Polysaccharide from Artocarpus heterophyllus Lam. (Jackfruit) Pulp Ameliorates Dextran Sodium Sulfate-Induced Enteritis in Rats
Abstract
1. Introduction
2. Results
2.1. JFP-Ps Alleviated the Damage of Small Intestinal Mucosa
2.2. JFP-Ps Enhanced the Antioxidant Activities
2.3. JFP-Ps Improved Inflammatory Cytokine Homeostasis in the Intestine
2.4. JFP-Ps Decreased the Expression of the Genes Associated with Inflammation
2.5. JFP-Ps Enhanced the Expression of the Tight Junction Protein in the Small Intestine
2.6. JFP-Ps Modulated the TLR4/MAPK Signaling Pathway in the Rats’ Small Intestines
3. Discussion
4. Materials and Methods
4.1. Preparation of JFP-Ps
4.2. Materials and Reagents
4.3. Experimental Animal Model
4.4. Histological Analysis
4.5. Cytokine Analysis
4.6. Antioxidant Activity Assays
4.7. mRNA Quantification
4.8. Protein Quantification and Western Blotting
4.9. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Turner, J.R. Intestinal mucosal barrier function in health and disease. Nat. Rev. Immunol. 2009, 9, 799–809. [Google Scholar] [CrossRef]
- Ganesan, K.; Quiles, J.L.; Daglia, M.; Xiao, J.; Xu, B. Dietary phytochemicals modulate intestinal epithelial barrier dysfunction and autoimmune diseases. Food Front. 2021, 2, 357–382. [Google Scholar] [CrossRef]
- Zhou, C.-B.; Zhou, Y.-L.; Fang, J.-Y. Gut microbiota in cancer immune response and immunotherapy. Trends Cancer 2021, 7, 647–660. [Google Scholar] [CrossRef]
- Huo, J.; Wu, Z.; Sun, W.; Wang, Z.; Wu, J.; Huang, M.; Wang, B.; Sun, B. Protective effects of natural polysaccharides on intestinal barrier injury: A review. J. Agric. Food Chem. 2022, 70, 711–735. [Google Scholar] [CrossRef]
- Peron, G.; Hidalgo-Liberona, N.; González-Domínguez, R.; Garcia-Aloy, M.; Guglielmetti, S.; Bernardi, S.; Kirkup, B.; Kroon, P.A.; Cherubini, A.; Riso, P. Exploring the molecular pathways behind the effects of nutrients and dietary polyphenols on gut microbiota and intestinal permeability: A perspective on the potential of metabolomics and future clinical applications. J. Agric. Food Chem. 2019, 68, 1780–1789. [Google Scholar] [CrossRef]
- Fang, Q.-Y.; Chen, S.-P.; Wang, J.-Q.; Huang, X.-J.; Nie, Q.-X.; Phillips, G.O.; Cui, S.W.; Li, Y.-J.; Nie, S.-P. Fractions from natural Cordyceps sinensis alleviated intestinal injury in cyclophosphamide-induced mice. Bioact. Carbohydr. Diet. Fibre 2021, 26, 100271. [Google Scholar] [CrossRef]
- Zhuang, S.; Zhong, J.; Bian, Y.; Fan, Y.; Chen, Q.; Liu, P.; Liu, Z. Rhein ameliorates lipopolysaccharide-induced intestinal barrier injury via modulation of Nrf2 and MAPKs. Life Sci. 2019, 216, 168–175. [Google Scholar] [CrossRef]
- Yang, W.; Zhao, P.; Li, X.; Guo, L.; Gao, W. The potential roles of natural plant polysaccharides in inflammatory bowel disease: A review. Carbohydr. Polym. 2022, 277, 118821. [Google Scholar] [CrossRef]
- Song, Q.; Wang, Y.; Huang, L.; Shen, M.; Yu, Y.; Yu, Q.; Chen, Y.; Xie, J. Review of the relationships among polysaccharides, gut microbiota, and human health. Food Res. Int. 2021, 140, 109858. [Google Scholar] [CrossRef]
- Jia, J.; Zhang, P.; Zhang, C.; Jiang, G.; Zheng, W.; Song, S.; Ai, C. Sulfated polysaccharides from pacific abalone attenuated DSS-induced acute and chronic ulcerative colitis in mice via regulating intestinal micro-ecology and the NF-κB pathway. Food Funct. 2021, 12, 11351–11365. [Google Scholar] [CrossRef]
- Xie, Y.; Wang, L.; Sun, H.; Wang, Y.; Yang, Z.; Zhang, G.; Jiang, S.; Yang, W. Polysaccharide from alfalfa activates RAW 264.7 macrophages through MAPK and NF-κB signaling pathways. Int. J. Biol. Macromol. 2019, 126, 960–968. [Google Scholar] [CrossRef]
- Wang, K.; Zhang, H.; Han, Q.; Lan, J.; Chen, G.; Cao, G.; Yang, C. Effects of astragalus and ginseng polysaccharides on growth performance, immune function and intestinal barrier in weaned piglets challenged with lipopolysaccharide. J. Anim. Physiol. Anim. Nutr. 2020, 104, 1096–1105. [Google Scholar] [CrossRef]
- Zou, T.; Yang, J.; Guo, X.; He, Q.; Wang, Z.; You, J. Dietary seaweed-derived polysaccharides improve growth performance of weaned pigs through maintaining intestinal barrier function and modulating gut microbial populations. J. Anim. Sci. Biotechnol. 2021, 12, 28. [Google Scholar] [CrossRef]
- Feng, X.; Du, C.; Wang, C.J.I.J.o.B.M. Structural characterization of polysaccharide from yellow sweet potato and ameliorates DSS-induced mice colitis by active GPR41/MEK/ERK 1/2 signaling pathway. Int. J. Biol. Macromol. 2021, 192, 278–288. [Google Scholar] [CrossRef]
- Zhu, K.; Zhang, Y.; Nie, S.; Xu, F.; He, S.; Gong, D.; Wu, G.; Tan, L. Physicochemical properties and in vitro antioxidant activities of polysaccharide from Artocarpus heterophyllus Lam. pulp. Carbohydr. Polym. 2017, 155, 354–361. [Google Scholar] [CrossRef]
- Tan, Y.-F.; Li, H.-L.; Lai, W.-Y.; Zhang, J.-Q. Crude dietary polysaccharide fraction isolated from jackfruit enhances immune system activity in mice. J. Med. Food 2013, 16, 663–668. [Google Scholar] [CrossRef]
- Wiater, A.; Paduch, R.; Trojnar, S.; Choma, A.; Pleszczyńska, M.; Adamczyk, P.; Pięt, M.; Próchniak, K.; Szczodrak, J.; Strawa, J. The effect of water-soluble polysaccharide from jackfruit (Artocarpus heterophyllus Lam.) on human colon carcinoma cells cultured in vitro. Plants 2020, 9, 103. [Google Scholar] [CrossRef]
- Zeng, S.; Chen, Y.; Wei, C.; Tan, L.; Li, C.; Zhang, Y.; Xu, F.; Zhu, K.; Wu, G.; Cao, J. Protective effects of polysaccharide from Artocarpus heterophyllus Lam.(jackfruit) pulp on non-alcoholic fatty liver disease in high-fat diet rats via PPAR and AMPK signaling pathways. J. Funct. Foods 2022, 95, 105195. [Google Scholar] [CrossRef]
- Zhu, K.; Fan, H.; Zeng, S.; Nie, S.; Zhang, Y.; Tan, L.; Li, C.; Xu, F.; Liu, Q.; Wu, G. Polysaccharide from Artocarpus heterophyllus Lam. (jackfruit) pulp modulates gut microbiota composition and improves short-chain fatty acids production. Food Chem. 2021, 364, 130434. [Google Scholar] [CrossRef]
- Bernardi, S.; Del Bo’, C.; Marino, M.; Gargari, G.; Cherubini, A.; Andrés-Lacueva, C.; Hidalgo-Liberona, N.; Peron, G.; González-Dominguez, R.; Kroon, P. Polyphenols and intestinal permeability: Rationale and future perspectives. J. Agric. Food Chem. 2019, 68, 1816–1829. [Google Scholar] [CrossRef]
- Santaolalla, R.; Abreu, M.T. Innate immunity in the small intestine. Curr. Opin. Gastroenterol. 2012, 28, 124. [Google Scholar] [CrossRef]
- Pawłowska, B.; Sobieszczańska, B.M. Intestinal epithelial barrier: The target for pathogenic Escherichia coli. Adv. Clin. Exp. Med. Off. Organ Wroc. Med. Univ. 2017, 26, 1437–1445. [Google Scholar] [CrossRef]
- Wu, Y.; Tang, L.; Wang, B.; Sun, Q.; Zhao, P.; Li, W. The role of autophagy in maintaining intestinal mucosal barrier. J. Cell. Physiol. 2019, 234, 19406–19419. [Google Scholar] [CrossRef]
- Zeng, S.; Cao, J.; Chen, Y.; Li, C.; Wu, G.; Zhu, K.; Chen, X.; Xu, F.; Liu, Q.; Tan, L. Polysaccharides from Artocarpus heterophyllus Lam.(jackfruit) pulp improves intestinal barrier functions of high fat diet-induced obese rats. Front. Nutr. 2022, 9, 1035619. [Google Scholar] [CrossRef]
- Cui, L.; Guan, X.; Ding, W.; Luo, Y.; Wang, W.; Bu, W.; Song, J.; Tan, X.; Sun, E.; Ning, Q. Scutellaria baicalensis Georgi polysaccharide ameliorates DSS-induced ulcerative colitis by improving intestinal barrier function and modulating gut microbiota. Int. J. Biol. Macromol. 2021, 166, 1035–1045. [Google Scholar] [CrossRef]
- Chen, Y.; Yang, B.; Ross, R.P.; Jin, Y.; Stanton, C.; Zhao, J.; Zhang, H.; Chen, W. Orally administered CLA ameliorates DSS-induced colitis in mice via intestinal barrier improvement, oxidative stress reduction, and inflammatory cytokine and gut microbiota modulation. J. Agric. Food Chem. 2019, 67, 13282–13298. [Google Scholar] [CrossRef]
- Lugrin, J.; Rosenblatt-Velin, N.; Parapanov, R.; Liaudet, L. The role of oxidative stress during inflammatory processes. Biol. Chem. 2014, 395, 203–230. [Google Scholar] [CrossRef]
- Chen, S.; Wu, X.; Tang, S.; Yin, J.; Song, Z.; He, X.; Yin, Y. Eugenol alleviates dextran sulfate sodium-induced colitis independent of intestinal microbiota in mice. J. Agric. Food Chem. 2021, 69, 10506–10514. [Google Scholar] [CrossRef]
- Wang, X.Y.; Yin, J.Y.; Hu, J.L.; Nie, S.P.; Xie, M.Y. Gastroprotective polysaccharide from natural sources: Review on structure, mechanism, and structure–activity relationship. Food Front. 2022, 3, 560–591. [Google Scholar] [CrossRef]
- Mao, G.; Li, Q.; Deng, C.; Wang, Y.; Ding, Y.; Zhang, W.; Chen, Y.; Zhao, T.; Wei, F.; Yang, L. The synergism and attenuation effect of Selenium (Se)-enriched Grifola frondosa (Se)-polysaccharide on 5-Fluorouracil (5-Fu) in Heps-bearing mice. Int. J. Biol. Macromol. 2018, 107, 2211–2216. [Google Scholar] [CrossRef]
- Lu, H.; Shen, M.; Chen, Y.; Yu, Q.; Chen, T.; Xie, J.J.F.R.I. Alleviative effects of natural plant polysaccharides against DSS-induced ulcerative colitis via inhibiting inflammation and modulating gut microbiota. Food Res. Int. 2023, 167, 112630. [Google Scholar] [CrossRef]
- Kimura, I.; Ichimura, A.; Ohue-Kitano, R.; Igarashi, M. Free fatty acid receptors in health and disease. Physiol. Rev. 2020, 100, 171–210. [Google Scholar] [CrossRef]
- Kim, M.H.; Kang, S.G.; Park, J.H.; Yanagisawa, M.; Kim, C.H. Short-chain fatty acids activate GPR41 and GPR43 on intestinal epithelial cells to promote inflammatory responses in mice. Gastroenterology 2013, 145, 396–406.e310. [Google Scholar] [CrossRef]
- Kim, M.; Friesen, L.; Park, J.; Kim, H.M.; Kim, C.H. Microbial metabolites, short-chain fatty acids, restrain tissue bacterial load, chronic inflammation, and associated cancer in the colon of mice. Eur. J. Immunol. 2018, 48, 1235–1247. [Google Scholar] [CrossRef]
- Lin, Y.; Lv, Y.; Mao, Z.; Chen, X.; Chen, Y.; Zhu, B.; Yu, Y.; Ding, Z.; Zhou, F.J.I.J.o.B.M. Polysaccharides from Tetrastigma Hemsleyanum Diels et Gilg ameliorated inflammatory bowel disease by rebuilding the intestinal mucosal barrier and inhibiting inflammation through the SCFA-GPR41/43 signaling pathway. Int. J. Biol. Macromol. 2023, 250, 126167. [Google Scholar] [CrossRef]
- Sanchez-Muñoz, F.; Dominguez-Lopez, A.; Yamamoto-Furusho, J.K. Role of cytokines in inflammatory bowel disease. World J. Gastroenterol. WJG 2008, 14, 4280. [Google Scholar] [CrossRef]
- Li, F.; Han, Y.; Cai, X.; Gu, M.; Sun, J.; Qi, C.; Goulette, T.; Song, M.; Li, Z.; Xiao, H. Dietary resveratrol attenuated colitis and modulated gut microbiota in dextran sulfate sodium-treated mice. Food Funct. 2020, 11, 1063–1073. [Google Scholar] [CrossRef]
- Li, L.; Qiu, N.; Meng, Y.; Wang, C.; Mine, Y.; Keast, R.; Guyonnet, V. Preserved egg white alleviates DSS-induced colitis in mice through the reduction of oxidative stress, modulation of infl ammatory cytokines, NF-κB, MAPK and gut microbiota composition. Food Sci. Hum. Wellness 2023, 12, 312–323. [Google Scholar] [CrossRef]
- He, L.-X.; Wang, J.-B.; Sun, B.; Zhao, J.; Li, L.; Xu, T.; Li, H.; Sun, J.-Q.; Ren, J.; Liu, R. Suppression of TNF-α and free radicals reduces systematic inflammatory and metabolic disorders: Radioprotective effects of ginseng oligopeptides on intestinal barrier function and antioxidant defense. J. Nutr. Biochem. 2017, 40, 53–61. [Google Scholar] [CrossRef]
- Guo, C.; Wang, Y.; Zhang, S.; Zhang, X.; Du, Z.; Li, M.; Ding, K. Crataegus pinnatifida polysaccharide alleviates colitis via modulation of gut microbiota and SCFAs metabolism. Int. J. Biol. Macromol. 2021, 181, 357–368. [Google Scholar] [CrossRef]
- Kanwal, S.; Joseph, T.P.; Aliya, S.; Song, S.; Saleem, M.Z.; Nisar, M.A.; Wang, Y.; Meyiah, A.; Ma, Y.; Xin, Y. Attenuation of DSS induced colitis by Dictyophora indusiata polysaccharide (DIP) via modulation of gut microbiota and inflammatory related signaling pathways. J. Funct. Foods 2020, 64, 103641. [Google Scholar] [CrossRef]
- Gao, W.; Wang, C.; Yu, L.; Sheng, T.; Wu, Z.; Wang, X.; Zhang, D.; Lin, Y.; Gong, Y. Chlorogenic acid attenuates dextran sodium sulfate-induced ulcerative colitis in mice through MAPK/ERK/JNK pathway. BioMed Res. Int. 2019, 2019, 6769789. [Google Scholar] [CrossRef]
- Cao, H.; Liu, J.; Shen, P.; Cai, J.; Han, Y.; Zhu, K.; Fu, Y.; Zhang, N.; Zhang, Z.; Cao, Y. Protective effect of naringin on DSS-induced ulcerative colitis in mice. J. Agric. Food Chem. 2018, 66, 13133–13140. [Google Scholar] [CrossRef]
- Coskun, M.; Olsen, J.; Seidelin, J.B.; Nielsen, O.H. MAP kinases in inflammatory bowel disease. Clin. Chim. Acta 2011, 412, 513–520. [Google Scholar] [CrossRef]
- Xu, D.; Zhuang, L.; Gao, S.; Ma, H.; Cheng, J.; Liu, J.; Liu, D.; Fu, S.; Hu, G. Orally Administered Ginkgolide C Attenuates DSS-Induced Colitis by Maintaining Gut Barrier Integrity, Inhibiting Inflammatory Responses, and Regulating Intestinal Flora. J. Agric. Food Chem. 2022, 70, 14718–14731. [Google Scholar] [CrossRef]
- Barbosa, J.R.; dos Santos Freitas, M.M.; da Silva Martins, L.H.; de Carvalho Junior, R.N. Polysaccharides of mushroom Pleurotus spp.: New extraction techniques, biological activities and development of new technologies. Carbohydr. Polym. 2020, 229, 115550. [Google Scholar] [CrossRef]
- Lu, H.; Shen, M.; Chen, T.; Yu, Y.; Chen, Y.; Yu, Q.; Chen, X.; Xie, J. Mesona chinensis Benth Polysaccharides Alleviate DSS-Induced Ulcerative Colitis via Inhibiting of TLR4/MAPK/NF-κB Signaling Pathways and Modulating Intestinal Microbiota. Mol. Nutr. Food Res. 2022, 66, 2200047. [Google Scholar] [CrossRef]
- Kanwal, S.; Joseph, T.P.; Owusu, L.; Xiaomeng, R.; Meiqi, L.; Yi, X. A polysaccharide isolated from Dictyophora indusiata promotes recovery from antibiotic-driven intestinal dysbiosis and improves gut epithelial barrier function in a mouse model. Nutrients 2018, 10, 1003. [Google Scholar] [CrossRef]
Group | TNF-α (pg/mL) | IL-1β (pg/mL) | IL-6 (pg/mL) | IL-10 (pg/mL) | IFN-γ (pg/mL) |
---|---|---|---|---|---|
Control | 281.22 ± 12.33 | 99.95 ± 7.09 | 106.86 ± 7.54 | 50.27 ± 1.11 | 1364.65 ± 46.68 |
DSS | 325.74 ± 10.71 # | 120.88 ± 5.01 # | 132.06 ± 3.11 # | 46.75 ± 1.47 | 1605.46 ± 46.63 # |
Mesalazine | 306.69 ± 7.84 | 116.94 ± 2.41 # | 119.99 ± 5.36 | 54.18 ± 1.81 * | 1478.45 ± 58.66 |
JFP-Ps-L | 319.32 ± 10.15 # | 120.44 ± 3.80 # | 130.57 ± 3.99 # | 52.97 ± 2.05 * | 1579.04 ± 46.11 # |
JFP-Ps-M | 308.73 ± 2.76 | 117.31 ± 2.97 # | 121.06 ± 2.83 | 54.12 ± 2.04 * | 1569.89 ± 26.93 # |
JFP-Ps-H | 306.99 ± 10.67 | 111.03 ± 1.84 # | 118.63 ± 2.82 | 54.36 ± 0.51 * | 1446.95 ± 55.45 * |
Primer | Forward 5′-3′ | Reverse 5′-3′ |
---|---|---|
β-actin | TGTCACCAACTGGGACGATA | GGGGTGTTGAAGGTCTCAAA |
TLR-4 | GGTTGGCACTCTCACTTCCTCTTG | GTAAATGGTGGCAGGGCAGAGTC |
IL-1β | AATCTCACAGCAGCATCTCGACAAG | TCCACGGGCAAGACATAGGTAGC |
IL-10 | GGCAGTGGAGCAGGTGAAGAATG | TGTCACGTAGGCTTCTATGCAGTTG |
IL-6 | ACTTCCAGCCAGTTGCCTTCTTG | TGGTCTGTTGTGGGTGGTATCCTC |
TNF-α | AAAGGACACCATGAGCACGGAAAG | CGCCACGAGCAGGAATGAGAAG |
GPR41 | TCTGCTCCTCTTCCTGCCATTCC | CGTTCTATGCTCACCGTCATCAGG |
GPR43 | TGCACCATCGTCATCATCGTTCAG | ACCAGGCACAGCTCCAGTCG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, Y.; Chen, Y.; Li, C.; Wu, G.; He, Y.; Tan, L.; Zhu, K. Polysaccharide from Artocarpus heterophyllus Lam. (Jackfruit) Pulp Ameliorates Dextran Sodium Sulfate-Induced Enteritis in Rats. Int. J. Mol. Sci. 2024, 25, 1661. https://doi.org/10.3390/ijms25031661
Li Y, Chen Y, Li C, Wu G, He Y, Tan L, Zhu K. Polysaccharide from Artocarpus heterophyllus Lam. (Jackfruit) Pulp Ameliorates Dextran Sodium Sulfate-Induced Enteritis in Rats. International Journal of Molecular Sciences. 2024; 25(3):1661. https://doi.org/10.3390/ijms25031661
Chicago/Turabian StyleLi, Yunlong, Yuzi Chen, Chuan Li, Gang Wu, Yanfu He, Lehe Tan, and Kexue Zhu. 2024. "Polysaccharide from Artocarpus heterophyllus Lam. (Jackfruit) Pulp Ameliorates Dextran Sodium Sulfate-Induced Enteritis in Rats" International Journal of Molecular Sciences 25, no. 3: 1661. https://doi.org/10.3390/ijms25031661
APA StyleLi, Y., Chen, Y., Li, C., Wu, G., He, Y., Tan, L., & Zhu, K. (2024). Polysaccharide from Artocarpus heterophyllus Lam. (Jackfruit) Pulp Ameliorates Dextran Sodium Sulfate-Induced Enteritis in Rats. International Journal of Molecular Sciences, 25(3), 1661. https://doi.org/10.3390/ijms25031661