrossRef]
- Dada, A.C.; Somorin, Y.M.; Ateba, C.N.; Onyeaka, H.; Anyogu, A.; Kasan, N.A.; Odeyemi, O.A. Microbiological hazards associated with food products imported from the Asia-Pacific region based on analysis of the rapid alert system for food and feed (RASFF) notifications. Food Control 2021, 129, 108243. [Google Scholar] [CrossRef]
- Kaptchouang Tchatchouang, C.-D.; Fri, J.; De Santi, M.; Brandi, G.; Schiavano, G.F.; Amagliani, G.; Ateba, C.N. Listeriosis Outbreak in South Africa: A Comparative Analysis with Previously Reported Cases Worldwide. Microorganisms 2020, 8, 135. [Google Scholar] [CrossRef]
- Tecellioglu, M.; Kamisli, O.; Kamisli, S.; Erdogmus, U.A.; Ozcan, C. Listeria monocytogenes rhombencephalitis in a patient with multiple sclerosis during fingolimod therapy. Mult. Scler. Relat. Disord. 2019, 27, 409–411. [Google Scholar] [CrossRef] [PubMed]
- Reissbrodt, R. New chromogenic plating media for detection and enumeration of pathogenic Listeria spp.—An overview. Int. J. Food Microbiol. 2004, 95, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Kirkan, S.; Goksoy, E.O.; Kaya, O. Detection of Listeria monocytogenes by using PCR in Helix pomatia. Turk. J. Vet. Anim. Sci. 2006, 30, 375–380. [Google Scholar]
- Portanti, O.; Di Febo, T.; Luciani, M.; Pompilii, C.; Lelli, R.; Semprini, P. Development and validation of an antigen capture ELISA based on monoclonal antibodies specific for Listeria monocytogenes in food. Vet. Ital. 2011, 47, 281–290. [Google Scholar] [PubMed]
- Chen, J.-Q.; Healey, S.; Regan, P.; Laksanalamai, P.; Hu, Z. PCR-based methodologies for detection and characterization of Listeria monocytogenes and Listeria ivanovii in foods and environmental sources. Food Sci. Hum. Wellness 2017, 6, 39–59. [Google Scholar] [CrossRef]
- Wang, D.-G.; Brewster, J.D.; Paul, M.; Tomasula, P.M. Two Methods for Increased Specificity and Sensitivity in Loop-Mediated Isothermal Amplification. Molecules 2015, 20, 6048–6059. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Chen, Y.-R.; Nou, X.; Chao, K. Potential of surface-enhanced Raman spectroscopy for the rapid identification of Escherichia coli and Listeria monocytogenes cultures on silver colloidal nanoparticles. Appl. Spectrosc. 2007, 61, 824–831. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Salazar, J.K. Culture-Independent Rapid Detection Methods for Bacterial Pathogens and Toxins in Food Matrices. Compr. Rev. Food Sci. Food Saf. 2016, 15, 183–205. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Shang, X.; Huang, X. Next-generation pathogen diagnosis with CRISPR/Cas-based detection methods. Emerg. Microbes Infect. 2020, 9, 1682–1691. [Google Scholar] [CrossRef] [PubMed]
- Barrangou, R.; Coute-Monvoisin, A.-C.; Stahl, B.; Chavichvily, I.; Damange, F.; Romero, D.A.; Boyaval, P.; Fremaux, C.; Horvath, P. Genomic impact of CRISPR immunization against bacteriophages. Biochem. Soc. Trans. 2013, 41, 1383–1391. [Google Scholar] [CrossRef]
- Shen, J.; Zhou, X.; Shan, Y.; Yue, H.; Huang, R.; Hu, J.; Xing, D. Sensitive detection of a bacterial pathogen using allosteric probe-initiated catalysis and CRISPR-Cas13a amplification reaction. Nat. Commun. 2020, 11, 267. [Google Scholar] [CrossRef]
- Wei, J. Accurate and sensitive analysis of Staphylococcus aureus through CRISPR-Cas12a based recycling signal amplification cascades for early diagnosis of skin and soft tissue infections. J. Microbiol. Methods 2021, 183, 106167. [Google Scholar] [CrossRef]
- Sun, X.; Wang, Y.; Zhang, L.; Liu, S.; Zhang, M.; Wang, J.; Ning, B.; Peng, Y.; He, J.; Hu, Y.; et al. CRISPR-Cas9 Triggered Two-Step Isothermal Amplification Method for E. coli O157:H7 Detection Based on a Metal-Organic Framework Platform. Anal. Chem. 2020, 92, 3032–3041. [Google Scholar] [CrossRef]
- Xu, Z.; Chen, D.; Li, T.; Yan, J.; Zhu, J.; He, T.; Hu, R.; Li, Y.; Yang, Y.; Liu, M. Microfluidic space coding for multiplexed nucleic acid detection via CRISPR-Cas12a and recombinase polymerase amplification. Nat. Commun. 2022, 13, 6480. [Google Scholar] [CrossRef]
- Zhang, X.; Tian, Y.; Xu, L.; Fan, Z.; Cao, Y.; Ma, Y.; Li, H.; Ren, F. CRISPR/Cas13-assisted hepatitis B virus covalently closed circular DNA detection. Hepatol. Int. 2022, 16, 306–315. [Google Scholar] [CrossRef] [PubMed]
- Park, J.S.; Hsieh, K.; Chen, L.; Kaushik, A.; Trick, A.Y.; Wang, T.-H. Digital CRISPR/Cas-Assisted Assay for Rapid and Sensitive Detection of SARS-CoV-2. Adv. Sci. 2021, 8, 2003564. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J.; Ao, C.; Wan, Z.; Dzakah, E.E.; Liang, Y.; Lin, H.; Wang, H.; Tang, S. A point-of-care rapid HIV-1 test using an isothermal recombinase-aided amplification and CRISPR Cas12a-mediated detection. Virus Res. 2021, 303. [Google Scholar] [CrossRef]
- Shi, Y.; Kang, L.; Mu, R.; Xu, M.; Duan, X.; Li, Y.; Yang, C.; Ding, J.-W.; Wang, Q.; Li, S. CRISPR/Cas12a-Enhanced Loop-Mediated Isothermal Amplification for the Visual Detection of Shigella flexneri. Front. Bioeng. Biotechnol. 2022, 10, 198505. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Guo, L.; Ma, R.; Cong, L.; Wu, Z.; Wei, Y.; Xue, S.; Zheng, W.; Tang, S. Rapid detection of Salmonella with Recombinase Aided Amplification. J. Microbiol. Methods 2017, 139, 202–204. [Google Scholar] [CrossRef]
- Bhardwaj, P.; Kant, R.; Behera, S.P.; Dwivedi, G.R.; Singh, R. Next-Generation Diagnostic with CRISPR/Cas: Beyond Nucleic Acid Detection. Int. J. Mol. Sci. 2022, 23, 6052. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M.; Liu, C.; Shi, Y.; Wu, J.; Wu, J.; Chen, H. Selective endpoint visualized detection of Vibrio parahaemolyticus with CRISPR/Cas12a assisted PCR using thermal cycler for on-site application. Talanta 2020, 214, 120818. [Google Scholar] [CrossRef]
- Liu, H.; Wang, J.; Zeng, H.; Liu, X.; Jiang, W.; Wang, Y.; Ouyang, W.; Tang, X. RPA-Cas12a-FS: A frontline nucleic acid rapid detection system for food safety based on CRISPR-Cas12a combined with recombinase polymerase amplification. Food Chem. 2021, 334, 127608. [Google Scholar] [CrossRef]
- Farber, J.M.; Peterkin, P.I. Listeria monocytogenes, a food-borne pathogen. Microbiol. Rev. 1991, 55, 476–511. [Google Scholar] [CrossRef]
- Vazquez-Boland, J.A.; Kuhn, M.; Berche, P.; Chakraborty, T.; Dominguez-Bernal, G.; Goebel, W.; Gonzalez-Zorn, B.; Wehland, J.; Kreft, J. Listeria pathogenesis and molecular virulence determinants. Clin. Microbiol. Rev. 2001, 14, 584–640. [Google Scholar] [CrossRef]
- Wu, L.; Zhou, T.; Huang, R. A universal CRISPR/Cas9-based electrochemiluminescence probe for sensitive and single-base-specific DNA detection. Sens. Actuators B Chem. 2022, 357, 131411. [Google Scholar] [CrossRef]
- Wang, M.; Zhang, R.; Li, J. CRISPR/cas systems redefine nucleic acid detection: Principles and methods. Biosens. Bioelectron. 2020, 165, 112430. [Google Scholar] [CrossRef]
- Li, Y.; Shi, Z.; Hu, A.; Cui, J.; Yang, K.; Liu, Y.; Deng, G.; Zhu, C.; Zhu, L. Rapid One-Tube RPA-CRISPR/Cas12 Detection Platform for Methicillin-Resistant Staphylococcus aureus. Diagnostics 2022, 12, 829. [Google Scholar] [CrossRef] [PubMed]
- Lin, M.; Yue, H.; Tian, T.; Xiong, E.; Zhu, D.; Jiang, Y.; Zhou, X. Glycerol Additive Boosts 100-fold Sensitivity Enhancement for One-Pot RPA-CRISPR/Cas12a Assay. Anal. Chem. 2022, 94, 8277–8284. [Google Scholar] [CrossRef] [PubMed]
- Osborne, S.E.; Brumell, J.H. Listeriolysin O: From bazooka to Swiss army knife. Philos. Trans. R Soc. Lond. B Biol. Sci. 2017, 372, 20160222. [Google Scholar] [CrossRef] [PubMed]
No. | Species | Strains | Detection Results |
---|---|---|---|
1 | L. monocytogenes | a ATCC BAA 751 | + |
2 | L. monocytogenes | Lmo 453 (Laboratory isolate) | + |
3 | L. monocytogenes | Lmo 503 (Laboratory isolate) | + |
4 | L. monocytogenes | Lmo 535 (Laboratory isolate) | + |
5 | L. monocytogenes | Lmo 549 (Laboratory isolate) | + |
6 | L. monocytogenes | Lmo 565 (Laboratory isolate) | + |
7 | L. monocytogenes | Lmo 761 (Laboratory isolate) | + |
8 | L. monocytogenes | Lmo 762 (Laboratory isolate) | + |
9 | L. monocytogenes | Lmo 763 (Laboratory isolate) | + |
10 | L. monocytogenes | Lmo 764 (Laboratory isolate) | + |
11 | L. monocytogenes | Lmo 769 (Laboratory isolate) | + |
12 | L. monocytogenes | Lmo 773 (Laboratory isolate) | + |
13 | L. monocytogenes | Lmo 775 (Laboratory isolate) | + |
14 | Listeria ivanovii | ATCC 19119 | − |
15 | Listeria innocua | ATCC 33090 | − |
16 | Listeria grayi | ATCC 700545 | − |
17 | Listeria seeligeri | ATCC 35967 | − |
18 | Listeria welshimeri | ATCC 35897 | − |
19 | Shigella flexneri | ATCC 51573 | − |
20 | Salmonella enteritidis | ATCC 14028 | − |
21 | Bacillus thuringiensis | ATCC 10792 | − |
22 | Staphylococcus aureus | ATCC 29213 | − |
23 | Bacillus cereus | ATCC 33019 | − |
24 | Pseudomonas aeruginosa | 0034 (Laboratory isolate) | − |
25 | Enterobacter cloacae | 0061 (Laboratory isolate) | − |
26 | Vibrio alginolyticus | ATCC 33787 | − |
27 | Vibrio parahemolyticus | ATCC 33847 | − |
28 | Klebsiella oxytoca | ATCC 700324 | − |
29 | Cronobacter sakazakii | ATCC 45401 | − |
30 | Proteus mirabilis | 0058 (Laboratory isolate) | − |
31 | Campylobacter jejuni | ATCC 33560 | − |
32 | Escherichia coli O157:H7 | b CICC 10670 | − |
Sample No. | Sample Name | Test Results by National Standard Method | Crispr/cas 12a Test Results (Fluorescence Intensity × 105) |
---|---|---|---|
1 | Drumstick | − | 0.3212 |
2 | Chicken breast | − | 0.3434 |
3 | Pork collar butt | − | 0.4112 |
4 | Pig back | − | 0.3718 |
5 | Cattle shoulder rib | − | 0.2998 |
6 | Cattle plate tendon | + | 1.6975 |
7 | Neck end | − | 0.3661 |
8 | Short loin | − | 0.3843 |
9 | Cololabis saira | − | 0.4611 |
10 | Mackerel | − | 0.3817 |
11 | Oncorhynchus sp. | − | 0.4712 |
12 | Carp | − | 0.3447 |
13 | Salmon | − | 0.4216 |
14 | Prawns | − | 0.3599 |
15 | Yoghourt 1 | − | 0.3989 |
16 | Yoghourt 2 | − | 0.4217 |
17 | Juice 1 | − | 0.3556 |
18 | Juice 2 | − | 0.4152 |
19 | Beer 1 | − | 0.4813 |
20 | Beer 2 | − | 0.3414 |
21 | Cheese | − | 0.2899 |
22 | Pure milk | − | 0.3214 |
23 | Soymilk | − | 0.4461 |
24 | Whole milk powder 1 | − | 0.3245 |
25 | Whole milk powder 2 | − | 0.3715 |
26 | Skim milk powder 1 | − | 0.4211 |
27 | Skim milk powder 2 | + | 1.7516 |
28 | Water | − | 0.3240 |
Description | Sequence (5′-3′) |
---|---|
L. MONOCYTOGENES-F | GTAAGTGGGAAATCTGTCTCAGGTGATGTAGA |
L. MONOCYTOGENES-R | AGTTCCCATTGCCTATACAACAAACTTCTTAAAAG |
crDNA-F | GAAATTAATACGACTCACTATAGGG |
crDNA-R | ACTTCATCTTTTGCGGAGCCACCGATCTACAACAG TAGAAATTCCCTATAGTGAGTCGTATTAATTTC |
probe | FAM-CACCGACGGCGAGACCGACTTT-TAMARA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, Y.; Kong, X.; Yang, J.; Xue, J.; Niu, B.; Chen, Q. Rapid Nucleic Acid Detection of Listeria monocytogenes Based on RAA-CRISPR Cas12a System. Int. J. Mol. Sci. 2024, 25, 3477. https://doi.org/10.3390/ijms25063477
Yang Y, Kong X, Yang J, Xue J, Niu B, Chen Q. Rapid Nucleic Acid Detection of Listeria monocytogenes Based on RAA-CRISPR Cas12a System. International Journal of Molecular Sciences. 2024; 25(6):3477. https://doi.org/10.3390/ijms25063477
Chicago/Turabian StyleYang, Yujuan, Xiangxiang Kong, Jielin Yang, Junxin Xue, Bing Niu, and Qin Chen. 2024. "Rapid Nucleic Acid Detection of Listeria monocytogenes Based on RAA-CRISPR Cas12a System" International Journal of Molecular Sciences 25, no. 6: 3477. https://doi.org/10.3390/ijms25063477
APA StyleYang, Y., Kong, X., Yang, J., Xue, J., Niu, B., & Chen, Q. (2024). Rapid Nucleic Acid Detection of Listeria monocytogenes Based on RAA-CRISPR Cas12a System. International Journal of Molecular Sciences, 25(6), 3477. https://doi.org/10.3390/ijms25063477