Development of a Multiplex RT–qPCR Method for the Identification and Lineage Typing of Porcine Reproductive and Respiratory Syndrome Virus
Abstract
1. Introduction
2. Results
2.1. Establishment of Multiplex RT–qPCR Method
2.1.1. Validation of Single Primer–Probe Combinations
2.1.2. Validation of Two Primer Pools
2.1.3. Optimization of Concentration of Primers and Probes in Two Primer Pools
2.1.4. Optimal Annealing Temperature
2.2. Construction of Standard Curves
2.3. Specificity Tests
2.4. Repeatability Tests
2.5. Sensitivity Tests
2.6. Detection of Clinical Samples
3. Discussion
4. Materials and Methods
4.1. Virus, Nucleic Acids, and Clinical Samples
4.2. Primers and Probes
4.3. Extraction of Nucleic Acids and Construction of Standard Plasmids
4.4. Optimization of Reaction Condition
4.4.1. Validation of Single Primer–Probe Combination and Two Primer Pools
4.4.2. Optimization of Concentration of Primer–Probes in Two Primer Pools
4.4.3. Optimization of Annealing Temperature
4.5. Standard Curve
4.6. Specificity, Repeatability and Sensitivity
4.7. Detection of Clinical Sample
5. Conclusions
6. Patents
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Boeters, M.; Garcia-Morante, B.; van Schaik, G.; Segalés, J.; Rushton, J.; Steeneveld, W. The Economic Impact of Endemic Respiratory Disease in Pigs and Related Interventions—A Systematic Review. Porcine Health Manag. 2023, 9, 45. [Google Scholar] [CrossRef] [PubMed]
- Clilverd, H.; Martín-Valls, G.; Li, Y.; Martín, M.; Cortey, M.; Mateu, E. Infection Dynamics, Transmission, and Evolution after an Outbreak of Porcine Reproductive and Respiratory Syndrome Virus. Front. Microbiol. 2023, 14, 1109881. [Google Scholar] [CrossRef] [PubMed]
- Rossow, K.D. Porcine Reproductive and Respiratory Syndrome. Vet. Pathol. 1998, 35, 1–20. [Google Scholar] [CrossRef]
- Zhao, D.; Yang, B.; Yuan, X.; Shen, C.; Zhang, D.; Shi, X.; Zhang, T.; Cui, H.; Yang, J.; Chen, X.; et al. Advanced Research in Porcine Reproductive and Respiratory Syndrome Virus Co-Infection With Other Pathogens in Swine. Front. Vet. Sci. 2021, 8, 699561. [Google Scholar] [CrossRef]
- Ruedas-Torres, I.; Rodríguez-Gómez, I.M.; Sánchez-Carvajal, J.M.; Larenas-Muñoz, F.; Pallarés, F.J.; Carrasco, L.; Gómez-Laguna, J. The Jigsaw of PRRSV Virulence. Vet. Microbiol. 2021, 260, 109168. [Google Scholar] [CrossRef] [PubMed]
- Dokland, T. The Structural Biology of PRRSV. Virus Res. 2010, 154, 86–97. [Google Scholar] [CrossRef]
- Lunney, J.K.; Fang, Y.; Ladinig, A.; Chen, N.; Li, Y.; Rowland, B.; Renukaradhya, G.J. Porcine Reproductive and Respiratory Syndrome Virus (PRRSV): Pathogenesis and Interaction with the Immune System. Annu. Rev. Anim. Biosci. 2016, 4, 129–154. [Google Scholar] [CrossRef]
- Guo, Z.; Chen, X.; Li, R.; Qiao, S.; Zhang, G. The Prevalent Status and Genetic Diversity of Porcine Reproductive and Respiratory Syndrome Virus in China: A Molecular Epidemiological Perspective. Virol. J. 2018, 15, 2. [Google Scholar] [CrossRef]
- Brinton, M.A.; Gulyaeva, A.A.; Balasuriya, U.B.R.; Dunowska, M.; Faaberg, K.S.; Goldberg, T.; Leung, F.C.C.; Nauwynck, H.J.; Snijder, E.J.; Stadejek, T.; et al. ICTV Virus Taxonomy Profile: Arteriviridae 2021. J Gen. Virol. 2021, 102, 001632. [Google Scholar] [CrossRef]
- Sun, Q.; Xu, H.; An, T.; Cai, X.; Tian, Z.; Zhang, H. Recent Progress in Studies of Porcine Reproductive and Respiratory Syndrome Virus 1 in China. Viruses 2023, 15, 1528. [Google Scholar] [CrossRef]
- Shi, M.; Lam, T.T.-Y.; Hon, C.-C.; Murtaugh, M.P.; Davies, P.R.; Hui, R.K.-H.; Li, J.; Wong, L.T.-W.; Yip, C.-W.; Jiang, J.-W.; et al. Phylogeny-Based Evolutionary, Demographical, and Geographical Dissection of North American Type 2 Porcine Reproductive and Respiratory Syndrome Viruses. J. Virol. 2010, 84, 8700–8711. [Google Scholar] [CrossRef]
- Jiang, Y.; Li, G.; Yu, L.; Li, L.; Zhang, Y.; Zhou, Y.; Tong, W.; Liu, C.; Gao, F.; Tong, G. Genetic Diversity of Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) From 1996 to 2017 in China. Front. Microbiol. 2020, 11, 618. [Google Scholar] [CrossRef] [PubMed]
- Zhang, R.; Li, H.; Xie, H.; Hou, X.; Zhou, L.; Cao, A.; Zeshan, B.; Zhou, Y.; Wang, X. Comparing the Molecular Evolution and Recombination Patterns of Predominant PRRSV-2 Lineages Co-Circulating in China. Front. Microbiol. 2024, 15, 1398470. [Google Scholar] [CrossRef] [PubMed]
- Gao, J.-C.; Xiong, J.-Y.; Ye, C.; Chang, X.-B.; Guo, J.-C.; Jiang, C.-G.; Zhang, G.-H.; Tian, Z.-J.; Cai, X.-H.; Tong, G.-Z.; et al. Genotypic and Geographical Distribution of Porcine Reproductive and Respiratory Syndrome Viruses in Mainland China in 1996–2016. Vet. Microbiol. 2017, 208, 164–172. [Google Scholar] [CrossRef] [PubMed]
- Yin, B.; Qi, S.; Sha, W.; Qin, H.; Liu, L.; Yun, J.; Zhu, J.; Li, G.; Sun, D. Molecular Characterization of the Nsp2 and ORF5 (ORF5a) Genes of PRRSV Strains in Nine Provinces of China During 2016-2018. Front. Vet. Sci. 2021, 8, 605832. [Google Scholar] [CrossRef]
- Luo, Q.; Zheng, Y.; He, Y.; Li, G.; Zhang, H.; Sha, H.; Zhang, Z.; Huang, L.; Zhao, M. Genetic Variation and Recombination Analysis of the GP5 (GP5a) Gene of PRRSV-2 Strains in China from 1996 to 2022. Front. Microbiol. 2023, 14, 1238766. [Google Scholar] [CrossRef]
- Liu, B.; Luo, L.; Shi, Z.; Ju, H.; Yu, L.; Li, G.; Cui, J. Research Progress of Porcine Reproductive and Respiratory Syndrome Virus NSP2 Protein. Viruses 2023, 15, 2310. [Google Scholar] [CrossRef]
- Pan, J.; Zeng, M.; Zhao, M.; Huang, L. Research Progress on the Detection Methods of Porcine Reproductive and Respiratory Syndrome Virus. Front. Microbiol. 2023, 14, 1097905. [Google Scholar] [CrossRef]
- Singh, C.; Roy-Chowdhuri, S. Quantitative Real-Time PCR: Recent Advances. In Clinical Applications of PCR; Luthra, R., Singh, R.R., Patel, K.P., Eds.; Springer: New York, NY, USA, 2016; pp. 161–176. ISBN 978-1-4939-3360-0. [Google Scholar]
- Chen, N.; Ye, M.; Xiao, Y.; Li, S.; Huang, Y.; Li, X.; Tian, K.; Zhu, J. Development of Universal and Quadruplex Real-Time RT-PCR Assays for Simultaneous Detection and Differentiation of Porcine Reproductive and Respiratory Syndrome Viruses. Transbound. Emerg. Dis. 2019, 66, 2271–2278. [Google Scholar] [CrossRef]
- Ruan, S.; Ren, W.; Yu, B.; Yu, X.; Wu, H.; Li, W.; Jiang, Y.; He, Q. Development and Implementation of a Quadruple RT-qPCR Method for the Identification of Porcine Reproductive and Respiratory Syndrome Virus Strains. Viruses 2023, 15, 1946. [Google Scholar] [CrossRef]
- GB/T 35912-2018; Real-Time RT-PCR Method for Detection of Porcine Reproductive and Respiratory Syndrome Virus. Standards Press of China: Beijing, China, 2018.
- Yang, K.; Tian, Y.; Zhou, D.; Duan, Z.; Guo, R.; Liu, Z.; Yuan, F.; Liu, W. A Multiplex RT-PCR Assay to Detect and Discriminate Porcine Reproductive and Respiratory Syndrome Viruses in Clinical Specimens. Viruses 2017, 9, 205. [Google Scholar] [CrossRef] [PubMed]
- Long, F.; Chen, Y.; Shi, K.; Yin, Y.; Feng, S.; Si, H. Development of a Multiplex Crystal Digital RT-PCR for Differential Detection of Classical, Highly Pathogenic, and NADC30-like Porcine Reproductive and Respiratory Syndrome Virus. Animals 2023, 13, 594. [Google Scholar] [CrossRef] [PubMed]
- Qiu, W.; Meng, K.; Liu, Y.; Zhang, Y.; Wang, Z.; Chen, Z.; Yang, J.; Sun, W.; Guo, L.; Ren, S.; et al. Simultaneous Detection of Classical PRRSV, Highly Pathogenic PRRSV and NADC30-like PRRSV by TaqMan Probe Real-Time PCR. J. Virol. Methods 2020, 282, 113774. [Google Scholar] [CrossRef]
- Zhang, H.; Luo, Q.; He, Y.; Zheng, Y.; Sha, H.; Li, G.; Kong, W.; Liao, J.; Zhao, M. Research Progress on the Development of Porcine Reproductive and Respiratory Syndrome Vaccines. Vet. Sci. 2023, 10, 491. [Google Scholar] [CrossRef]
- Caserta, L.C.; Zhang, J.; Piñeyro, P.; Diel, D.G. Rapid Genotyping of Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) Using MinION Nanopore Sequencing. PLoS ONE 2023, 18, e0282767. [Google Scholar] [CrossRef] [PubMed]
- Cui, X.-Y.; Xia, D.-S.; Luo, L.-Z.; An, T.-Q. Recombination of Porcine Reproductive and Respiratory Syndrome Virus: Features, Possible Mechanisms, and Future Directions. Viruses 2024, 16, 929. [Google Scholar] [CrossRef]
- Ouyang, Y.; Du, Y.; Zhang, H.; Guo, J.; Sun, Z.; Luo, X.; Mei, X.; Xiao, S.; Fang, L.; Zhou, Y. Genetic Characterization and Pathogenicity of a Recombinant Porcine Reproductive and Respiratory Syndrome Virus Strain in China. Viruses 2024, 16, 993. [Google Scholar] [CrossRef]
- Wang, X.; Zhang, K.; Mo, Q.; Chen, G.; Lv, J.; Huang, J.; Pang, Y.; Wang, H.; Liu, W.; Huang, K.; et al. The Emergence and Pathogenesis of Recombinant Viruses Associated with NADC34-like Strains and the Predominant Circulating Strains of Porcine Reproductive and Respiratory Syndrome Virus in Southern China. Viruses 2022, 14, 1695. [Google Scholar] [CrossRef]
- Tian, K.; Yu, X.; Zhao, T.; Feng, Y.; Cao, Z.; Wang, C.; Hu, Y.; Chen, X.; Hu, D.; Tian, X.; et al. Emergence of Fatal PRRSV Variants: Unparalleled Outbreaks of Atypical PRRS in China and Molecular Dissection of the Unique Hallmark. PLoS ONE 2007, 2, e526. [Google Scholar] [CrossRef]
- Liu, Z.; Li, C.; Hu, Y.; Fang, S.; Li, X.; Zhang, C.; Huang, L.; Qian, J.; Wang, G.; Fan, A.; et al. Protective Evaluation of the Commercialized Porcine Reproductive and Respiratory Syndrome Virus Vaccines in Piglets Challenged by NADC34-like Strain. Front. Microbiol. 2024, 15, 1422335. [Google Scholar] [CrossRef]
- Yim-Im, W.; Anderson, T.K.; Paploski, I.A.D.; VanderWaal, K.; Gauger, P.; Krueger, K.; Shi, M.; Main, R.; Zhang, J. Refining PRRSV-2 Genetic Classification Based on Global ORF5 Sequences and Investigation of Their Geographic Distributions and Temporal Changes. Microbiol. Spectr. 2023, 11, e0291623. [Google Scholar] [CrossRef] [PubMed]
- Rupasinghe, R.; Lee, K.; Liu, X.; Gauger, P.C.; Zhang, J.; Martínez-López, B. Molecular Evolution of Porcine Reproductive and Respiratory Syndrome Virus Field Strains from Two Swine Production Systems in the Midwestern United States from 2001 to 2020. Microbiol. Spectr. 2022, 10, e0263421. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Zhao, J.; Li, W.; Xu, H.; Gong, B.; Sun, Q.; Guo, Z.; Li, J.; Xiang, L.; Tang, Y.-D.; et al. Prevalence and Genetic Evolution of Porcine Reproductive and Respiratory Syndrome Virus in Commercial Fattening Pig Farms in China. Porcine Health Manag. 2024, 10, 5. [Google Scholar] [CrossRef] [PubMed]
- Krasnikov, N.; Yuzhakov, A.; Aliper, T.; Gulyukin, A. Metagenomic Approach Reveals the Second Subtype of PRRSV-1 in a Pathogen Spectrum during a Clinical Outbreak with High Mortality in Western Siberia, Russia. Viruses 2023, 15, 565. [Google Scholar] [CrossRef] [PubMed]



| Primer Pool A | Primer Pool B | |||||||
|---|---|---|---|---|---|---|---|---|
| PRRSV2 | HP-PRRSV | NADC30 | NADC34 | PRRSV1 | QYYZ | VR-2332 | ||
| Plasmid Templates | PRRSV2-M | 26.1 1 | - | - | - | - | - | - |
| HP-PRRSV-nsp2 | - | 24.26 | - | - | - | - | - | |
| NADC30-nsp2 | - | - | 24.93 | - | - | - | - | |
| NADC34-nsp2 | - | - | - | 24.36 | - | - | - | |
| PRRSV1-M | - | - | - | - | 25.17 | - | - | |
| QYYZ-nsp2 | - | - | - | - | - | 24.72 | - | |
| VR-2332-nsp2 | - | - | - | - | - | - | 26.06 | |
| Mixed plasmids 2 | 30.14 | 28.67 | 28.35 | 28.11 | 29.18 | 29.42 | 30.46 | |
| Primer Pool | Plasmid Templates | Copies of Plasmids (Copies/μL) | Ct Value 1 | CV (%) | CI 2 |
|---|---|---|---|---|---|
| A | PRRSV2-M | 105 | 18.80 ± 0.12 | 0.66 | [18.75, 18.85] |
| HP-PRRSV-nsp2 | 105 | 18.46 ± 0.18 | 0.96 | [18.39, 18.53] | |
| NADC30-nsp2 | 105 | 19.23 ± 0.08 | 0.40 | [19.20, 19.26] | |
| NADC34-nsp2 | 105 | 18.66 ± 0.14 | 0.74 | [18.61, 18.72] | |
| PRRSV2-M | 102 | 30.23 ± 0.51 | 1.70 | [30.02, 30.43] | |
| HP-PRRSV-nsp2 | 102 | 29.93 ± 0.30 | 0.99 | [29.81, 30.05] | |
| NADC30-nsp2 | 102 | 30.73 ± 0.50 | 1.62 | [30.53, 30.93] | |
| NADC34-nsp2 | 102 | 30.15 ± 0.64 | 2.12 | [29.90, 30.41] | |
| B | PRRSV1-M | 105 | 19.33 ± 0.18 | 0.92 | [19.25, 19.40] |
| QYYZ-nsp2 | 105 | 18.96 ± 0.08 | 0.40 | [18.93, 18.99] | |
| VR2332-nsp2 | 105 | 19.61 ± 0.23 | 1.15 | [19.52, 19.70] | |
| PRRSV1-M | 102 | 30.92 ± 0.58 | 1.87 | [30.69, 31.15] | |
| QYYZ-nsp2 | 102 | 30.51 ± 0.56 | 1.85 | [30.29, 30.74] | |
| VR2332-nsp2 | 102 | 30.91 ± 0.55 | 1.79 | [30.68, 31.13] |
| Primer Pool | Plasmid Templates | Positive Rates (%) | |||
|---|---|---|---|---|---|
| (10 Copies/μL) | (5 Copies/μL) | (1 Copies/μL) | (0.5 Copies/μL) | ||
| A | PRRSV2-M | 100 | 100 | 10 | 15 |
| HP-PRRSV-nsp2 | 100 | 100 | 60 | 25 | |
| NADC30-nsp2 | 100 | 95 | 30 | 0 | |
| NADC34-nsp2 | 100 | 95 | 20 | 5 | |
| B | PRRSV1-M | 100 | 95 | 20 | 0 |
| QYYZ-nsp2 | 100 | 100 | 40 | 0 | |
| VR2332-nsp2 | 100 | 100 | 50 | 0 | |
| Kappa Test | Developed Method | Total | ||
|---|---|---|---|---|
| + | − | |||
| Reference method | + | 75 | 1 | 76 |
| − | 2 | 26 | 28 | |
| Total | 77 | 27 | 104 | |
| Primers/Probes | Targets | Sequences (5′–3′) | Positions 2 | Reference Strains |
|---|---|---|---|---|
| PRRSV1-F 1 | PRRSV-1 | CAGATGCAGATTGTGTTGCCT | 14344–14364 | OP566682.1 |
| PRRSV1-R | CGGGCTTTCTCACAGCGTA | 14450–14468 | ||
| PRRSV1-P | VIC-CCTGCAGCACTTTCTACG-MGB | 14398–14415 | ||
| PRRSV2-F | PRRSV-2 | TGCTAGGCCGCAAGTACAT | 14592–14610 | KY761966.1 |
| PRRSV2-R | GGACGCCGGACGACAAA | 14681–14697 | ||
| PRRSV2-P | Cy5-CTGGCCCCTGCCCACCAC-BHQ2 | 14612–14629 | ||
| HP-PRRSV-F | HP-PRRSV-like | CTATTACCCTGCACAAGGTGAC | 2349–2370 | KY761966.1 |
| HP-PRRSV-R | GTGGACATGAGCCCATATTCTTC | 2431–2453 | ||
| HP-PRRSV-P | ROX-TCTTCCAACTTAGAGAGTACG-MGB | 2400–2420 | ||
| NADC30-F | NADC30-like | GATAGGGTGGAYATGCTAACCTG | 2993–3015 | OM293961.1 |
| NADC30-R | GCATCATCACAAACCCGCAAG | 3108–3128 | ||
| NADC30-P | FAM-ATGATACTCGAAACACC-MGB | 3080–3096 | ||
| NADC34-F | NADC34-like | GTCGCTGGCAAGTACCTG | 1089–1106 | OL516348.1 |
| NADC34-R | CTGTACAAYGATGGGTCCAC | 1153–1172 | ||
| NADC34-P | VIC-TCGTGTCAGTCACTGC-MGB | 1137–1152 | ||
| QYYZ-F | QYYZ-like | CACGCAGGAGTGGCTTTC | 3311–3328 | MN046242.1 |
| QYYZ-R | CTCGAGAATCATCTTTGGGAGG | 3416–3437 | ||
| QYYZ-P | ROX-CGCATGTGGGACAGGGTTGAC-BHQ2 | 3330–3350 | ||
| VR-2332-F | VR-2332-like | CACGCTCTTGTGCGACTG | 1361–1378 | MT746146.1 |
| VR-2332-R | CGGGGAGTAGTGTTTGAGGT | 1463–1482 | ||
| VR-2332-P | Cy5-CCGCGCTTTGTCCGTTCGTGA-BHQ2 | 1392–1412 |
| Reaction Components | Volume (μL) |
|---|---|
| 2 × Hifair® Ⅲ P buffer | 10 |
| Hifair® UH Ⅲ Enzymes | 1 |
| PRRSV2-F/R | 0.2/0.3/0.4/0.5/0.6 2 |
| PRRSV2-P | 0.4 |
| HP-PRRSV-F/R/P 1 | 0.4 |
| NADC30-F/R/P | 0.4 |
| NADC34-F/R/P | 0.4 |
| plasmid templates | 3 |
| nuclease-free water | up to 20 μL |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tao, C.; Zhu, X.; Huang, Y.; Yuan, W.; Wang, Z.; Zhu, H.; Jia, H. Development of a Multiplex RT–qPCR Method for the Identification and Lineage Typing of Porcine Reproductive and Respiratory Syndrome Virus. Int. J. Mol. Sci. 2024, 25, 13203. https://doi.org/10.3390/ijms252313203
Tao C, Zhu X, Huang Y, Yuan W, Wang Z, Zhu H, Jia H. Development of a Multiplex RT–qPCR Method for the Identification and Lineage Typing of Porcine Reproductive and Respiratory Syndrome Virus. International Journal of Molecular Sciences. 2024; 25(23):13203. https://doi.org/10.3390/ijms252313203
Chicago/Turabian StyleTao, Chunhao, Xizhou Zhu, Ying Huang, Weifeng Yuan, Zhen Wang, Hongfei Zhu, and Hong Jia. 2024. "Development of a Multiplex RT–qPCR Method for the Identification and Lineage Typing of Porcine Reproductive and Respiratory Syndrome Virus" International Journal of Molecular Sciences 25, no. 23: 13203. https://doi.org/10.3390/ijms252313203
APA StyleTao, C., Zhu, X., Huang, Y., Yuan, W., Wang, Z., Zhu, H., & Jia, H. (2024). Development of a Multiplex RT–qPCR Method for the Identification and Lineage Typing of Porcine Reproductive and Respiratory Syndrome Virus. International Journal of Molecular Sciences, 25(23), 13203. https://doi.org/10.3390/ijms252313203

